- Email: [email protected]
db mouse
Pathophysiology 19 (2012) 193–203
Expression of cardiac GATA4 and downstream genes after exercise training in the db/db mouse Tom L. Broderick a,∗ , Cassandra R. Parrott a , Donghao Wang b , Marek Jankowski b , Jolanta Gutkowska b b
a Laboratory of Diabetes and Exercise Metabolism, Midwestern University, Glendale, AZ, USA Laboratory of Cardiovascular Biochemistry, Centre Hospitalier de L’Université de Montréal-Hôtel-Dieu Research Centre, Montréal, Québec, Canada
Received 27 February 2012; received in revised form 30 May 2012; accepted 7 June 2012
Abstract GATA4 is a transcriptional factor expressed in heart that regulates the synthesis of structural and cardioprotective genes. We have demonstrated that low GATA4 expression in the db/db mouse heart is associated with reduced expression of key downstream genes, including oxytocin (OT) natriuretic peptide (A-, B-type), nitric oxide synthase (eNOS), and myosin heavy chain (␣-MHC). In this study, the effect of exercise on GATA4 expression and related genes was determined in the db/db mouse, a model that represents human type 2 diabetes. Vascular endothelial growth factor (VEGF) and hypoxia-induced factor-␣ expression were also measured after 8 weeks of treadmill running. Compared with control littermates, db/db mice exhibited hyperglycemia and obesity, and exercise failed to improve these parameters. GATA4 expression was reduced in db/db hearts and this was associated with reduced expression of OT, OTR, ANP, BNP, eNOS, ␣-MHC, and ratio of ␣- to -MHC, whereas mRNA expression of -MHC and VEGF remained unchanged compared with control hearts. Exercise training increased GATA4 expression (mRNA and protein) but most genes regulated by GATA4 were not observed to increase accordingly. However, protein expression of eNOS, mRNA expression of ␣-MHC, ratio of ␣- to -MHC, and protein expression of VEGF were increased in db/db hearts after exercise. In conclusion, while GATA4 expression is increased following exercise, not all structural and cardioprotective genes are expressed, suggesting other transcription factors may be involved in this regulation. Regardless of this effect, the positive effect of exercise training on key protective genes is evident in the db/db mouse heart. © 2012 Elsevier Ireland Ltd. All rights reserved. Keywords: GATA4; Oxytocin; Natriuretic peptides; VEGF; Exercise; db/db
1. Introduction Diabetes is a major risk for cardiovascular diseases [1]. Left ventricular dysfunction is a significant adverse outcome that occurs in type 2 diabetes in the absence of existing co-morbidities such as ischemic, hypertensive and valvular heart disease [2]. Type 2 diabetes is also associated with a heightened mortality rate following ischemic events [3]. Disturbances in cardiac energy metabolism, endothelial dysfunction, and altered transcription of genes encoding for ∗ Corresponding author at: Department of Physiology, Laboratory of Diabetes and Exercise Metabolism, Midwestern University, 19555 North 59th Avenue, Glendale, AZ 85308, USA. Tel.: +1 623 572 3664; fax: +1 623 572 3673. E-mail address: [email protected] (T.L. Broderick).
0928-4680/$ – see front matter © 2012 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.pathophys.2012.06.001
contractile proteins and cardioprotective peptides contribute to deteriorating left ventricular function in diabetes [4–7]. GATA4 is a zinc finger-containing transcription factor involved in cardiomyocyte differentiation during embryonic development, and is also highly expressed in adult cardiac cells [8]. GATA4 regulates the transcription of structural and cardioprotective genes, including myosin heavy chain (MHC), A-, and B-type atrial natriuretic peptides (NP), oxytocin (OT), and endothelial nitric oxide synthesis (eNOS). GATA4 also regulates the expression of the angiogenic marker vascular endothelial growth (VEGF-1) factor [9], which is also regulated by eNOS. As a result, GATA4 is essential for various adaptive responses in the heart including myocyte survival, angiogenesis, and hypertrophy in response to exercise [8–11]. In the db/db mouse heart, GATA4 expression is reduced and we have shown that this is associated
194
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
with a corresponding decrease in the synthesis of GATA4associated genes and peptides [12]. Regular physical activity is a key strategy to reduce the risk of cardiovascular disease in patients with type 2 diabetes. Exercise controls body weight, improves glucose control, and reduces the incidence of type 2 diabetes [13,14]. Further, cardiomyopathy and sensitivity to ischemic damage can be attenuated by regular exercise [15]. Reduction in plasma lipids and adiposity, improved insulin sensitivity, and more efficient energy metabolism have all been implicated to explain the beneficial effect of exercise on the myocardium [15]. Additionally, a direct role of transcription factors has been proposed to account for these positive effects based on the observation that the physiological stimulus of exercise regularly induces cardiac hypertrophy [16,17]. However, the impact of exercise training on key GATA4-regulated genes in the db/db mouse heart is poorly understood. The present study investigates the effect of type 2 diabetes on GATA4 content and expression of downstream regulated structural and cardioprotective genes in response to exercise training. We use the db/db mouse model of diabetes due to its close representation to human type 2 diabetes. The onset of diabetes is gradual with mice exhibiting obesity, hyperglycemia, and subsequent hyperinsulinemia as a result of two mutant copies of the leptin receptor gene. To our knowledge, this is the first study to explore the effects of exercise on GATA-4 regulated downstream genes in the db/db mouse.
