Expression of Carbohydrate Antigens in Pancreatic Cancer

P333942-P3_07

5/26/05

9:14 AM

Page 341

▼

▼

7 Expression of Carbohydrate Antigens in Pancreatic Cancer Makoto Osanai

Introduction In the past generation, the incidence of pancreatic cancer has increased from less than 5 per 100,000 to between 11 and 12 per 100,000 people in the population (DiMagno, 1996). In developed countries, the annual age-adjusted incidence rates range from 8.0 to 12.0 per 100,000 males and from 4.5 to 7.0 per 100,000 females (Solcia et al., 1997). Incidence rates from most thirdworld countries range from 1.0 to 2.5 per 100,000 people. It is noteworthy that pancreatic cancer has an extremely poor prognosis and is usually diagnosed after there has been local invasion or metastasis, and as a result, treatment is seldom effective. A previous study reported that median survival after diagnosis is 4–8 months and overall survival is less than 1% (DiMagno, 1996). Although resecting the tumor improves the median survival to 17–20 months, the actual average of resection rates is 10.7% (Gudjionsson, 1987) and 5-year survival remains less than 10% (DiMagno, 1996). Most pancreatic neoplasms are malignant, but benign forms or tumors with various malignant potentials also occur. The most common tumor type in the pancreas is ductal adenocarcinoma and its variants, comprising 85–90% of cases. These carcinomas vary in their differentiation with markedly altered architecture and typically are accompanied by the dense proliferation of stromal fibrous tissue. Less than 10% of the exocrine pancreatic tumors are benign or uncertain. Handbook of Immunohistochemistry and in situ Hybridization of Human Carcinomas, Volume 3: Molecular Genetics, Liver Carcinoma, and Pancreatic Carcinoma

Approximately 75% of all pancreatic carcinomas occur in the head of the organ, whereas ∼25% occur in the body and tail regions. Histologic classification of tumors originating from the exocrine pancreas and the location of occurrence have both clinical and prognostic significance. The histogenesis of the pancreatic neoplasm remains unclear; however, a number of animal models have suggested plausible mechanisms for development. Animal models using rodents have indicated that proliferative lesions of the ductal cells are likely to be the origin of most ductal carcinomas. Intraductal papillary hyperplasia and intraductal hyperplasia with various degrees of atypia may arise from the ductal cells. Similarly, proliferative lesions of the acinar cells give rise to acinar cell carcinoma showing a partial phenotype of ductal cell, indicating that malignant transformation and metaplastic change occur simultaneously in acinar cells. It remains to be clarified whether this pathway is involved in the histopathogenesis of human pancreatic cancer, and it has yet to be confirmed that any single factor or carcinogen is responsible for the development of pancreatic cancers in humans. Usually, patients suspected of having pancreatic cancer are diagnosed based on their symptoms, routine blood analyses such as hematology and chemistry, and a series of radiographic image studies. After these routine tests, plasma will be examined for specific tumor markers. In some patients who required further

341

Copyright © 2005 by Elsevier (USA) All rights reserved.

P333942-P3_07

5/26/05

9:14 AM

Page 342

III Pancreatic Carcinoma

342 examination to diagnose the pancreatic malignancy, pathologic or cytologic examination or both would be used in the next line of clinical examinations. However, no specific and sensitive serologic marker for tumors has been identified as a routine diagnostic or screening test for pancreatic cancer. To date, clinically available serologic tests mainly include carcinoembryonic antigen (CEA), carbohydrate antigen (CA) 19-9, and DU PAN-2. Although these tests have ranged in sensitivity from 50–70%, and CA 19-9 has been proved to be useful as a pancreatic tumor maker and is widely used in clinical settings with a sensitivity of 76% and a specificity of 87% (Gupta et al., 1985), none of the tests satisfactorily detect the lesion at early stages of development. Elevated levels of serologic markers are also detected in benign diseases, including acute and chronic pancreatitis, and cholangitis. If further examination was performed using biopsy specimens, it is widely believed that even experienced pathologists gave different diagnostic results in some selected cases. Moreover, immunohistochemistry (IHC) testing of these samples is of limited diagnostic value. For example, immunostaining for markers such as CA 19-9 may yield positive results not only in neoplastic cells but also in normal ductal epithelial cells. None of these markers can be used satisfactorily to differentiate between primary pancreatic carcinomas and carcinomas originating from other organs. Here, the author presents a case diagnosed as adenocarcinoma arising from gastric heterotopic pancreas and describes the role of CA 19-9 in immunohistochemical staining and its diagnostic significance and limited use in the diagnostic procedures in patients with pancreatic carcinomas. In addition, the roles and characters of major CAs that are available to clinical laboratories are described. As a result of these limited preexisting diagnostic tools, the author examined the possible clinical application for genetic analyses based on the detection of specific genetic alterations over the course of pancreatic carcinogenesis, which would be a highly specific and sensitive method when compared with the currently available immunohistochemical techniques.

MATERIALS Immunohistochemistry 1. Fixative: 10% phosphate-buffered formalin, pH 7.4. 2. Phosphate buffer saline (PBS, 10X stock solution): 77.5 g NaCl, 15.0 g K2HPO4, 2.0 g KH2PO4; dissolve the salt completely and bring volume to 1 L. The pH of this solution should be 7.4–7.6, and it should be stored at room temperature.

3. PBS (1X working solution): 10X PBS stock solution, 100 ml; distilled water, 900 ml. 4. Primary antibody: CA 19-9 (l:50–200, M3517, Dako, Tokyo, Japan). In a preliminary experiment, the appropriate dilution for this antibody must be determined for each slide. 5. Permanent mounting media. 6. 3% solution of hydrogen peroxide: 30% hydrogen peroxide, 1 part; absolute methanol, 9 parts. 7. 0.1% solution of trypsin: Trypsin (Sigma, Japan) should be dissolved in 1X PBS solution, pH 7.4 at 4°C. 8. Hematoxylin for counterstaining. 9. EnVision/HRP (horseradish peroxidase) (diaminobenzidine, or DAB) kit (Dako, Japan): Peroxidase-conjugated enhanced polymer one-step staining system. Dako has developed a technology that enables the coupling of a large number of molecules to a dextran-based polymer. This unique chemistry permits binding of a large number of enzyme molecules (e.g., HRP) to a secondary antibody via the dextran backbone. The major benefits are as follows: 1) increased sensitivity, 2) minimal nonspecific background staining, and 3) reduction in the total number of assay steps compared with conventional techniques. 10. Histofine DAB kit (Nichirei, Japan): DAB, 3,3′diaminobenzidine as a chromogen substrate. This kit gives high sensitivity and low background activity. 11. Moist (humidified) chamber: All immunoreactions and the color reaction should be performed in this chamber, because drying results in salt precipitation produces artifacts. 12. Staining rack or coplin jar.

