Expression of angiopoietins and vascular endothelial growth factors and their clinical significance in acute myeloid leukemia

Available online at www.sciencedirect.com

Leukemia Research 32 (2008) 904–912

Expression of angiopoietins and vascular endothelial growth factors and their clinical significance in acute myeloid leukemia Hsin-An Hou a , Wen-Chien Chou a,b , Liang-In Lin c , Jih-Luh Tang a , Mei-Hsuan Tseng a , Chi-Fei Huang a , Ming Yao a , Chien-Yuan Chen a , Woei Tsay a , Hwei-Fang Tien a,∗ a

Division of Hematology, Department of Internal Medicine, National Taiwan University Hospital, College of Medicine, National Taiwan University, Taipei, Taiwan b Department of Laboratory Medicine, National Taiwan University Hospital, College of Medicine, National Taiwan University, Taipei, Taiwan c Department of Clinical Laboratory Sciences and Medical Biotechnology, College of Medicine, National Taiwan University, Taipei, Taiwan Received 20 June 2007; received in revised form 27 July 2007; accepted 10 August 2007 Available online 29 September 2007

Abstract Angiogenic factors play an essential role in normal and pathologic angiogenesis, but their clinical role in acute myeloid leukemia (AML) remains unclear. We investigated the expression of Ang-1, Ang-2, Tie2, VEGF-A, and VEGF-C genes in bone marrow (BM) mononuclear cells by real-time quantitative PCR (RQ-PCR) in a cohort of 126 patients with newly diagnosed de novo AML and normal marrow donors. Here we show that high pre-treatment levels of Ang-2 in the BM indicate an unfavorable prognosis in AML. Only karyotype (hazard ratio 2.19, 95% CI 1.25–3.42, P = 0.005) and expression of Ang-2 (hazard ratio 2.05, 95% CI 1.20–3.52, P = 0.009), but not other angiogenic factors, were independent prognostic factors for overall survival by multivariate analysis. The prognostic significance of Ang-2 expression was more obvious in the subgroup of patients with intermediate-risk cytogenetics. Subgroup analysis showed that Ang-2 expression had prognostic impact on patients with low (but not high) Ang-1 or Tie2 levels, and on patients with high (but not low) VEGF-A or VEGF-C levels. © 2007 Elsevier Ltd. All rights reserved. Keywords: Angiopoietin; Vascular endothelial growth factor; Acute myeloid leukemia; Survival

1. Introduction Angiogenesis is not only required for growth, progression, and metastasis of solid tumors but also plays a crucial role in hematologic malignancies [1–3]. Studies show that microvessel density (MVD) is significantly increased in patients with newly diagnosed acute myeloid leukemia (AML) compared with control subjects, and returns to a normal level after complete remission (CR) is achieved [4–7]. The mutual ∗ Corresponding author at: Department of Internal Medicine, National Taiwan University Hospital, No. 7, Chung-Shan South Road, Taipei 100, Taiwan. Tel.: +886 2 2312 3456x3955; fax: +886 2 2395 9583. E-mail address: [email protected] (H.-F. Tien).

0145-2126/$ – see front matter © 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.leukres.2007.08.010

and coordinated interaction of growth factor and angiogenic cytokines from bone marrow (BM) endothelial cells and leukemia cells is thought to contribute to the pathogenesis of AML [7–10]. Although many angiogenic factors with autocrine and paracrine regulatory effects on the hematopoietic system have been identified in AML, the most important include vascular endothelial growth factor (VEGF) and the angiopoietin (Ang)-Tie2 receptor family [11–14]. Ang represents a family of extracellular ligands that specifically recognize and bind to a receptor tyrosine kinase, Tie2 [15]. Ang-1 acts as a stabilizing and maturation factor for vasculature, maintaining cell–cell interaction and antiapoptosis by autophosphorylation of Tie2 [16]. Ang-2, a natural antagonist for Ang-1 [17], mediates a destabilizing signal for