2. Methods 2.1. Mouse model of diabetes The Midwestern University Research and Animal Care Committee approved this study. All animals used in this study were cared in accordance to the recommendations in The Guide for the Care and Use of Laboratory Animals, National Institute of Health, Publ. No. 85-23, 1986. Mice of the db/db strain (C57BL/KsJ-leptdb -leptdb ) were obtained from Jackson Laboratories (Bar Harbor, ME) at the age of 6 weeks. This strain displays many of the metabolic perturbations associated with type 2 diabetes. The onset of diabetes is gradual and characterized by the obese phenotype with hyperglycemia and subsequent hyperinsulinemia as a result of two mutant copies of the leptin receptor gene. The lean littermates possess one mutant and one normal copy of the leptin gene (db/+). 2.2. Exercise training protocol At 8 weeks of age, db/db mice were randomly assigned to four groups: control sedentary (CN), diabetic sedentary (DS), control runners (CT), and diabetic runners (DT). Treadmill training consisted of moderate intensity exercise 5 days per week on an electrically driven treadmill (Columbus Instr., OH) for a period of 8 weeks, as reported earlier [18]. In brief,
the training regimen consisted of a 3-week graded increase in exercise duration and intensity as follows: week 1, 10 min at 10 m/min; week 2, 20 min at 10 m/min; week 3, 30 min at 12 m/min and weeks 4–8, 30 min at 15 m/min. Mice were provided with food and water ad libitum and were kept in a room with alternating 12-h light/dark cycle and kept at 22 ◦ C. 2.3. Blood and tissue sampling At the end of the exercise training protocol, and 48 h after the last exercise session, overnight-fasted mice were sacrificed in the morning between 8 and 11 AM. This 48-h period was selected to eliminate the effect of the last exercise bout on insulin sensitivity [19]. A blood sample was obtained from the submandibular vein and mice were then immediately sacrificed by cervical dislocation. Blood was centrifuged (3000 rpm at 4 ◦ C, for 5 min), and plasma was kept at −80 ◦ C for later analysis. Hearts were rapidly removed and frozen with clamps pre-cooled to the temperature of liquid N2 for analysis of genes. Frozen tissue was first ground to powder under liquid nitrogen and then thoroughly homogenized using a Teflon pestle in a glass homogenization tube cooled in ice. 2.4. Real time PCR Total RNA was extracted from freeze-clamped hearts with Trizol reagent (Invitrogen Life Technologies, Burlington, ON) according to the manufacturer’s protocol. To remove genomic DNA, RNA samples were incubated with 2 U deoxyribonuclease I (DNase I; Invitrogen Life Technologies, Burlington, ON)/g RNA for 30 min at 37 ◦ C. PCR was carried out in the iCycler IQ Real time PCR detection system (Bio-Rad Laboratories, Hercules, CA), using SYBR® green chemistry. The samples were analyzed in duplicate or triplicate. For amplification, 2 l of diluted cDNA were added to a 20 l reaction mixture containing 1× iQ SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA) and 200 nM forward and reverse primers. The thermal cycling program was 95 ◦ C for 2 min, followed by 40 cycles of 95 ◦ C for 30 s, 60 ◦ C for 30 s, and 72 ◦ C for 30 s. The primers were purchased from Invitrogen Life Technologies (Burlington, ON). Primer sets served to generate amplicons (Table 1). Optical data were recorded during the annealing step of each cycle. After PCR, the reaction products were melted for 1 min at 95 ◦ C, the temperature was lowered to 55 ◦ C, and then gradually increased to 95 ◦ C in 1.0 ◦ C increments, 10 s per increment. Optical data were collected over the duration of the temperature increments, with a dramatic drop in fluorescence occurring. This was done to ensure that only 1 PCR product was amplified per reaction. The relative expression of the RT-PCR products was determined by the Ct method. This method calculates relative expression using the following equation: Fold induction = 2−[ΔΔCt] , where Ct = the threshold cycle, i.e. the cycle number at which the sample’s relative fluorescence rises
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
195
Table 1 PCR primer sequences. Gene
Sense primer (5 –3 )
Antisense primer (5 –3 )
Accession no.