Polymerase Chain Reaction 1. Double-distilled water (DDW): Autoclave the distilled water that has been run through a Millipore Q filter system (Billerica, MA). 2. Primer: Each oligonucleotide should be synthesized by a specialized company. Nucleotide sequences are shown in Figure 52. 3. Taq deoxyribonucleic acid (DNA) polymerase (Takara, Shiga, Japan): 10X polymerase chain reaction (PCR) buffer and dNTP (deoxynucleotide triphosphate) mixture of satisfactory quality are provided with the enzyme. 4. Pipette, pipette tip, 1.5 mL microcentrifuge tube, and 0.2 mL microtube for PCR: PCR microtube is uniquely designed for the PCR machine. Use the appropriate tube and check before the experiments to determine whether your machine needs mineral oil overlying the PCR reaction mixture. Failure to use the required mineral oil overlay will result in the vaporization of samples or unsatisfactory amplification.

P333942-P3_07

5/26/05

9:14 AM

Page 343

7 Expression of Carbohydrate Antigens in Pancreatic Cancer A Oligonucleotide of K-ras codon 12 for MASA

K-ras codon 12

Sense (5'-3') Set 1 ACTTGTGGTAGTTGGAGCTA ACTTGTGGTAGTTGGAGCTC ACTTGTGGTAGTTGGAGCTT Set 2 CTTGTGGTAGTTGGAGCTGA CTTGTGGTAGTTGGAGCTGC CTTGTGGTAGTTGGAGCTGT

AGT CGT TGT GAT GCT GTT

Set 2

Set 2

M

Set 1

B

Set 1

Antisense (5'-3') CTCATGAAAATGGTCAGAGAAACC

A C T

A C T

M 178 bp

Figure 52. Mutant allele-specific amplification (MASA) analysis of K-ras mutation at codon 12. A: Primer sets used in this study. Set 1, primers for the first base mutation; set 2, primers for the second base mutation. B: Agarose gel electrophoresis shows a mutant specific band with primer set 2 and the transition for GGT to GAT. Lane l, sense set 1; Lane 2, sense set 2; Lanes 3–5, each mutant primer in the first base instead of set 1; Lanes 6–8, each mutant primer in the second base instead of set 2. M, molecular size marker; bp, base pairs.

4. Agarose: Electrophoresis grade should be prepared. 5. 5X TBE (Tris-Bolate-EDTA [ethylenediamine tetra-acetic acid]) buffer (stock solution): Tris Base, 54 g; boric acid, 27.5 g; 0.5 M EDTA pH 8.0, 20 ml. Bring volume to 1 L. 6. 0.5X TBE buffer (working solution): 5X TBE buffer stock solution, 100 ml; distilled water, 900 ml. 7. Ethidium bromide (EtBr): 10 mg/ml. 8. Loading buffer: 0.25% bromophenol blue, 0.25% xylene cyanol FF in 40% (w/v) sucrose in water. 9. Thermal cycler and ultraviolet (UV) illuminator.

METHODS Hematoxylin and Eosin Staining 1. Tissue samples were fixed in 10% phosphatebuffered formalin overnight (generally more than 20 hr). 2. Fixed samples were embedded in paraffin. 3. The slides were stained with hematoxylin and eosin (H&E) in a standard procedure.

Immunohistochemistry l. Cut paraffin sections at 4 or 5 µm and mount on silanized slides. 2. Positive control must be run along with each antibody each time immunohistochemical staining is performed.

343

3. Negative control also must be run by substituting the appropriate diluent solution for the primary antibody (e.g., PBS). 4. Dry overnight in a drying oven maintaining a temperature of 40–45°C. 5. Deparaffinize by treatment with xylene: Immerse the slides in xylene. After 3 min, take out and shake off the excess xylene from the slides. Repeat 3× for at least 3 min in each series using fresh xylene. 6. Immerse the slides in 100% ethanol. After 3 min, take out and shake off the excess ethanol in the slides. Repeat 3× for at least 3 min in each series with fresh 100% ethanol. 7. Treat them 2× with 95% ethanol in a similar manner as described in Step 6. 8. Rehydration: After excess ethanol is shaken off, immerse slides in PBS for 5 min. 9. Treat the slides with a fresh 3% solution of hydrogen peroxide in methanol for 15 min at RT. Hydrogen peroxide is used as the first blocking solution to inhibit the endogenous peroxidase activity of the tissues. 10. Rinse the slides in PBS 3× for 5 min each time. 11. Digest the slides in 0.1% trypsin solution for 10 min at 37°C to unmask most antigens. 12. Rinse well, as in Step 10. 13. Rinse well again in PBS working solution. 14. Remove excess fluid from the slides with cotton gauze to prevent dilution of the antiserum in the subsequent step; however, the tissue must not be allowed to dry from this step so as to avoid generation of artifacts. 15. Put the blocking serum on the slides and incubate for 10 min. 16. Tap off the excess solution on the slides. Do not rinse off. 17. Apply a couple of drops of primary antibody diluted in PBS to completely cover the sections and incubate at room temperature for 1 hr in the humidified chamber. 18. Wash the slides well, as in Step 10. Place the slides in PBS and leave at room temperature for 10 min. 19. Wipe areas around the sections on the slides carefully. 20. Place a few drops of Bottle 3 provided as part of the EnVision kit onto each section. Incubate section for 30–60 min. Bottle 3 content is a mixture of HRPconjugated goat anti-mouse polyclonal antibody and goat anti-rabbit polyclonal antibody bound to the dextran polymer reagent. 21. Rinse the slides well, as in Step 10. 22. Wipe areas around the section on the slides carefully and apply histofine DAB as the chromogen substrate (prepared according to the manufacturer’s instructions) to completely cover the sections. Incubate for 10 min in the humidified chamber. 23. Rinse well, as in Step 10.