H.-A. Hou et al. / Leukemia Research 32 (2008) 904–912

vessel integrity and facilitates regression of vessels in the absence of VEGF or other mitogenic factors. In the presence of VEGF, however, Ang-2 induces an angiogenic response [18]. Hence, both Ang-1 and Ang-2 have crucial, but different functions in angiogenesis regulation defined by the quantitative balance between these factors and other angiogenic factors. Expression of Ang and VEGF correlate well with clinical features and outcome of patients with solid cancers [19–21]. The reports concerning clinical implications of Ang and Tie2 expression and their interaction with VEGFs are limited in acute leukemia. Loges et al. [22] demonstrated that RNA expression of Ang-2 in peripheral blasts from AML patients represents an independent prognostic factor for overall survival, especially in cohorts with low VEGF-C and Ang-1 RNA levels. Whether this is also true for BM blasts remains unknown. Since the BM is the site where the majority of AML cells proliferate and accumulate, it will be of interest to study the expression of angiogenic factors in the BM. In this study, we evaluated the expression of Ang-1, Ang-2, Tie2, VEGF-A, and VEGF-C by real-time quantitative polymerase chain reaction (RQ-PCR) in the pre-treated BM leukemia cells of 126 adult patients with de novo AML. Correlation between expression of angiogenic factors and clinical features, relapse-free survival, and overall survival were also analyzed.

2. Patients and methods 2.1. Patients and samples We recruited 126 adult patients (>15 years) with de novo AML diagnosed between June 1995 and February 2006 at the National Taiwan University Hospital. Expression of Ang-1, Ang-2, Tie2, VEGF-A, and VEGF-C in BM leukemia cells was determined before treatment. All patients were treated with standard induction chemotherapy (3 days of an anthracycline [idarubicin or daunorubicin] and 7 days of cytarabine) and received consolidation therapy with high dose cytarabine with or without the anthracycline after achieving CR. Forty patients underwent allogeneic hematopoietic stem cell transplantation from siblings or unrelated donors. The median follow-up duration was 35 months. Patients with t(15;17) were excluded from the study. This study protocol was approved by the Institutional Review Board of the National Taiwan University Hospital and all patients gave their informed consent to participate in the study.

905

2.2. Real-time quantitative polymerase chain reaction BM mononuclear cells from 126 patients and 22 healthy transplantation donors were isolated and total RNA was extracted and reverse transcribed as previously described [23]. RQ-PCR was performed using the method described previously [24]. Every sample was tested at least twice independently. The amount of the target genes was normalized to the housekeeping gene RPLP0. The copies of target gene were quantified only after successful amplification of the internal control, using standard curves derived from cloned plasmids. All data were presented as log ratio of the target gene/RPLP0. The sequences of primers and probes of different angiogenic factors are listed in Table 1. 2.3. Immunocytochemical staining for Ang-2 protein To assess the Ang-2 protein expression in leukemia blasts, immunocytochemical staining was performed by immunoperoxidase technique using avidin–biotinperoxidase complex (ABC) [25]. Cytospin smears of BM leukemia cells from nine patients were fixed for 3 min in formalin acetone (3%). The specimen was then incubated with peroxidase blocking enzyme (20 min), followed by goat polyclonal antibody against the C-terminus peptide of human Ang2 (1:50 in blocking solution, 1 h at room temperature; Santa Cruz Biotechnology, Santa Cruz, CA). Biotinylated donkey anti-goat IgG (1 ␮g/ml, diluted in blocking solution, 30 min; DAKO) was used as secondary antibody and the protein was detected using the streptavidin-peroxidase complex (DAKO). The specimens were counter-stained with hematoxylin. 2.4. Enzyme-linked immunosorbent assay (ELISA) for protein determination ELISA was performed to measure concentration of Ang-2 protein in BM plasma from 31 patients using a previously described method [26]. One-step sandwich enzyme immunoassay was done using commercially available kits with monoclonal antibody to Ang-2 protein (catalog DANG20; R&D Systems, Minneapolis, MN, USA). 2.5. Cytogenetic study Chromosomal analyses were done on BM cells after 1–3 days of unstimulated culture as previously described [27] and

Table 1 Sequences of primer pairs and probes of angiogenic factors Target gene

Forward (5 –3 )

Reverse (5 –3 )

Probe (5 –3 )

Ang-2 Ang-1 Tie 2 VEGF-A VEGF-C

AAGAGATCAAGGCCTACTGTGACA CAGACTGCAGAGCAGACCAGAA CTGTGAAGGGCGAGTTCGA CGAGGGCCTGGAGTGTGT GAACACCAGCACGAGCTACCT

TCCTCACGTCGCTGAATAATTG CTCTAGCTTGTAGGTGGATAATGAATTC TGGTAGGAAGGAAGCTTGTTGAC CCGCATAATCTGCATGGTGAT CGGCAGGAAGTGTGATTGG

CCGCCTCCTCCAGCT ACCCAGGTACTAAATCA CAATCAGGATACGAACCATGA CCCACTGAGGAGTCC CAGCAAGACGTTATTTG

906

H.-A. Hou et al. / Leukemia Research 32 (2008) 904–912

karyotyped according to the International System for Human Cytogenetic Nomenclature (ISCN).