ANP BNP eNOS IRAP GATA HIF-1 ␣-MHC -MHC HSP NAB1 OT OTR VEGF Actin GAPDH
CCTGTGTACAGTGCGGTGTC CTGAAGGTGCTGTCCCAGAT AACCAGCGTCCTGCAAAC CAAAGACCGAGCCAACCTGATC CACTATGGGCACAGCAGCTCC AGTCGGACAGCCTCA CTGCTGGAGAGGTTATTCCTCG TGCAAGGCTCCAGGTCTGAGGGC GGTGGTGCTGTCCGACATG TGCTGACAAGAAGAGATGAG CCTACAGCGGATCTCAGACTGA CGACTCAGGACGAAGGTGGAGGA CACCCACGACAGAAGG ACCAACTGGGACGATATGGAGAAGA TTCACCACCATGGAGAAGGC
CCTAGAAGCACTGCCGTCTC GTTCTTTTGTGAGGCCTTGG AACCAGCGTCCTGCAAAC GCTAAAGAGGAACAACCAGCC TTGGAGCTGGCCTGCGATGTC TGCTGCCTTGTATGGGA GGAAGAGTGAGCGGCGCCATCAAGG GCCAACACCAACCTGTCCAAGTTC TACGCCTCAGCGATCTCCTTC TCCTGGTTTCCACAGACTAC TCAGAGCCAGTAAGCCAAGCA AAGATGACCTTCATCATTGTTC TCACAGTGAACGCTCCC TACGACCAGAGGCATACAGGGACAA GGCATGGACTGTGGTCATGA
NM NM NM NM NM NM NM NM NM NM NM NM NM NM NM
008725 008726 008713 172827 008092 010431 001164171 080728 010478 008667 011025 001081147 001025250 007393 008084
ANP, atrial natriuretic peptide; BNP, brain natriuretic peptide; eNOS, endothelial nitric oxide synthase; IRAP, insulin regulated aminopeptidase; G4, GATA binding protein4; HIF-1, hypoxia-indiced factor; ␣-MHC, alpha myosin heavy chain; -MHC, beta myosin heavy chain; HSP70, heat shock protein; NAB1, NGF1A-binding protein; OT, oxytocin; OTR, oxytocin receptor; VEGF, vascular endothelial growth factor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
above background fluorescence, and Ct = [Ct gene of interest (unknown sample) − Ct GAPDH (unknown sample)] − [Ct gene of interest (calibrator sample) − Ct GAPDH (calibrator sample)]. One of the control samples was chosen as the calibrator sample and tested in each PCR. Each sample was run in duplicate, and mean Ct was taken in the Ct equation. GAPDH and actin were chosen for normalization because this gene showed consistent expression relative to
other housekeeping genes among the treatment groups in our experiments. 2.5. Western blot analysis Heart samples (∼100 mg) were prepared by homogenization in modified RIPA buffer (1× PBS, 1% Igepal CA-630, 0.5% sodium deoxycholate, 0.1% SDS, 10 mg/mL PMSF,
Fig. 1. Physical characteristics of control mice, db/db mice, and db/db mice after exercise training on body weight (A), blood glucose (B), heart weight (C), and the heart weight-to-body weight ratio (D). Values are expressed as mean ± SEM for 10–12 mice in each group. CN, control mice; DS, diabetic sedentary mice; DT, diabetic trained mice. *p < 0.05, **p < 0.01, ***p < 0.001.
196
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
Fig. 2. Expression of IRAP mRNA (A) and protein (B) hearts from in control mice, db/db mice, and db/db mice subjected to exercise training. Values are expressed as mean ± SEM obtained from 2 separate experiments each performed with 5 hearts. CN, control mice; DS, diabetic sedentary mice; DT, diabetic trained mice. **p < 0.01.
aprotinin, 100 mM sodium orthovanadate and 4% protease inhibitor). After 2 h in constant agitation at 4 ◦ C, the samples were centrifuged at 10,000 × g for 20 min at 4 ◦ C. The supernatants were collected and the protein concentration was determined by modified Bradford assay. Thirty micrograms of total protein were applied to each well of 10% SDS polyacrylamide gel and electrophoresed for 2 h at 130 V along with a set of molecular weight markers (RPN800, Amersham Biosciences, Baie d’Urfe, PQ). The resolved protein bands were then transferred onto PVDF membranes (Hybond-C; Amersham Pharmacia Biotech Inc., Piscataway, NJ) at 30 V for 120 min at room temperature using a transfer buffer (25 mmol/L Tris base, 192 mmol/L glycine, 20% methanol). The blots were blocked overnight at 4 ◦ C with blocking buffer (5% non-fat milk in 10 mmol/L Tris, pH 7.5, 100 mmol/L NaCl, 0.1% Tween 20). The membranes were then probed with specific primary antibodies overnight at 4 ◦ C. The primary antibodies obtained from Santa Cruz Biotechnology (Santa Cruz, CA) are following: GATA4 (1:500, sc-25310), Nab1 (1:1000, sc-12147), HSP70 (1:10,000, sc-32239), OTR (1:2000, sc-8102), eNOS (1:1000, sc-654), and VEGF (1:2000, sc-152); IRAP (1:10,000, kindly provided by Dr. Pilch, Boston University School of Medicine, MA); HIF1␣ (1:2000, NB100-105, Novus Biologicals, Oakville, ON, Canada). As an internal control, blots were reprobed with either anti--actin antibody (1:2000; sc-1616, Santa Cruz Biotechnology, Santa Cruz, CA) or anti--GAPDH antibody
Fig. 3. Cardiac GATA4 mRNA expression (A) and protein expression (B) in control and db/db hearts. Values are expressed as mean ± SEM obtained from 2 separate experiments each performed with 5 hearts. CN, control mice; DS, diabetic sedentary mice; DT, diabetic trained mice. *p < 0.05, ***p < 0.001.