P333942-P3_07

5/26/05

9:14 AM

Page 344

344

III Pancreatic Carcinoma

24. Wash the slides in two changes of distilled water. 25. Counter-staining: Immerse slides in hematoxylin for 15 min. 26. Wash them well in running water for 15 min. 27. Dehydrate the sections in a graded series of alcohol and clear in xylene. 28. Mount with permanent mounting media.

ferent primer set, the optimal annealing temperature for your primers is Tm −5°C.); extension, 72°C for 45 sec. c. Repeat step b for 30–35 cycles. d. Cycling should conclude with a final extension at 72°C for 10 min. e. Store at 4°C.

Genetic Analysis for Detecting Point Mutations of K-ras at Codon 12

8. Add 2 µl 10X loading buffer in each sample. 9. Electrophorese on 2.0% agarose gel containing 100 µg/ml EtBr at 100 V for approximately 30 min in 0.5X TBE electrophoresis buffer. 10. Obtain results under UV illumination.

1. All pipette tips and tubes must be autoclaved for 20–30 min at 121°C. 2. Extraction of DNA from 1-µm-thick paraffinembedded tissue specimens: The most important thing for the PCR reaction is the quality and quantity of the DNA template, which does not always need to be high in certain situations. A crude lysate prepared by simple boiling in DDW may provide template DNA of adequate quality and quantity for successful amplification. In this context, we generally used 1-µm-thick samples cut from paraffin-embedded tissue specimens. If these are unavailable, the tiny debris or improperly cut sections are sufficient. However, excess amounts of paraffin debris are not acceptable because they inhibit the enzymatic activity in PCR reactions. a. Suspend the 1-µm-thick paraffin-embedded tissue specimen in DDW and pellet down in a centrifuge at no less than 10,000X g for 10 min at room temperature. b. Resuspend in 25–100 µl DDW and transfer to a 1.5-ml microcentrifuge tube. c. Incubate for 5 min in boiling water. d. Transfer the tube immediately to ice and incubate for 3–5 min. This crude lysate contains DNA of sufficient quality and quantity for the following PCR reaction. 3. Set up a 20-µl reaction mixture in a 0.2-ml microcentrifuge tube: 1 µl, template DNA (crude lysate); 2 µl, 5 µM each primer; 2 µl, 10X PCR buffer; 1.6 µl, dNTP mixture (2.5 mM each dNTP: dCTP, dATP, dGTP and dTTP); 11.3 µl, DDW. 4. Add 0.1 µl Taq DNA polymerase. 5. (Option) The reaction mixture in Step 3 and Step 4 must be on ice to reduce the incidence of primer-dimmer artifacts. 6. Spin down briefly in a benchtop centrifuge. 7. Run the PCR reactions in a thermalcycler using the following profile: a. Initial denaturation: 94°C for 5 min. b. Denaturation, 94°C for 30 sec; annealing, 55°C for 30 sec. (The annealing temperature is dependent on your primer design. If you use a dif-

RESULTS This section describes a case of adenocarcinoma presumably arising from a gastric heterotopic pancreas and considers the morphologic and immunohistochemical features along with genetic analysis to examine its histogenesis (Osanai et al., 2001). Although heterotopic pancreas in the stomach is a relatively common congenital condition, the risk of malignant transformation is believed to be extremely low. This unusual lesion was seen in a 57-year-old Japanese female. She was in good general health, and all laboratory tests including tumor marker examinations such as CEA, CA 19-9, and DU PAN-2 were within normal limits. Clinical examinations including X-ray image studies and biopsy specimens confirmed the final diagnosis as advanced adenocarcinoma of the stomach. After the sequential diagnostic procedures, a total gastrectomy was performed on the patient. Gross features of the surgically resected specimen included an irregular ulcerated mass (∼12.5 × 9 cm) that extended from the angle to the body in the lesser curvature of the stomach. This invasive tumor was exposed to the serosal membrane and adhered tightly to the perigastric soft tissue, but the resected surgical margins were determined to be negative for neoplastic cells. Microscopically, the heterotopic pancreas was located broadly within the submucosal and muscular layers of the stomach. The surface epithelium over the tumor was intact except in the region of ulceration. Nontumorous heterotopic pancreatic tissue demonstrated the elements of a normal pancreas: ducts and acini (Heinrich type II). The tumor showed mixed patterns of trabecular and solid neoplastic cell proliferation with poor ductal differentiation and moderately differentiated glandular structures. Most of the dilated ducts showed papillary hyperplasia with focal intestinal metaplasia and also demonstrated lesions in transition to malignancy where adjacent to obviously malignant lesions. These transitional lesions were classified as duct cell dysplasia or carcinoma in situ. Invasion of the

P333942-P3_07

5/26/05

9:14 AM

Page 345

7 Expression of Carbohydrate Antigens in Pancreatic Cancer

345

DISCUSSION

Figure 53. The tumor shows mixed patterns of solid neoplastic cell proliferation and moderately differentiated glandular structures. Immunohistochemical staining demonstrates that CA 19-9 has strong and widespread positive immunoreactivity in the ductal epithelium of tumor tissue with ductal differentiation. (Final magnification 200X.)

lymphatic and vascular vessels was frequently observed in histologic specimens. We performed immunohistochemical staining using various antibodies. In areas of the tumor with ductal differentiation, CA19-9 (Figure 53), transmembrane glycoprotein tumor antigen mucin (MUC) 1 and cytokeratin 19 exhibited a strong, widespread positive immunoreactivity in ductal epithelium. Alpha 1-antitrypsin and alpha 1-antichimotrypsin were also strongly reactive in the ductal luminal surface. Insulin staining revealed approximate positivity rates of 50–60% for cells in neoplastic duct epithelial cytoplasm. Whereas cells positive for CEA, MUC2, and cytokeratin 20 were scattered focally in the ducts, staining for MUC 5AC, glucagon, and p53 was faint or negative. Because the incidence of point mutation in K-ras codon 12 (KRM) in patients with pancreatic carcinoma and biliary tract carcinoma has been reported to be high (75–100%) (Almoguera et al., 1988), we attempted to identify KRM in this case by the mutant allele-specific amplification (MASA) method as described by Takeda et al. (1993). Although no band was present with primer set 1, primer set 2 generated a mutant-specific band suggesting that our case was positive for KRM (Figure 52). We performed further analysis to identify the mutational type in this case and found the transition of GGT (Gly) to GAT (Asp), which is the most common mutational change in KRM observed in the patients with pancreatic carcinomas. These findings provide evidence that the tumor in our clinical case originated from heterotopic pancreatic tissue rather than gastric epithelium. This patient had multiple liver metastatic lesions and inoperable local recurrence 13 months after the operation. She became cachexic and died of peritonitis carcinomatosa.