Table 2 Characteristics of the 126 patients with acute myeloid leukemia Variables

2.6. Statistical analysis Correlations between variables were assessed by the Spearman rank correlation. Mann–Whitney U test was used to analyze the difference in the expression of Ang-1, Ang-2, Tie2, VEGF-A, and VEGF-C between the AML and control groups. Overall survival (OS) was measured from the date of first diagnosis to death from any cause, and relapse-free survival (RFS) was calculated from the time of CR until relapse, death, or end of study. Kaplan–Meier estimation was used to plot survival curves, and log-rank tests were used to test the difference between groups. To exclude confounding influences of different treatment regimens, patients who received hematopoietic stem cell transplantation were censored on the day of cell infusion. Hazard ratio and 95% confidence interval (CI) was estimated by Cox proportional hazards regression models to determine independent risk factors associated with OS and RFS in multivariate analyses. Two-sided P values < 0.05 were considered statistically significant. All statistical analyses were performed with the SPSS 13 (SPSS Inc., Chicago, IL, USA).

3. Results

No of patients (%)

Sex Male Female Age (year)a

67 (53) 59 (47) 39.5 (15–87)

FAB classification M0 M1 M2 M4 M5 M6 M7

1 (0.8) 51 (40.5) 42 (33.3) 22 (17.5) 6 (4.7) 4 (3.2) 0

Karyotypeb Favorable Intermediate Unfavorable Unknown

25 (19.8) 83 (65.9) 14 (11.1) 4 (3.2)

Follow-up (months)a Complete remission CR duration (months)a Overall survival (months)a

35 (0.5–127) 101 (80.2) 10 (1–126) 17.5 (0.5–127)

Abbreviations: FAB, French–American–British classification, CR, complete remission. a Median (range). b Favorable, t(8;21), inv(16); unfavorable, −7, del(7q), −5, del(5q), 3q abnormality, complex; intermediate, normal karyotype, and other abnormalities.

3.1. Characteristics of the patients Among the 126 AML patients recruited (Table 2), 67 were males and 59 were females with a median age of 39.5 years (range 15–87), 101 (80%) achieved a CR, and 39 (31%) remained disease free at the time of this writing (median follow-up duration—35 months). The median CR duration was 10 months and OS was 17.5 months.

with high-level RNA expression and weakly stained in all patients with low-level expression (Fig. 2). For all 31 patients tested, Ang-2 protein concentration in BM plasma (measured by ELISA) was also closely associated with RNA expression in leukemia cells (P = 0.022 by Spearman’s rank, data not shown).

3.2. Comparison of angiogenic factor expression between AML patients and normal controls We quantified the expression of Ang-1, Ang-2, Tie2, VEGF-A, and VEGF-C as a ratio with expression of the housekeeping gene RPLP0. In spite of the wide range of individual values of angiogenic factors, median levels of Ang1, Ang-2, and VEGF-A were significantly higher in AML patients than in normal donors, whereas median levels of VEGF-C were higher in control samples. There was no difference in Tie2 expression between leukemia cells and normal control cells (Fig. 1). 3.3. Correlation of Ang-2 RNA and protein expression Ang-2 protein expression in leukemia blasts (measured by immunocytochemical staining) correlated well with RNA expression (measured by RQ-PCR) in the nine patients studied. Ang-2 was strongly stained in blasts from all patients

Fig. 1. Expression of angiopoietin-1 (Ang-1), Ang-2, Tie2, vascular endothelial growth factor A (VEGF-A), and VEGF-C in BM leukemia cells from 126 patients with acute myeloid leukemia (P), compared with that in 22 healthy donors (N). P values were calculated using the Mann–Whitney U test.