(1:20,000, G9545-200UL, Sigma Aldrich, Oakville, ON, Canada). Blots were then washed using TBS washing buffer (10 mmol/L Tris, pH 7.5, 100 mmol/L NaCl, 0.1% Tween 20) and incubated with horseradish peroxidase-conjugated immunoglobulin G (GE Healthcare UK Limited) during 1 h at room temperature. The blots finally were detected by chemiluminescence detection system (RPN2132, Amersham Biosciences, Baie d’Urfe, PQ) and visualized by exposure to Kodak X-Omat film. Densitometric measurement of the bands was performed using Photoshop 7 software. 2.6. Statistical analysis Statistical analysis was performed using the statistical software package Prism 3.0. ANOVA nonparametric test and Bonferroni post hoc test were applied to analyze differences in three tested groups. All values are expressed as mean ± SEM with significance defined as p ≤ 0.05.
3. Results 3.1. Physical characteristics of db/db mice The physical characteristics of db/db mice obtained at the end of exercise training are illustrated in Fig. 1. Body weight was significantly higher in DS mice compared with CN mice and exercise training failed to reduce body weight.
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
197
Fig. 4. Cardiac oxytocin mRNA expression (A), oxytocin receptor mRNA expression (B) and oxytocin receptor protein expression (C) in control and db/db hearts. Values are expressed as mean ± SEM obtained from 2 separate experiments each performed with 5 hearts. CN, control mice; DS, diabetic sedentary mice; DT, diabetic trained mice. *p < 0.05, **p < 0.01, ***p < 0.001.
Similarly, plasma glucose was significantly elevated in DS mice compared with CN mice and DT mice remained hyperglycemic after exercise training. There were no differences in heart weight between CN mice and DS mice. However, heart weight was significantly lower in DT mice compared with CN mice. The heart-to-body weight ratios were lower in both DS and DT mice compared with CN mice. Also consistent with the db/db mouse, as shown in Fig. 2, is the significantly decreased mRNA and protein expression of IRAP in DS hearts compared with CN hearts. IRAP codistributes with GLUT4 and a depression in expression of IRAP reflects decreased glucose uptake [12]. In DT hearts, expression of IRAP also remained low compared with CN hearts. 3.2. Cardiac GATA4 and downstream genes As illustrated in Fig. 3, gene expression of GATA4 was significantly lower in hearts from DS mice compared with CN hearts. A significant reduction of GATA4 protein in DS hearts was also observed. Exercise proved to be beneficial in attenuating the reduction in GATA4 mRNA and protein expression from occurring in DT hearts. Expression of the cardiac oxytocin system is a function of GATA4 [20]. As shown in Fig. 4, expression of OT and
OTR was reduced in DS hearts compared with CN hearts. Despite the increase in GATA4 expression seen in DT hearts, this was not associated with the accompanying changes in the expression of OT and OTR. Expression of ANP and BNP is illustrated in Fig. 5. Further associated with reduced expression of GATA4 in db/db hearts is the down-regulation of ANP and BNP. Although not significant, mRNA expression of ANP was 45% lower in DS hearts compared with CN hearts, whereas expression of BNP mRNA was significantly reduced in DS hearts. No improvement in the expression of ANP and BNP mRNA levels was observed in DT hearts. Fig. 6 shows that mRNA expression of ␣-MHC expression was altered by exercise training and the diabetic state. Indeed, expression of ␣-MHC expression was increased in CT hearts compared with CN hearts. In DS hearts, expression of ␣MHC was reduced by ∼50% compared to CN hearts. After exercise training, however, mRNA expression of ␣-MHC was significantly increased in DT hearts compared with CN and DS hearts. -MHC expression was not affected by exercise training in control and diabetic hearts, but expression was significantly lower in DT hearts compared with CT hearts. As a result of the minor changes in the expression -MHC, the ratio of ␣- to -MHC mirrored the changes seen in ␣-MHC
198
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
Expression of the cardiac hypertrophy marker Nab-1 is shown in Fig. 9. Gene expression of Nab-1 mRNA was not altered by either the diabetic state or with exercise training. However, Nab-1 protein levels were significantly lower in DS and DT hearts compared with CN hearts. Expression of HSP-70 is shown in Fig. 10. There were no changes in the mRNA HSP-70 expression between CN and DS hearts. However, mRNA expression was significantly increased by exercise training in CT hearts only. Protein expression, on the other hand, was significantly decreased in DS hearts compared with CN, and exercise training had no effect on protein expression of HSP-70.