Heterotopic (ectopic, aberrant) pancreas has been found frequently in the gastrointestinal tract, especially in the antrum of the stomach; however, malignant change in heterotopic pancreas is extremely rare (Guillou et al., 1994). There are few reports detailing cases of gastric carcinoma that have presumably arisen from heterotopic pancreatic tissue in the gastric wall. The significance of this unusual lesion is its potential confusion with conventional adenocarcinoma arising from gastric epithelium. Such confusion may occur if the presence of pancreatic tissue cannot be verified. The well-differentiated cell structure and predominantly submucosal lesion of gastric heterotopic pancreas make it an infertile soil for neoplastic transformation (Hickman et al., 1981). Because surface irritation may not be a significant factor for carcinogenesis in submucosal sites, it is not clear why neoplastic formation may occur in this restricted location. With regard to immunohistochemical findings, the staining pattern of this tumor resembled that of adenocarcinoma arising from an orthotopic pancreas, rather than that of adenocarcinoma arising from gastric epithelium. The positive immunoreactivity for CA 19-9, cytokeratin 19, and insulin support the speculation that the tumor cells may have arisen from the duct epithelium or acinar cells in the heterotopic pancreas. Immunohistochemical staining for insulin confirmed the production of insulin by the neoplastic cells and acinar cells in the nontumorous heterotopic pancreatic tissue. The occurrence of endocrine cells in ductal neoplasm is reasonable if the neoplasm is originated from primitive, multipotent cells that have the capacity to differentiate in several directions. In the concept of multistep carcinogenesis, the presence of a subclone of the cells sharing characteristics distinct from the neighboring cells is not difficult to envisage. It is plausible that, like the orthotopic pancreas, ductal cells of the heterotopic pancreas have the potential to differentiate into acinar and islet cells. Although these findings may be correct in terms of the histologic origin of the tumor, no definite diagnostic immunoreactivity could be established by using preexisting antibodies. Therefore, we applied genetic analysis to identify KRM for the purpose of confirming our diagnosis and speculating on its possible histogenesis. Pancreatic carcinoma has the highest incidence of KRM among various human cancer tissues. Many investigators have reported the presence of KRM in this carcinoma at higher rates, ranging from 75% to 100% (Almoguera et al., 1988). Moreover, the KRM found in our study is the most common type of change observed in the patients with pancreatic carcinoma.

P333942-P3_07

5/26/05

9:14 AM

Page 346

346 In contrast, published studies have shown that the incidence of KRM in gastric cancer ranges from 0% to 28% (Jiang et al., 1989). The reason for the difference in the occurrence of KRM between the two types of cancer is not known. It is interesting that the genetic change often seen in pancreatic carcinoma is not common in gastric carcinoma, indicating that KRM may be a “hot spot” for pancreatic carcinoma and a very convenient genetic tumor marker for clinical application. However, it should be noted that the findings of previous studies suggest that KRM is not specific to pancreatic cancer. Results from this study support the conclusion that the adenocarcinoma observed in our case developed from gastric heterotopic pancreas. It is clear from the diagnostic procedure that there are limitations in diagnosing pancreatic cancer by conventional pathologic examination. It is necessary to combine the results of various examinations such as the physical status of the patient, blood tests including tumor markers, various imaging examinations, and pathologic examinations. When attempting to make a diagnosis, the clinical pathologist must play a central role in evaluating the clinical samples from the patients with suspected pancreatic cancer and in contributing to the development of useful immunohistochemical techniques that use antibodies very specific to pancreatic cancer. Modern IHC has evolved from the pioneering work of Köhler and Milstein (1975), who made it possible to produce unlimited quantities of monoclonal antibodies with the hybridoma technique. Immunohistochemical staining uses antibodies to distinguish between cells based on antigenic differences. These differences are based on the different cellular phenotypes of interest. With the development of this method, IHC has had a significant and fundamental impact on the practice of surgical pathology (Cote and Taylor, 1996). Next, scientists looked for cell-specific antigens because the success of IHC is dependent on the specificity of antibodies for the target antigens. Many scientists have tried to identify antibodies that react with antigens of interest in very specific manner; however, researchers have been unable to identify tumor-specific antigens that meet the strict criteria. In the last few decades, a number of chemically valuable antibodies with satisfactory specificity to certain neoplastic cells have been identified and characterized, which has been useful for clinical applications. These antibodies have been termed “tumor-associated antigens (TAAs)” (Juhl et al., 1996). The TAAs were known to express in the cell membrane of the target cells and are measurable as tumor markers in the serum of patients. A subgroup of TAAs is CA, which are detectable with monoclonal antibodies (mAbs). These mAbs react with cell-surface mucins in neoplastic pancreatic cells.

III Pancreatic Carcinoma Cell-surface mucins in neoplastic pancreatic cells are high molecular weight (MW) glycoproteins with oligosaccharide residue on their protein backbone. These mucins are synthesized and secreted from the glandular epithelium, and there is a report that the glycosylation of mucins is altered in cancers (Osako et al., 1993). One of the epitopes on a mucin glycoprotein is CA, in which carbohydrate epitopes on mucin antigen are recognized with its oligosaccharides residue by mAbs.