H.-A. Hou et al. / Leukemia Research 32 (2008) 904–912

907

with unfavorable karyotype, higher Ang-2 expression, higher Ang-1 expression, or higher Tie2 expression (Table 3). Parameters, such as sex, age, WBC count, hemoglobin level, platelet count, VEGF-A and VEGF-C expression had no impact. On the other hand, the variables that were associated with poor OS on univariate analysis were age of 40 years or older, unfavorable karyotype, higher Ang-2 expression, and higher Tie2 expression. Cox proportional hazards multivariate analysis of the univariate predictors identified karyotype (hazard ratio 3.1, 95% CI 1.78–5.40, P < 0.0001), but not expression of angiopoietin or VEGF family, as an independent prognostic factor for RFS, and both karyotype (hazard ratio 2.19, 95% CI 1.25–3.42, P = 0.005) and Ang-2 expression (hazard ratio 2.05, 95% CI 1.20–3.52, P = 0.009) as independent prognostic factors for OS. The Kaplan–Meier curves for OS stratified according to Ang2 expression in BM leukemia cells is shown in Fig. 3A. The ELISA of Ang-2 protein level in BM plasma in 31

Fig. 2. Immunocytochemical staining of Ang-2 protein in two representative patients showing strong staining in one patient with high Ang-2 RNA expression (A), while weak staining in another patient with low-level expression (B). (1000×).

3.4. Association between angiogenic factor expression in BM leukemia cells and clinical features Assessment of correlation between gene expression levels of angiogenic factors and FAB subtypes, peripheral white blood cell (WBC) count, blast count, hemoglobin value, platelet count, serum lactate dehydrogenase (LDH) level, age, and sex found only a positive correlation of Ang-1 and Ang-2 expression with absolute peripheral blast count (P = 0.0044 and 0.0041, respectively) and an inverse relationship of VEGF-A and VEGF-C with absolute blast count (P = 0.011 and 0.019, respectively). 3.5. Association between angiogenic factor expression and outcome Patients were divided into a low group (expression of angiogenic factor below the median) and a high group (above the median). Univariate analysis of factors associated with RFS showed a significantly shorter survival in the patients

Fig. 3. (A) Kaplan–Meier curves of overall survival of patients with newly diagnosed acute myeloid leukemia stratified by the level of angiopoietin 2 (Ang-2) expression. (B) Kaplan–Meier curves of overall survival stratified by Ang-2 expression in patients with intermediate-risk cytogenetics.

908

H.-A. Hou et al. / Leukemia Research 32 (2008) 904–912

Table 3 Univariate analysis of the impact of angiogenic factor on relapse-free survival and overall survival in AML patients Variable

Relapse-free survival

Overall survival

No. of patients

Median (months ± S.D.)

Sex Male Female

53 48

12 ± 2.51 12 ± 2.98

Age (years) <40 ≥40

53 48

14 ± 2.26 11 ± 2.29

Karyotype Favorable Intermediate Unfavorable

23 64 11

Not reached 12 ± 1.62 4 ± 0.78

Ang-2 Low High

52 49

14 ± 1.44 9 ± 2.23

Ang-1 Low High

56 45

14 ± 4.87 8 ± 2.65

Tie2 Low High

52 49

14 ± 1.25 8.5 ± 2.49

VEGF-A Low High

48 53

13 ± 2.76 10 ± 1.72

VEGF-C Low High

49 52

12 ± 2.95 12 ± 2.16

P value

No. of patients

Median (months ± S.D.)

67 59

21 ± 4.55 20 ± 4.40

63 63

26 ± 12.28 15.7 ± 3.16

25 83 14

Not reached 21 ± 2.65 10 ± 3.45

63 63

38 ± 16.8 15.7 ± 3.27

63 63

26 ± 8.72 16 ± 3.0

63 63

26 ± 8.1 14 ± 2.54

63 63

20 ± 3.67 22 ± 6.47

63 63

21 ± 6.16 22 ± 3.62

0.401

P value 0.782

0.507

0.028

<0.0001

0.001

0.01

0.005

0.029

0.069

0.01

0.043

0.560

0.996

0.526

0.673

Abbreviations: Ang, angiopoietin; VEGF, vascular endothelial growth factor. Median value of each angiogenic factor was used as the cut-off level to define low and high expression groups.

patients also showed that higher Ang-2 protein level was associated with shorter survival (median, 5 ± 1.47 [more than 3 ng/ml] versus 13 ± 5.24 months [less than 3 ng/ml], P = 0.018, Fig. 4).

Fig. 4. Kaplan–Meier curves of overall survival stratified by Ang-2 protein expression in BM plasma (cut-off value: 3 ng/ml) using an ELISA method.