4. Discussion
Fig. 5. Cardiac ANP mRNA expression (A) and BNP mRNA expression (B) in control and db/db hearts. Values are expressed as mean ± SEM obtained from 2 separate experiments each performed with 5 hearts. CN, control mice; DS, diabetic sedentary mice; DT, diabetic trained mice. *p < 0.05, ***p < 0.001.
expression. The ratio was increased with exercise training, and decreased in hearts of sedentary diabetic mice. We have previously shown that synthesis of nitric oxide is a component of the oxytocin–natriuretic peptide system in the heart [7]. As illustrated in Fig. 7, both mRNA and protein expression of eNOS were reduced in DS hearts, a finding that is consistent with reductions in OT and NP expression in db/db hearts [7]. Exercise training failed to increase the mRNA expression of eNOS, but was benefit and induced a significant increase in the protein expression compared with DS hearts. Fig. 8 illustrates the expression of angiogenic markers HIF-1 and VEGF, the latter dependent on GATA4 function. There were no significant differences in mRNA or protein expression in these markers between CN and DS groups. However, exercise training resulted in significant increases in protein expression of both VEGF and HIF-1 compared with CN and DS hearts, with the greatest increases seen in HIF-1 in DT hearts. A significant increase in mRNA expression in VEGF and HIF-1 was observed in CT hearts, although mRNA expression was increased by ∼30% and ∼60%, respectively, in DT hearts.
One strategy that favorably impacts cardiovascular outcomes in patients with type 2 diabetes is regular physical activity. Beneficial effects on cardiovascular risk factors have been reported in exercising overweight diabetic patients independently of weight loss [21]. Improvement of cardiovascular risk factors, such as lipids, oxidative stress, and endothelial dysfunction reported in representative experimental models, such as in the obese diabetic db/db mouse, also occur in the absence of any beneficial effects on obesity and hyperglycemia [22–24]. In this study, we examined the effects of diabetes and the combined effects of diabetes and exercise on cardiac expression of GATA4 and related genes. We chose the db/db mouse as model of study because over 90% of human cases of diabetes cases fall into the type 2 category and this model is a close counterpart to the human condition. However, a hallmark feature of this model is hyperleptinemia, as a result of leptin resistance, which is rarely a cause of diabetes but nonetheless reported in obesity and diabetes [25]. We showed that db/db mice remained hyperglycemic and obese after exercise training, findings that confirm results from earlier studies using treadmill running as an exercise paradigm [18,23,24]. Despite the lack of benefit on these markers after exercise, improvements in the expression of certain genes were observed. Our results show that mRNA and protein expression of GATA4 in the db/db heart are reduced. This is consistent with earlier work that report decreased expression of cardiac GATA4 in the presence of acute hyperglycemia, and similarly in the streptozotocin model of type 1 diabetes and the db/db mouse [26]. Decreased cardiac expression of GATA4, to our knowledge, has not been reported in adult human diabetic myocardium, although low levels of GATA4 have been linked to atrial septal defect in neonatal diabetes [27]. The consequences of this reduction in GATA4 on the synthesis of ascribed downstream genes were also examined. Decreased expression of OT and its receptor, ANP, BNP, eNOS, and ␣-MHC was observed in db/db hearts. These findings are in line with our recent work [7] and also reported by others [28]. In ob/ob mouse myocardium, decreased expression of OT, natriuretic peptides and eNOS has been reported, findings
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
199
Fig. 6. Cardiac ␣-MHC mRNA expression (A), -MHC mRNA expression (B) and the /␣ mRNA MHC ratio (C) in control and db/db hearts. Values are expressed as mean ± SEM obtained from 2 separate experiments each performed with 5 hearts. CN, control mice; CT, control trained mice; DS, diabetic sedentary mice; DT, diabetic trained mice. *p < 0.05, **p < 0.01.
also observed in the fat-fed C57BL/6 mouse, suggesting that the expression of these genes is not solely related to defective leptin signaling, but also by lifestyle modification [28]. A reduction in GATA4 may explain these changes by view of support of GATA4-deleted and overexpression leads to corresponding changes in gene expression [10,11,29,30]. However, the exact mechanism causing the reduction in the expression of OT, natriuretic peptides, and eNOS in myocardium is still not well understood. Earlier reports link a deficiency in these peptides to increased apoptosis, fibrosis, and hypertrophy of cardiomyocytes [7,28]. A cardioprotective role of OT is proposed in view of its ability to stimulate glucose uptake cardiomyocytes and exerting a robust antiischemic effect [31,32]. Impaired diuresis, natriuresis, and vasoconstriction are reported with a deficiency in OT, ANP and BNP [33,34]. Reduced plasma BNP levels have been observed in obese patients, and this could account for the greater propensity toward sodium retention, volume expansion, and heart failure observed in these patients [35–37]. Although expression of VEGF is a function of GATA4 [9], the reduction in GATA4 in db/db hearts was not accompanied with a corresponding change in the expression of this angiogenic marker. The hyperglycemic state typically induces remodeling in both skeletal muscle and myocardium and observed changes include a lower capillary-to-fiber ratio which reduces capillary diffusion [38,39]. There appears to be some inconsistencies in the literature regarding the effects of
experimental diabetes on VEGF expression in myocardium, with reports showing either higher or lower expression. However, in the present study, we found that there were no differences in the expression of this marker between db/db and control hearts. The reasons for these inconsistencies are unknown, and may relate to the duration and severity of diabetes or to a down-regulation of the VEGF-A receptor expressed in the myocardium and differences in the expression of antiangiogenic factors [40,41]. In the myocardium of diabetic patients, inconsistencies regarding the VEGF expression also exist, but reduced neoangiogenesis is nonetheless observed in patients with ischemic cardiomyopathy despite increased VEGF expression [42,43]. The results of these studies clearly demonstrate the impact of the various forms of the diabetic state on angiogenic signaling in the heart. Our results show that exercise training was of benefit on GATA4 expression in db/db mice, resulting in a significant increase in mRNA and protein expression. This improvement occurred despite the fact that mice remained in the hyperglycemic state. This increase in GATA4 expression was not associated with corresponding changes in the expression of GATA4-regulated downstream genes, although of the genes studied, eNOS, ␣-MHC, and VEGF expression were increased as a function of GATA4. Attention has been given to the role of exercise training on eNOS expression in the db/db model with the reported changes typically beneficial, suggesting improved endothelial function [7,22,23]. In the db/db
200
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
Fig. 7. Cardiac eNOS mRNA expression (A) and eNOS protein expression (B) in control and db/db hearts. Values are expressed as mean ± SEM obtained from 2 separate experiments each performed with 5 hearts. CN, control mice; DS, diabetic sedentary mice; DT, diabetic trained mice. *p < 0.05, ***p < 0.001.