CA 19-9 The CA 19-9 antigen was isolated by a mAb that is specific for cells of human carcinoma of the colon as determined by the direct binding of antibody to thinlayer chromatograms of total lipid extracts of tissues (Magnani et al., 1981). The binding of this antibody to antigen is inhibited by the serum of most patients with advanced colorectal carcinoma but not by the serum of normal individuals, patients with inflammatory bowel diseases, or most patients with other malignancies. CA 19-9 consists of a migratory mucin-like glycoprotein (monosialoganglioside) expressed on the cell membrane. Because the epitope has components similar to the Lewisa blood-group antigen (Magnani et al., 1981), CA 19-9 cannot detect patients who are sialyl Lewisa blood group-negative, who account for ∼5% of the general population. CA 19-9 appears to have a great value as a pancreatic tumor maker and is widely used in clinical diagnosis (initially described by Del Villano et al., 1983 and Ricolleau et al., 1983). Immunohistochemical staining of pancreatic cancer has shown that 86% of tumors express CA 19-9 antigen (Juhl et al., 1996) and immunoreactivity is predominantly found in the luminal contents and along the luminal borders. The clinical significances of this TAA comes from the fact that elevated concentrations of serum CA 19-9 can be found in patients with pancreatic cancer. This marker is expressed in more than 80% of ductal adenocarcinomas and tumor cells of the serous cystadenomas and acinar cell carcinomas, and sensitivity was 76% (Gupta et al., 1985), which seems to be higher than the sensitivity of other TAAs, such as CEA. However, CA 19-9 may also be detected in various other gastrointestinal and extragastrointestinal malignancies, in transitional lesions of obvious pancreatic malignancy (Zamora et al., 2001), and in a number of benign diseases including chronic inflammatory diseases such as chronic pancreatitis and obstructive jaundice and even in smokers (Hammarström, 1985). In contrast, Steinberg (1990) reported that CA 19-9 is a TAA synthesized by normal pancreatic acinar and ductal cells and occurs in large quantities within normal

P333942-P3_07

5/26/05

9:14 AM

Page 347

7 Expression of Carbohydrate Antigens in Pancreatic Cancer pancreatic juice. These results suggest that CA 19-9 is not pathognomonic of pancreatic cancer because most patients demonstrate elevated concentrations of this marker in serum and pancreatic juice and CA 19-9 stains the epithelium of normal pancreatic ducts, particularly in chronic pancreatitis (Solcia et al., 1997). This observation demonstrates that the testing for CA 19-9 may be of no clinical value to diagnose a pancreatic malignancy; however, clinical trials indicate that the kinetics of CA 19-9 are comparable to conventional imaging procedures and may serve as an early indicator of patient outcome following surgery or chemotherapy. This suggests that the testing of CA 19-9 kinetics may help to reduce the number of costly imaging procedures (Heinemann et al., 1999). In addition, a previous study of patients with pancreatic malignancy showed that the combination of the CA 19-9 assay in the serum and the cytologic study of aspirated materials obtained by percutaneous fine-needle aspiration of the pancreas increases the diagnostic rate to 100% (Tatsuta, 1985). The peculiar histogenesis of the pancreas has received much attention. It is well known that three different main cell lineages are found in the human pancreas: the duct cell, the acinar cell, and the endocrine cell. These cells originate from the common prototype epithelium (protodifferentiated cells) developed in the fetal pancreas (Githens, 1993). Some protodifferentiated cells may exist even in adulthood within the ductal epithelium and may retain the capacity to regenerate and differentiate into duct, acinar, or islet cells, and pancreatic neoplasm is thought to originate from primitive, multipotential cells that have the capacity to differentiate in several directions. In fact, animal experiments have demonstrated that islet cells can regenerate even in the adult from ductal cells when islet cells are injured with various insults (Githens, 1988). The cellular phenotype of the various tumors arising from these cell lineages is believed to reflect their origin and differentiation from one of these cell types. Although IHC can be used to separate and categorize tumors occurring from pancreatic tissue, CA 19-9 is not pathognomonic for differential diagnosis of pancreatic tumors because the CA 19-9 antibody is known to crossreact with a variety of other cellular phenotypes. This phenomenon can be easily explained by the accumulated evidences that many types of pancreatic cells can produce this specific TAA. Over the course of multistep carcinogenesis, a number of subclones have accumulated genetic alterations spontaneously and lead to the characteristic heterogeneity of malignant tumors. In this context, it is not surprising to discover the presence of cells sharing partial characteristics with each of these three types of cell lineages. Given the fact that the ductal cells of the adult pancreas have a potential to differentiate into

347

acinal cells and islet cells (transdifferentiation), IHC using only CA 19-9 antibody would be unable to differentiate between cell types as a result of this chimeric property of tumor cells. Unless we can improve or revolutionalize our diagnostic strategies, the exact clonal origin of the tumor cell cannot be determined distinctly and we would not understand the overall view of the histogenesis of pancreatic cancer, which is implicated in the quality of the surgical pathology. An increasing number of studies have reported the usefulness of new CAs; however, none of these markers have proved superior to CA 19-9. In addition, their uses as tumor and tissue markers for pancreatic cancer are limited by their lack of tumor and tissue specificity, and even a combination of positive markers does not increase this sensitivity. Furthermore, although the effectiveness of other possible combinations of CAs remains to be elucidated, limited application of these antibodies may lead to no clinical improvement in the diagnosis of pancreatic malignancy.

DU PAN-2 DU PAN-2 is a human pancreatic adenocarcinoma– associated mucin-like antigen defined by the murine mAb DU PAN-2. The epitope defined by this mAb is thought to be expressed on glandular cell secretory products that exhibit molecular microheterogeneity in structure (Lan et al., 1985). This epitope is predominantly found in pancreatic and hepatobiliary malignancies, but it is also expressed in normal ductal cells in the pancreas (Juhl et al., 1996). The combination of serologic analyses of CA 19-9 and DU PAN-2 has been shown to be a useful diagnostic tool for pancreatic carcinomas (Solcia et al., 1997).

Span-1 Span-1 is a high MW, mucin-like glycoprotein identified as a human pancreatic cancer–associated antigen, which was produced from spleen cells of mice immunized against the human pancreatic cancer cell line, Capan-2 (Yuan et al., 1985). It reacts preferentially with cancerous and normal human pancreatic tissue, and it is also found in colonic and stomach carcinomas. This mAb is known to crossreact with CA 19-9 and CA 50.

CA 15-3 The CA 15-3 TAA is found in a variety of adenocarcinomas including ductal adenocarcinoma of the pancreas and malignant mucinous cystic neoplasms. Expression of the CA 15-3 protein is reported to coincide with malignant transformation in pancreatic

P333942-P3_07

5/26/05

9:14 AM

Page 348

III Pancreatic Carcinoma

348 mucinous cystic neoplasms and has proved useful in the differentiation between benign and malignant pancreatic mucinous cysts (Rubin et al., 1994).

CA 50

and has a sensitivity of 66.2% (90% specificity level). The use of CA 242 alone does not improve on the sensitivities reached with CA 19-9 and CA 50, but in combination with these antibodies it results in higher sensitivity and specificity (Röthlin et al., 1993).