To further illustrate the impact of Ang-2 expression on OS, Kaplan–Meier survival curves of three cytogenetic-risk groups stratified for Ang-2 expression were analyzed. Ang-2 expression had an even more obvious impact on OS in patients with intermediate-risk karyotype (Fig. 3B, median survival, 55 ± 20.57 months versus 16 ± 2.92 months, in patients with low and high Ang-2 expression, respectively, P = 0.004). However, there was no survival difference between patients with low and high Ang-2 expression in the favorable-risk group (P = 0.702) and unfavorable-risk group (P = 0.145). To investigate possible interactions between Ang-2 and other angiogenic factors on OS, subgroup analysis was performed. Patients were divided into two groups with high or low expression (respectively, above or below the median level) of Ang-1, Tie2, VEGF-A and VEGF-C. Survival estimates were calculated for each group according to the level of Ang-2 expression (Fig. 5). The survival difference between patients with low and high Ang-2 expression was pronounced in the subgroups with low Ang-1 levels (P = 0.003) and low Tie2 levels (P = 0.003), respectively, but not evident in the patients with high values (Fig. 5A and B). On the contrary, outcome was much poorer in patients with high than low Ang2 expression in the presence of high VEGF-A and VEGF-C expression (P = 0.038 and 0.05, respectively, Fig. 5C and D).

H.-A. Hou et al. / Leukemia Research 32 (2008) 904–912

909

Fig. 5. Subgroup analysis: Kaplan–Meier curves of overall survival stratified by angiopoietin-2 (Ang-2) expression in the cohorts with low or high expression of Ang-1 (A), Tie2 (B), VEGF-A (C), and VEGF-C (D).

910

H.-A. Hou et al. / Leukemia Research 32 (2008) 904–912

4. Discussion Our present study, similar to previous reports [6,28], demonstrated that Ang-2, Ang-1, and VEGF-A expression were elevated in the BM leukemia cells of patients with newly diagnosed AML, compared with normal controls. In addition, multivariate analysis revealed that expression of Ang-2 was a predictor of poor OS, independent of cytogenetics. Furthermore, the prognostic relevance of Ang-2 expression became even more pronounced in the patients with intermediate-risk karyotype (7.2 ± 6.2% of patients with high Ang-2 expression versus 46.5 ± 11.6% with low level in this subgroup remained alive at 60 months, P = 0.004, Fig. 3B). In other words, Ang-2 expression may serve as a potential biomarker for prognosis prediction, especially in the intermediate-risk cytogenetic group. Ang-2 is a destabilizing factor that regulates vessel remodeling under the influence of VEGF [11,17,18,29–32]. It facilitates regression of vessels in the absence of VEGF, but in their presence, Ang-2 induced an angiogenic response [18]. Recently, emphasis has been put on the interaction of Ang-2 and VEGF in tumor angiogenesis. The facts that the poor prognosis in patients with high Ang-2 expression was only evident in the presence of higher (not lower) levels of VEGF-C and VEGF-A shown in this study (Fig. 5C and D) also suggest that the effect of Ang-2 depends on VEGF. Tanaka et al. [20] reported positive Ang-2 expression was a significantly poor prognostic factor for non-small-cell lung cancer, and its influence was enhanced in the presence of high VEGF expression. These findings and our data support the model of angiogenic factor interactions. The reason that Ang-2 lost its impact on survival in the patients with high expression of Ang-1 and Tie2 was unclear. Following Ang-1 binding, phosphorylation of Tie2 results in activation of the phosphatidylinositol 3-kinase (PI3-K)/Akt signaling pathway, which is associated with increased survival and antiapoptotic effect [16,33–36]. Arai et al. [37] demonstrated that the interaction of Ang-1 and Tie2 in the bone marrow enhanced the ability of hematopoietic stem cells to become quiescent, resulting in protection of the cells from myelosuppressive stress. Wulf et al. [38] reported a similar phenomenon in AML models. Therefore, the prognostic influence of Ang-2 expression may be lessened if the Ang-1/Tie2 pathway is highly activated. The close association between Ang-2 expression in tumor cells and adverse outcome has long been associated with adverse outcome in solid cancers, such as breast, lung, gastric, and colorectal cancers [19–21,39,40]. Recently, Maffei et al. reported that high mRNA level of Ang-2 was related to disease progression and shorter progression-free survival in patients with chronic lymphocytic leukemia [41]. Our observation that there was an inverse relationship between Ang-2 expression and survival time in AML patients was consistent with these findings. However, two previous studies showed the opposite [22,42]. In the report of Loges et al., high expression of Ang-2 mRNA in peripheral blasts of AML