mouse, short term exercise improves aortic function without reducing plasma levels of inflammatory markers [44], and long term exercise was reported to restore coronary artery endothelial function by increased nitric oxide bioavailability independent of the hyperglycemic state [23]. We show that cardiac eNOS expression was increased in db/db mice following exercise, even in the presence of persistent hyperglycemic and obese states, indicating a beneficial effect on vascular function. Along with increased expression of GATA4 in myocardium of trained db/db mice is the observed improvement of VEGF protein expression. This, in conjunction with the eNOS findings, may further indicate improved vascular function in the db/db heart. The effect of exercise training on the expression of this marker has been reported in skeletal muscle and in the streptozotocin-induced diabetic mouse with slight improvements observed [41]. However, we are the first to show that protein expression of VEGF is increased in myocardium following exercise in the db/db mouse. VEGF expression occurs in response to various factors, including the shear stress of blood flow during exercise as well as from expression of eNOS and HIF-1 [45]. We demonstrated increased expression of eNOS in db/db hearts which may explain the increase in VEGF in db/db hearts after exercise. Similarly, the increased expression of HIF-1, as a result of training-induced hypoxemia, would also explain the improvement in VEGF expression [45].
Fig. 8. Cardiac VEGF mRNA (A) and protein (B) expression, and HIF-1 mRNA (C) and protein (D) expression in control and db/db hearts. Values are expressed as mean ± SEM obtained from 5 to 6 hearts in each group. CN, control mice; CT, control trained mice; DS, diabetic sedentary mice; DT, diabetic trained mice. *p < 0.05, **p < 0.01.
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
Fig. 9. Cardiac NAB-1 mRNA expression (A) and NAB-1 protein expression (B) in control and db/db hearts. Values are expressed as mean ± SEM obtained from 2 separate experiments each performed with 5 hearts. CN, control mice; DS, diabetic sedentary mice; DT, diabetic trained mice. ***p < 0.001.
The mechanism explaining the increase in GATA4 expression in db/db hearts following exercise is unknown. Hyperglycemia has been previously proposed as a mechanism to deplete GATA4 levels in the diabetic heart [26,46]. Our finding is rather intriguing as exercise training was not effective in reducing the extent of hyperglycemia in db/db mice, and still GATA4 levels were increased. Degradation of GATA4 by hyperglycemia is mediated by an increase in reactive oxygen species and by ubiquitination through the ubiquitin–proteosome system, with increased expression of E3-ubiquitin ligase CHIP as mechanism [26,47,48]. One explanation that could account for the preservation of GATA4 content db/db hearts after exercise training is that exercise overcomes the degradation effects of hyperglycemia and ubiquitination. Evidence for this effect is suggested in a recent study demonstrating a reduction in the expression of the E3-ubiquitin ligase Murf1 in hearts of trained rats [49]. It is proposed that the reduction in the expression of this ligase is linked to the inflammatory marker TNF-␣, known to be elevated in db/db hearts [50], which can be mitigated by regular exercise [51]. Several factors regulate the expression of ␣- and -MHC isoforms in the heart, including the developmental milieu, pathological states, and exercise training [16,52–55]. In the diabetic heart, a shift from the normally predominant ␣-MHC toward -MHC is typically observed [4,56]. Up-regulation of
201
Fig. 10. Cardiac HSP70 mRNA expression (A) and HSP70 protein expression (B) in control and db/db hearts. Values are expressed as mean ± SEM obtained from 2 separate experiments each performed with 5 hearts. CN, control mice; CT, control trained mice; DS, diabetic sedentary mice; DT, diabetic trained mice. **p < 0.01, ***p < 0.001.