The CA-50 ganglioside antigen present in the COLO 205 cell line has been characterized as sislosylfucosyllactotetraosylceramide, which is the sialylated Lewisa pentaglycosylceramide (Nilsson et al., 1985). Because CA 50 is also present in patients who are Lewisa blood group-negative (∼5%) and who therefore cannot have the CA 19-9 antigen, a combination of CA 50 and CA 19-9 may be useful for accurate diagnosis of pancreatic neoplasm. Studies using a mAb against the CA-50 ganglioside have demonstrated CA 50 to be a minor component in many different carcinomas.

The CA 494 antigen is another epitope on the same mucin on which CA 19-9 and CA 50 are located. A mAb, BW 494, initially isolated from BALB/c mice immunized with a human colon cancer cell line, defines the CA 494 antigen and has been shown to have a high immunohistochemical binding capacity for pancreatic ductal carcinomas (Friess et al., 1993). The sensitivity of CA 494 for pancreatic cancer is 90%, whereas the specificity for chronic pancreatitis is 94%.

CA 72-4

PAM4

A high MW, mucin-like, human tumor–associated glycoprotein (TAG-72), CA 72-4 is expressed in a wide variety of human gastrointestinal carcinomas, including pancreatic carcinomas (Ching et al., 1993; Byrne et al., 1990). Antibodies against this TAA can detect aberrant glycosylation of structural and secretary glycoconjugates in epithelial cancer cells and has proved to be a sensitive and specific tumor marker for the pancreas. CA 72-4 also has been well studied in gastric cancer as a tumor marker, and one study indicates that CA 72-4 is a reliable tumor marker of disease stage and activity in gastric cancer with a specificity and sensitivity of 95% and 0.94, respectively (Byrne et al., 1990).

The epitope PAM4 is a murine mAb directed against a pancreatic cancer–derived mucin that reacts with greater than 80% of the human pancreatic carcinomas and is nonreactive with normal pancreatic tissue (Gold et al., 1995). This epitope is distinct from that of CA 19-9, DU PAN-2, Span-1, and Lewis antigens. Its high specificity has proved useful for diagnostic and therapeutic approaches.

CA 125 The glycoprotein CA 125 is a higher MW mucin that is predominantly associated with ovarian carcinomas (Kabawat et al., 1983) but has also been detected in other carcinomas including pancreatic carcinomas (Mattes et al., 1990) and in normal lung tissue (Noumen et al., 1986) and breast milk (Hanisch et al., 1985). The use of CA 125 in combination with CEA has been shown to reliably distinguish malignant cystic pancreatic tumors and potentially premalignant mucinous cystic neoplasms from pseudocysts and serous cystadenomas (Lewandrowski et al., 1993).

CA 242 The epitope recognized by CA 242 has been shown to be a sialated carbohydrate structure situated on the same macromolecules as CA 50, but it is completely unique from the latter (Röthlin et al., 1993). The CA 50 mAb reacts with serum samples from pancreatic cancer

CA 494

CAM 17-1 The assay for the CAM 17-1 mAb is an enzymelinked immunoassay that uses lectin wheatgerm agglutinin as a capture agent (Yiannakou et al., 1997). The lectin binds to N-acetylglucosamine or sialic acid, components of oligosaccharides that are abundant on mucins. Thus, CAM 17-1 has an advantage over CA 19-9 because its epitope is ubiquitous. The sensitivity and specificity in patients with pancreatic cancer were 86% and 91%, respectively. Use of this assay in combination with ultrasonography identified 94% of the patients with pancreatic tumors and 100% of those with resectable tumors.

TKH2 The sialyl-Tn antigen, a disaccharide antigen found on mucin proteoglycan, was detected by immunohistochemical studies using the mAb TKH2. This antigen is expressed on colon epithelial cells in a cancerassociated fashion (Ogata et al., 1995). TKH2 detects the tumor-associated sialylated antigens, and these sialylated epitopes can be expressed in different gastrointestinal epithelial cells and cancer tissues including carcinomas of the colon, stomach, and pancreas.

P333942-P3_07

5/26/05

9:14 AM

Page 349

7 Expression of Carbohydrate Antigens in Pancreatic Cancer

A10 A10 is an immunoglobulin M (IgM) mAb raised against murine Ehrlich tumor cells that has been demonstrated to inhibit their growth. It recognizes an undefined carbohydrate epitope that is carried on a high MW cell-surface glycoprotein (Medina et al., 1999). A10 mAb reacts strongly with most human colon adenocarcinomas but not with normal colon. A10 is also reactive with a selected variety of adenocarcinomas including pancreatic adenocarcinomas and nonmalignant ductal cells of the pancreas. Studies using human pancreatic cancer tissue and human pancreatic cancer cell lines have identified some characteristic genetic alterations associated with the development of this disease, indicating that accumulation of some oncogenic activation is associated with the tumor phenotype. The most common molecular abnormality in pancreatic cancer is the point mutations in the codon 12 of the K-ras oncogene, located on chromosome 12p13. This mutation occurs in 70–90% of ductal adenocarcinomas, which is higher than rates observed in either acinal (8%) or endocrine tumors (0%) (Almoguera et al., 1988; Solcia et al., 1997). The alternative common changes are deletions or mutations that occur in many codons of the p53 tumor-suppressor gene (40–60% of ductal cancers and 8% of endocrine tumors) (Solcia et al., 1997). Preneoplastic ductal lesions and invasive adenocarcinoma have been shown to harbor mutations in genes including p53 (Boschman et al., 1994), p16 (Moskaluk et al., 1997), and activated telomerase (Suehara et al., 1997). Activation of epidermal growth factor (EGF), EGF receptor (EGFR), and HER-2/neu protooncogene pathways in concert with transforming growth factoralpha (TGF-α) expression have a role in the pathogenesis of pancreatic cancer by forming an autocrine growth-stimulating mechanism (Smith et al., 1987). Other genetic alterations associated with pancreatic malignancies are as follows: bcl-2 gene family and its corresponding proteins, Smad4, retinoblastoma (Rb), TGF-β, p15, p21, fibroblast growth factor (FGF), insulin-like growth factor (IGF), vascular endothelial growth factor (VEGF), and multidrug resistance gene (MDR) (see review by Wolff et al., 2000). A number of chromosomal examinations have identified the rearrangement and allelic loss in chromosome 1p, 1q, 6q, 12p, 16q, 17p, and 18q (Solcia et al., 1997). To date, no clear correlation between prognosis or disease-free survival and these genetic changes have been established. It is worth noting here that these genetic changes are not always specific and diagnostic for pancreatic carcinogenesis. For example, K-ras codon