patients was correlated with longer survival [22]. Schliemann et al. showed that high Ang-2 protein expression revealed by immunohistochemical staining of the BM was a favorable prognostic factor in AML patients [42]. The reasons for these differences between our study and theirs remain unclear. Intriguingly, in the report of Longes et al., the association of good prognosis with higher Ang-2 expression was only evident in cohorts with low VEGF mRNA expression, a condition in which Ang-2 was supposed to act as an inhibitor of angiogenesis [22], but not in those with high VEGF levels. Though our study showed the opposite result to that of Longes et al. regarding the prognostic impact of Ang-2 expression, the poor prognosis in patients with high Ang-2 expression was only evident in the presence of high VEGF expression, a condition in which Ang-2 acted as a proangiogenic agent, but not in the presence of low VEGF expression. It is possible that the angiogenesis at the sites where leukemia cells proliferate, but not individual angiogenic factor, determines the prognosis of AML patients. Unfortunately, BM microvessel density was not performed in this study because only a few patients had BM biopsy specimen. Recently, we developed a dynamic magnetic resonance image (dMRI) technique to measure BM blood flow and perfusion in AML patients [43]. It demonstrated that increased BM angiogenesis as shown by this functional image predicted adverse outcome of AML patients. Prospective study to correlate the results of dMRI, microvessel density and angiogenic factors expression in the BM of AML patients is ongoing. The final results from this study may give us a better overview of the prognostic implication of angiogenesis and angiogenic factor expression in AML. Whether the different samples used between this study (BM) and that of Longes et al. (peripheral blood) may influence the results also deserved further studies. In the study of Schliemann et al. [42], immunohistochemistry might not only have detected Ang-2 protein in leukemia cells but also in the stromal cells of BM. Though immunohistochemical staining of the BM was not done in our study, Ang-2 protein concentration in BM plasma was measured in all AML patients (n = 31) who had available samples. Ang-2 RNA expression in leukemia cells and Ang-2 protein level in plasma were well correlated. Furthermore, both high Ang-2 protein level in BM plasma and high RNA expression in leukemia cells predicted poor outcome. Comprehensive studies on all kinds of samples, including the BM aspirate and biopsy specimen and BM and PB plasma, are warranted to clarify the prognostic value of Ang-2 in AML. In conclusion, our data show that high pre-treatment levels of Ang-2 in the BM indicate an unfavorable prognosis in AML and the prognostic significance of Ang-2 expression was more obvious in the subgroup of patients with intermediate-risk cytogenetics. Subgroup analysis also demonstrates that Ang2 expression had prognostic impact on patients with low (but not high) Ang-1 or Tie2 levels, and on patients with high (but not low) VEGF-A or VEGF-C levels. To explain the different findings between our study and those reported previously, further more comprehensive studies are needed.