-MHC expression in the heart is also observed in response to the hemodynamic load of exercise training [17,57]. We show that expression of -MHC was not affected by the diabetic state. Similarly, expression of -MHC was not affected by exercise training, where a slight decrease in the expression of -MHC was observed. Failure of endurance training to increase the expression of -MHC was observed is not consistent with previous work, and this finding may represent a maladaptation to exercise in the db/db model. In young hypothyroid rats, it is interesting to note that exercise training was not associated with cardiac hypertrophy and had no effect in attenuating the increase in the expression of -MHC [58,59]. In the streptozotocin diabetic rat heart, expression of -MHC is increased and exercise training failed to downregulate the expression of this protein [56], findings which are in contrast to our data. The reasons for this discrepancy are not clear, but may relate to differences in the diabetic model used, the severity of the diabetic state, and volume of exercise training. 5. Conclusions We demonstrate that hearts from db/db mice exhibit decreased levels of GATA4 and down-regulation of most of
202
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
its ascribed gene transcripts. Although exercise had a stimulatory effect on cardiac GATA4 mRNA and protein expression, this was not associated with corresponding increases in the expression of most regulated genes studied, possibly indicating either impaired synthesis as a result of exercise training or from impaired activation of other GATA transcription factors in the db/db myocardium. Regardless, exercise training increased eNOS, ␣-MHC, and VEGF expression, suggesting a beneficial response on vascular and cardiac function.
Acknowledgements This work was supported by the Canadian Institute of Health Research (CIHR, MOP-53217, NET Program) and the Canadian Heart and Stroke Foundation (CHSF, NET Program) as grants to JG and MJ, and by the Office of Research and Sponsored Programs of Midwestern University and the Diabetes Action and Research Education Foundation to TLB.
References [1] W.B. Kannel, D.L. McGee, Diabetes and cardiovascular risk factors: the Framingham study, Circulation 59 (1979) 8–13. [2] Z.Y. Fang, J.B. Prins, T.H. Marwick, Diabetic cardiomyopathy: evidence, mechanisms, and therapeutic implications, Endocrine Reviews 25 (2004) 543–567. [3] R.D. Abbott, R.P. Donahue, W.B. Kannel, P.W. Wilson, The impact of diabetes on survival following myocardial infarction in men vs women. The Framingham Study, Journal of the American Medical Association 260 (1988) 3456–3460. [4] C. Depre, M.E. Young, J. Ying, H.S. Ahuja, Q. Han, N. Garza, P.J. Davies, H. Taegtmeyer, Streptozotocin-induced changes in cardiac gene expression in the absence of severe contractile dysfunction, Journal of Molecular and Cellular Cardiology 32 (2000) 985–996. [5] S.W. Schaffer, M.S. Mozaffari, M. Artman, G.L. Wilson, Basis for myocardial mechanical defects associated with non-insulin-dependent diabetes, American Journal of Physiology 256 (1989) E25–E30. [6] W.C. Stanley, G.D. Lopaschuk, J.G. McCormack, Regulation of energy substrate metabolism in the diabetic heart, Cardiovascular Research 34 (1997) 25–33. [7] J. Gutkowska, T.L. Broderick, D. Bogdan, D. Wang, J.-M. Lavoie, M. Jankowski, Downregulation of oxytocin and natriuretic peptides in diabetes: possible implications in cardiomyopathy, Journal of Physiology 587 (19) (2009) 4725–4736. [8] J.D. Molkentin, The zinc finger-containing transcription factors GATA4, -5, and -6. Ubiquitously expressed regulators of tissue-specific gene expression, Journal of Biological Chemistry 275 (50) (2000) 38949–38952. [9] J. Heineke, M. Auger-Messier, J. Xu, T. Oka, M.A. Sargent, A. York, R. Klevitsky, S. Vaikunth, S.A. Duncan, B.J. Aronow, J. Robbins, T.M. Crombleholme, J.D. Molkentin, Cardiomyocyte GATA4 functions as a stress-responsive regulator of angiogenesis in the murine heart, Journal of Clinical Investigation 117 (2007) 3198–3210. [10] E. Bisping, S. Ikeda, S.W. Kong, O. Tarnavski, N. Bodyak, J.R. McMullen, S. Rajagopal, J.K. Son, Q. Ma, Z. Springer, P.M. Kang, S. Izumo, W.T. Pu, Gata4 is required for maintenance of postnatal cardiac function and protection from pressure overload-induced heart failure, Proceedings of the National Academy of Sciences of the United States of America 103 (2006) 14471–14476.