349

12 mutations are also observed in other malignancies such as gastrointestinal cancers and cancers in the hepatobiliary tract and pancreas. These cancers are also indistinguishable by IHC alone. In summary, because there is no antibody available as an immunohistochemical marker “specific” to pancreatic neoplastic cells, IHC testing is of limited diagnostic value. Some CAs, such as CA 19-9, however, appear to have great value as pancreatic tumor markers. They have served 1) to identify that ∼86% of malignant tumors express the CA 19-9 antigen, 2) for patient follow-up, and 3) as the predictor of patient response over the course of treatment by measuring the kinetics of serum CA 19-9 concentrations. Use of the CA 19-9 assay in combination with other tumor markers, medical imaging, and cytohistologic studies increases the diagnostic rate for pancreatic cancer. The clinical application of genetic analyses specific for pancreatic malignancy is a promising approach both for establishing an accurate diagnosis and for the understanding of novel characteristics of pancreatic cancer.

References Almoguera, C., Shibata, D., Forrester, K., Martin, J., Arnheim, N., and Perucho, M. 1988. Most human carcinomas of the exocrine pancreas contain mutant c-K-ras genes. Cell. 53:549–554. Boschman, C.R., Stryker, S., Reddy, J.K., and Rao, M.S. 1994. Expression of p53 protein in precursor lesions and adenocarcinoma of human pancreas. Am. J. Pathol. 145:1291–1295. Byrne, D.J., Browning, M.C.K., and Cuschieri, A. 1990. CA72-4: A new tumour marker for gastric cancer. Br. J. Cancer 77:1010–1013. Ching, C.K., Holmes, S.W., Holmes, G.K.T., and Long, R.G. 1993. Comparison of two sialosyl-Tn binding monoclonal antibodies (MLS102 and B72.3) in detecting pancreatic cancer. Gut 34: 1722–1725. Cote, R.J., and Taylor, C.R. 1996. Immunohistochemistry and related marking techniques. In Damjanov, I., and Linder, J., (ed) Anderson’s Pathology, 10th edition. Philadelphia: Mosby, 136–175. Del Villano, B.C., Brennan, S., Brock, P., Bucher, C., Liu, V., McClure, M., Rake, B., Space, S., Westrick, B., Schoemaker, H., and Zurawski, V.R. 1983. Radio-immunometric assay for a monoclonal antibody-defined tumor marker CA 19-9. Clin. Chem. 29:549–552. DiMagno, E.P. 1996. Carcinoma of the pancreas. In Bennett, J.C., and Plum, F., (eds), Cecil textbook of medicine, 20th edition, Philadelphia: W.B. Saunders Company, 736–738. Friess, H., Büchler, M., Auerbach, B., Weber, A., Malfertheiner, P., Hammar, K., Madry, N., Greiner, S., Bosslet, K., and Beger, H.G. 1993. CA 494: A new tumor marker for the diagnosis of pancreatic cancer. Int. J. Cancer 44:759–763. Githens, S. 1988. The pancreatic duct cell: Proliferative capabilities, specific characteristics, metaplasia, isolation, and culture. J. Pedistr. Gastroenterol. Nutr. 7:486–506. Githens, S. 1993. Differentiation and development of the pancreas in animals. In Go, V.L.W. (ed), The Pancreas: Biology, Pathobiology, and Disease, New York: Raven Press, 21–55.

P333942-P3_07

5/26/05

9:14 AM

Page 350

350 Gold, D.V., Alisauskas, R., and Sharkey, R.M. 1995. Targeting of xenografted pancreatic cancer with a new monoclonal antibody, PAM4. Cancer Res. 55:1105–1110. Gudjonsson, B. 1987. Cancer of the pancreas. Cancer 60:2284–2303. Guillou, L., Nordback, P., Gerber, C., and Schneider, R.P. 1994. Ductal adenocarcinoma arising in heterotopic pancreas situated in hiatal hernia. Arch. Pathol. Lab. Med. 118:568–571. Gupta, M., Arciaga, R., Bocci, L., Tubbs, R., Bukowski, R., and Deodhar, S. 1985. Measurement of a monoclonal antibodydefined antigen (CA 19-9) in the sera of patients with malignant and nonmalignant diseases. Cancer 56:277–283. Hammarström, S. 1985. Chemistry and immunology of CEA, CA 19-9 and CA 50. Holmgren, J. (ed), Tumor Marker Antigens. Lund: Studentlitteratur 32–49. Hanisch, F.G., Uhlenbruck, G., Dienst, C., Stottrop, M., and Hippauf, E. 1985. CA125 and CA 19-9: Two cancer associated sialosaccharide antigens on a mucous glycoprotein from human milk. Eur. J. Biochem. 149:323–330. Heinemann, V., Schermuly, M.M., Stieber, P., Schulz, L., Jüngst, D., Wilkowski, R., and Schalhorn, A. 1999. CA 19-9: A predictor of response in pancreatic cancer treated with gemcitabine and cisplatin. Anticancer Res. 19:2433–2436. Hickman, D.M., Frey, C.F., and Carson, J.W. 1981. Adenocarcinoma arising in heterotopic pancreas. West. J. Med. 135:57–62. Jiang, W., Kahn, S., Guillem, J.G., Ku, S., and Weinstein, I.B. 1989. Rapid detection of ras oncogenes in human tumors: Applications to colon, esophageal, and gastric cancer. Oncogene 4:923–928. Juhl, H., Schmiegel, W., and Kalthoff, H. 1996. Clinical applications of cancer-associated antigens. In Neoptolemos, J.P., and Lemoine, N.R. (eds), Pancreatic Cancer: Molecular and Clinical Advances. London: Blackwell Science, 214–223. Kabawat, S.E., Bast, R.C., Welch, W.R., Knapp, R.C., and Colvin, R.B. 1983. Immunopathologic characterization of a monoclonal antibody that recognizes common surface antigens of human ovarian tumors of serous, endometrioid, and clear cell types. Am. J. Clin. Pathol. 79:98–104. Köhler, G., and Milstein, C. 1975. Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 256:495–497. Lan, M.S., Finn, O.J., Fernsten, P.D., and Metzgar, R.S. 1985. Isolation and properties of human pancreatic adenocarcinomaassociated antigen, DU-PAN-2. Cancer Res. 45:305–310. Lewandrowski, K.B., Southern, J.F., Pins, M.R., Compton, C.C., and Warshaw, A.L. 1993. Cyst fluid analysis in the differential diagnosis of pancreatic cysts. Ann. Surg. 217:41–47. Magnani, J.L., Brockhaus, M., Smith, D.F., Ginsburg, V., Blaszczyk, M., Mitchell, K.F., Steplewski, Z., and Koprowski, H. 1981. A monosialoganglioside is a monoclonal antibodydefined antigen of colon carcinoma. Science 212:55–56. Mattes, M.J., Major, P.P., Goldenberg, D.M., Dion, A.S., Hutter, R.V.P., and Klein, K.M. 1990. Pattern of antigen distribution in human carcinomas. Cancer Res. 50:880s–884s. Medina, M., Vélez, D., Asenjo, J.A., Egea, G., Real, F.X., Gil, J., and Subiza, J. 1999. Human colon adenocarcinomas express a MUC1-associated novel carbohydrate epitope on core mucin glycans defined by a monoclonal antibody (A10) raised against murine Ehrlich tumor cells. Cancer Res. 59:1061–1070. Moskaluk, C.A., Hruban, R.H., and Kern, S.E. 1997. p16 and K-ras gene mutations in the intraductal precursors of human pancreatic adenocarcinoma. Cancer Res. 57:2140–2143. Nilsson, O., Månsson, J.E., Lindholm, L., Holmgren, J., and Svennerholm, L. 1985. Sialosyllactotetraosylceramide, a novel ganglioside antigen detected in human carcinomas by a monoclonal antibody. FEBS Lett. 182:398–402. Noumen, E.J., Pollet, D.E., Eerdekens, M.W., Hendrix, P.G.,