H.-A. Hou et al. / Leukemia Research 32 (2008) 904–912

Acknowledgements This study was sponsored partly by grants from National Science Council of Taiwan, NSC 95-2314-B002-042, and National Taiwan University Hospital, NTUH 95 A04-6. The authors thank Dr. Chi-Ling Chen from Graduate Institute of Clinical Medicine, College of Medicine, National Taiwan University, for her great help in statistic analyses. Contributions. Hsin-An Hou contributed to analysis, performance, manuscript and figure preparation. Wen-Chien Chou helped in supervision, experimental design and interpretation of data. Liang-In Lin and Jih-Luh Tang contributed to experimental design and interpretation of data; Mei-Hsuan Tseng and Chi-Fei Huang contributed to the performance of ELISA and assisted in real-time quantitative PCR; Ming Yao, Chien-Yuan Chen and Woei Tsay contributed to sample collection and were responsible for patient follow-up. They also contributed to manuscript revision. Hwei-Fang Tien contributed to planning and project design, comprehensive supervision and manuscript preparation. References [1] Risau W. Mechanisms of angiogenesis. Nature 1997;386(6626):671–4. [2] Fiedler W, Staib P, Kuse R, et al. Role of angiogenesis inhibitors in acute myeloid leukaemia. Cancer J 2001;7(Suppl. 3):S129–33. [3] Holash J, Wiegand SJ, Yancopoulos GD. New model of tumor angiogenesis: dynamic balance between vessel regression and growth mediated by angiopoietins and VEGF. Oncogene 1999;18(38):5356– 62. [4] Hussong JW, Rodgers GM, Shami PJ. Evidence of increased angiogenesis in patients with acute myeloid leukemia. Blood 2000;95(1):309–13. [5] Padro T, Ruiz S, Bieker R, et al. Increased angiogenesis in the bone marrow of patients with acute myeloid leukemia. Blood 2000;95(8):2637–44. [6] de Bont ES, Rosati S, Jacobs S, Kamps WA, Vellenga E. Increased bone marrow vascularization in patients with acute myeloid leukaemia: a possible role for vascular endothelial growth factor. Br J Haematol 2001;113(2):296–304. [7] Dickson DJ, Shami PJ. Angiogenesis in acute and chronic leukemias. Leuk Lymphoma 2001;42(5):847–53. [8] Moehler TM, Ho AD, Goldschmidt H, Barlogie B. Angiogenesis in hematologic malignancies. Crit Rev Oncol Hematol 2003;45(3):227–44. [9] Mangi MH, Newland AC. Angiogenesis and angiogenic mediators in haematological malignancies. Br J Haematol 2000;111(1):43–51. [10] De Raeve H, Van Marck E, Van Camp B, Vanderkerken K. Angiogenesis and the role of bone marrow endothelial cells in haematological malignancies. Histol Histopathol 2004;19(3):935–50. [11] Holash J, Maisonpierre PC, Compton D, et al. Vessel cooption, regression, and growth in tumors mediated by angiopoietins and VEGF. Science 1999;284(5422):1994–8. [12] Aguayo A, Estey E, Kantarjian H, et al. Cellular vascular endothelial growth factor is a predictor of outcome in patients with acute myeloid leukemia. Blood 1999;94(11):3717–21. [13] Dias S, Choy M, Alitalo K, Rafii S. Vascular endothelial growth factor (VEGF)-C signaling through FLT-4 (VEGFR-3) mediates leukemic cell proliferation, survival, and resistance to chemotherapy. Blood 2002;99(6):2179–84. [14] Fiedler W, Graeven U, Ergun S, et al. Vascular endothelial growth factor, a possible paracrine growth factor in human acute myeloid leukemia. Blood 1997;89(6):1870–5.

911

[15] Tait CR, Jones PF. Angiopoietins in tumours: the angiogenic switch. J Pathol 2004;204(1):1–10. [16] Kim I, Kim HG, So JN, Kim JH, Kwak HJ, Koh GY. Angiopoietin1 regulates endothelial cell survival through the phosphatidylinositol 3’-Kinase/Akt signal transduction pathway. Circ Res 2000;86(1):24–9. [17] Maisonpierre PC, Suri C, Jones PF, et al. Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis. Science 1997;277(5322):55–60. [18] Lobov IB, Brooks PC, Lang RA. Angiopoietin-2 displays VEGFdependent modulation of capillary structure and endothelial cell survival in vivo. Proc Natl Acad Sci USA 2002;99(17):11205–10. [19] Sfiligoi C, de Luca A, Cascone I, et al. Angiopoietin-2 expression in breast cancer correlates with lymph node invasion and short survival. Int J Cancer 2003;103(4):466–74. [20] Tanaka F, Ishikawa S, Yanagihara K, et al. Expression of angiopoietins and its clinical significance in non-small cell lung cancer. Cancer Res 2002;62(23):7124–9. [21] Etoh T, Inoue H, Tanaka S, Barnard GF, Kitano S, Mori M. Angiopoietin-2 is related to tumor angiogenesis in gastric carcinoma: possible in vivo regulation via induction of proteases. Cancer Res 2001;61(5):2145–53. [22] Loges S, Heil G, Bruweleit M, et al. Analysis of concerted expression of angiogenic growth factors in acute myeloid leukemia: expression of angiopoietin-2 represents an independent prognostic factor for overall survival. J Clin Oncol 2005;23(6):1109–17. [23] Chou WC, Tang JL, Yao M, et al. Clinical and biological characteristics of acute promyelocytic leukemia in Taiwan: a high relapse rate in patients with high initial and peak white blood cell counts during all-trans retinoic acid treatment. Leukemia 1997;11(7):921–8. [24] Chou WC, Tang JL, Wu SJ, et al. Clinical implications of minimal residual disease monitoring by quantitative polymerase chain reaction in acute myeloid leukemia patients bearing nucleophosmin (NPM1) mutations. Leukemia 2007;21(5):998–1004. [25] Hsu SM, Raine L, Fanger H. Use of avidin–biotin-peroxidase complex (ABC) in immunoperoxidase techniques: a comparison between ABC and unlabeled antibody (PAP) procedures. J Histochem Cytochem 1981;29(4):577–80. [26] Lin LI, Lin DT, Chang CJ, Lee CY, Tang JL, Tien HF. Marrow matrix metalloproteinases (MMPs) and tissue inhibitors of MMP in acute leukaemia: potential role of MMP-9 as a surrogate marker to monitor leukaemic status in patients with acute myelogenous leukaemia. Br J Haematol 2002;117(4):835–41. [27] Tien HF, Wang CH, Lin MT, et al. Correlation of cytogenetic results with immunophenotype, genotype, clinical features, and ras mutation in acute myeloid leukaemia. A study of 235 Chinese patients in Taiwan. Cancer Genet Cytogenet 1995;84(1):60–8. [28] Watarai M, Miwa H, Shikami M, et al. Expression of endothelial cellassociated molecules in AML cells. Leukemia 2002;16(1):112–9. [29] Oh H, Takagi H, Suzuma K, Otani A, Matsumura M, Honda Y. Hypoxia and vascular endothelial growth factor selectively up-regulate angiopoietin-2 in bovine microvascular endothelial cells. J Biol Chem 1999;274(22):15732–9. [30] Mandriota SJ, Pepper MS. Regulation of angiopoietin-2 mRNA levels in bovine microvascular endothelial cells by cytokines and hypoxia. Circ Res 1998;83(8):852–9. [31] Acker T, Beck H, Plate KH. Cell type specific expression of vascular endothelial growth factor and angiopoietin-1 and -2 suggests an important role of astrocytes in cerebellar vascularization. Mech Dev 2001;108(1–2):45–57. [32] Vajkoczy P, Farhadi M, Gaumann A, et al. Microtumor growth initiates angiogenic sprouting with simultaneous expression of VEGF, VEGF receptor-2, and angiopoietin-2. J Clin Invest 2002;109(6):777–85. [33] Shiojima I, Walsh K. Role of Akt signaling in vascular homeostasis and angiogenesis. Circ Res 2002;90(12):1243–50. [34] Wakabayashi M, Miwa H, Shikami M, et al. Autocrine pathway of angiopoietins-Tie2 system in AML cells: association with phosphatidyl-inositol 3 kinase. Hematol J 2004;5(4):353–60.

912

H.-A. Hou et al. / Leukemia Research 32 (2008) 904–912

[35] Xu Q, Simpson SE, Scialla TJ, Bagg A, Carroll M. Survival of acute myeloid leukemia cells requires PI3 kinase activation. Blood 2003;102(3):972–80. [36] Min YH, Eom JI, Cheong JW, et al. Constitutive phosphorylation of Akt/PKB protein in acute myeloid leukemia: its significance as a prognostic variable. Leukemia 2003;17(5):995–7. [37] Arai F, Hirao A, Ohmura M, et al. Tie2/angiopoietin-1 signaling regulates hematopoietic stem cell quiescence in the bone marrow niche. Cell 2004;118(2):149–61. [38] Wulf GG, Wang RY, Kuehnle I, et al. A leukemic stem cell with intrinsic drug efflux capacity in acute myeloid leukemia. Blood 2001;98(4):1166–73. [39] Lee JH, Koh JT, Shin BA, et al. Comparative study of angiostatic and anti-invasive gene expressions as prognostic factors in gastric cancer. Int J Oncol 2001;18(2):355–61.

[40] Chung YC, Hou YC, Chang CN, Hseu TH. Expression and prognostic significance of angiopoietin in colorectal carcinoma. J Surg Oncol 2006;94(7):631–8. [41] Maffei R, Marasca R, Martinelli S, et al. Angiopoietin-2 expression in B-cell chronic lymphocytic leukemia: association with clinical outcome and immunoglobulin heavy-chain mutational status. Leukemia 2007. [42] Schliemann C, Bieker R, Padro T, et al. Expression of angiopoietins and their receptor Tie2 in the bone marrow of patients with acute myeloid leukemia. Haematologica 2006;91(9):1203– 11. [43] Shih TT, Tien HF, Liu CY, Su WP, Chan WK, Yang PC. Functional MR imaging of tumor angiogenesis predicts outcome of patients with acute myeloid leukemia. Leukemia 2006;20(2):357– 62.