III Pancreatic Carcinoma Briers, T.W., and DeBroe, M.E. 1986. Immunohistochemical localization of placental alkaline phosphatase, carcinoembryonic antigen and cancer antigen 125 in normal and neoplastic human lung. Cancer Res. 46:866–876. Ogata, S., Ho, I., Chen, A., Dubois, D., Maklansky, J., Singhal, A., Hakomori, S., and Itskowitz, S.H. 1995. Tumor-associated sialylated antigens are constitutively expressed in normal human colonic mucosa. Cancer Res. 55:1869–1874. Osako, M., Yonezawa, S., Siddiki, B., Huang, J., Ho, J.J.L., Kim, Y.S., and Sato, E. 1993. Immunohistochemical study of mucin carbohydrates and core proteins in human pancreatic tumors. Cancer 71:2191–2199. Osanai, M., Miyokawa, N., Tamaki, T., Yonekawa, M., Kawamura, A., and Sawada, N. 2001. Adenocarcinoma arising in gastric heterotopic pancreas: Clinicopathological and immunohistochemical study with genetic analysis of a case. Pathol. Int. 51:549–554. Ricolleau, G., Kremer, M., Curtet, C., Fumoleau, P., Douillard, J.Y., Le Mevel, B., Le Bodic, L., and Chatal, J.F. 1983. Intérêt diagnostique comparé au radio-immunodosage de I’antigène carcino-embryonnaire et de I’antigène CA 19-9 isolé par un anticorps monoclonal. Gastroentérol. Clin. Biol. 7:25A. Röthlin, M.A., Joller, H., and Largiadér, F. 1993. CA242 is a new tumor marker for pancreatic cancer. Cancer 71:701–707. Rubin, D., Warshaw, A.L., Southern, J.F., Pins, M., Compton, C.C., and Lewandrowski, L.B. 1994. Expression CA 15.3 protein in the cyst contents distinguishes benign from malignant pancreatic mucinous cyst neoplasms. Surgery 115:52–55. Smith, J.J., Derynck, R., and Korc, M. 1987. Production of transforming growth factor alpha in human pancreatic cancer cells: Evidence for a superagonist autocrine cycle. Proc. Natl. Acad. Sci. USA 84:7567–7570. Solcia, E., Capella, C., and Klöppel, G. 1997. Atlas of tumor pathology. Third series. Fascicle 20. In Rosai, J., (ed), Tumor of the Pancreas. Washington, DC: Armed Forces Institute of Pathology. 64–88. Steinberg, W. 1990. The clinical utility of the CA 19-9 tumor associated antigen. Am. J. Gastroenterol. 85:350–355. Suehara, N., Mizumoto, K., Muta, T., Tominaga, Y., Shimura, H., Kitajima, S., Hamasaki, N., Tsuneyoshi, M., and Tanaka, M. 1997. Telomerase elevation in pancreatic ductal carcinoma compared to nonmalignant pathological states. Clin. Cancer Res. 3:993–998. Takeda, S., Ichii, S., and Nakamura, Y. 1993. Detection of K-ras mutation in sputum by mutant allele specific amplification (MASA). Hum Mutat. 2:112–117. Tatsuta, M., Yamamura, H., Iishi, H., Ichii, M., Noguchi, S., Yamamoto, R., and Okuda, S. 1985. Values of CA 19-9 in the serum, pure pancreatic juice and aspirated pancreatic material in the diagnosis of malignant pancreatic cancer. Cancer 56:2669–2673. Wolff, R.A., Abbruzzese, J.L., and Evans, D.B. 2000. Cancer medicine, 5th edition, Hamilton, Ontario, Canada: B.C. Decker Inc., 1436–1464. Yiannakou, J.Y., Newland, P., Calder, F., Kingnorth, A.N., and Rhodes, J.N. 1997. Prospective study of CAM 17-1/WGA mucin assay for serological diagnosis of pancreatic cancer. Lancet 349:389–392. Yuan, S.Z., Ho, J.J.L., Yuan, M., and Kim, Y.S. 1985. Human pancreatic cancer-associated antigens detected by murine monoclonal antibodies. Cancer Res. 45:6179–6187. Zamora, C., Sahel, J., Cantu, D.G., Heyries, L., Bernard, J.P., Bastid, C., Payan, M.J., Sielezneff, I., Familiari, L., Sastre, B., and Barthet, M. 2001. Intraductal papillary and mucinous tumors (IPMT) of the pancreas: Report of a case series and review of the literature. Am. J. Gastroenterol. 96:1441–1447.