[11] Q. Liang, J.J. De Windt, S.A. Witt, T.R. Kimball, B.E. Markham, J.D. Molkentin, The transcription factors GATA4 and GATA6 regulate cardiomyocyte hypertrophy in vitro and in vivo, Journal of Biological Chemistry 276 (2001) 30245–30253. [12] T.L. Broderick, M. Jankowski, D. Wang, D. Bogdan, C.R. Parrott, J. Gutkowska, Down-regulation in GATA4 and downstream structural and contractile proteins in the db/db mouse heart, ISRN Endocrinology 2012 (2012) 736860. [13] N.G. Boule, E. Haddad, G.P. Kenny, G.A. Wells, R.J. Sigal, Effects of exercise on glycemic control and body mass in type 2 diabetes mellitus: a meta-analysis of controlled clinical trials, Journal of the American Medical Association 286 (2001) 1218–1227. [14] R.S. Paffenbarger Jr., R.T. Hyde, A.L. Wing, I.M. Lee, D.L. Jung, J.D. Kampert, The association of changes in physical-activity level and other lifestyle characteristics with mortality among men, New England Journal of Medicine 328 (1993) 538–545. [15] C. Saraceni, T.L. Broderick, Cardiac and metabolic consequences of exercise training in experimental diabetes, Current Diabetes Reviews 3 (2007) 75–84. [16] D.P. Fitzsimons, P.W. Bodell, R.E. Herrick, K.M. Baldwin, Left ventricular functional capacity in the endurance-trained rodent, Journal of Applied Physiology 69 (1990) 305–312. [17] K. Rafalski, A. Abdourahman, J.G. Edwards, Early adaptations to training: upregulation of alpha-myosin heavy chain gene expression, Medicine and Science in Sports and Exercise 39 (2007) 75–82. [18] J. Sennott, J. Morrissey, P.R. Standley, T.L. Broderick, Treadmill exercise training fails to restore defects in glucose, insulin and muscle glut4 content in the db/db mouse model of diabetes, Pathophysiology 15 (2008) 173–179. [19] D.E. James, K.M. Burleigh, E.W. Kraegen, D.J. Chisholm, Effect of acute exercise and prolonged training on insulin response to intravenous glucose in vivo in rat, Journal of Applied Physiology 55 (1983) 1660–1664. [20] J. Uchida, S. Fuke, T. Tsukahara, Upregulations of Gata4 and oxytocin are important in cardiomyocyte differentiation processes of P19CL6 cells, Journal of Cellular Biochemistry 100 (3) (2007) 629–641. [21] E.W. Gregg, R.B. Gerzoff, T.J. Thompson, D.F. Williamson, Trying to lose weight, losing weight, and 9-year mortality in overweight U.S. adults with diabetes, Diabetes Care 27 (2004) 657–662. [22] K.A. Esser, W. Su, S. Matveev, V. Wong, L. Zeng, J.J. McCarthy, E.J. Smart, Z. Guo, M.C. Gong, Voluntary wheel running ameliorates vascular smooth muscle hyper-contractility in type 2 diabetic db/db mice, Applied Physiology, Nutrition, and Metabolism 32 (2007) 711–720. [23] F. Moien-Afshari, S. Ghosh, S. Elmi, M. Khazaei, M.M. Rahman, N. Sallam, I. Laher, Exercise restores coronary vascular function independent of myogenic tone or hyperglycemic status in db/db mice, American Journal of Physiology: Heart and Circulatory Physiology 295 (2008) H1470–H1480. [24] F. Moien-Afshari, S. Ghosh, S. Elmi, M.M. Rahman, N. Sallam, M. Khazaei, T.J. Kieffer, R.W. Brownsey, I. Laher, Exercise restores endothelial function independently of weight loss or hyperglycaemic status in db/db mice, Diabetologia 15 (7) (2008) 1327–1337. [25] G.A. Bray, D.A. York, Clinical review 90: leptin and clinical medicine: a new piece in the puzzle of obesity, Journal of Clinical Endocrinology and Metabolism 82 (1997) 2771–2776. [26] S. Kobayashi, K. Mao, H. Zheng, X. Wang, C. Patterson, T.D. O’connell, Q. Liang, Diminished GATA4 protein levels contribute to hyperglycemia-induced cardiomyocyte injury, Journal of Biological Chemistry 282 (30) (2007) 21945–21952. [27] E. D’Amato, F. Giacopelli, G. Giannattasio, R. Bocciardi, M. Musso, R. Lorini, R. Ravazzolo, Genetic investigation in an Italian child with an unusual association of atrial septal defect, attributable to a new familial GATA4 gene mutation, and neonatal diabetes due to pancreatic agenesis, Diabetic Medicine 27 (2010) 1195–2000. [28] E.D. Bartels, J.M. Nielsen, L.S. Bisgaard, J.P. Goetze, L.B. Nielsen, Decreased expression of natriuretic peptides associated with lipid
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
[29]
[30]
[31]
[32]
[33]
[34]
[35]
[36]
[37]
[38]
[39]
[40]
[41]
[42]
[43]
accumulation in cardiac ventricle of obese mice, Endocrinology 151 (2010) 5218–5225. T. Oka, M. Maillet, A.J. Watt, R.J. Schwartz, B.J. Aronow, S.A. Duncan, J.D. Molkentin, Cardiac-specific deletion of Gata4 reveals its requirement for hypertrophy, compensation, and myocyte viability, Circulation Research 98 (2006) 837–845. F. Charron, G. Tsimiklis, M. Arcand, L. Robitaille, Q. Liang, J.D. Molkentin, S. Meloche, M. Nemer, Tissue-specific GATA factors are transcriptional effectors of the small GTPase RhoA, Genes and Development 15 (2001) 2702–2719. M. Florian, M. Jankowski, J. Gutkowska, Oxytocin increases glucose uptake in neonatal cardiomyocytes, Endocrinology 151 (2010) 482–491. M. Ondrejcakova, T. Ravingerova, J. Bakos, D. Pancza, D. Jezova, Oxytocin exerts protective effects on in vitro myocardial injury induced by ischemia and reperfusion, Canadian Journal of Physiology and Pharmacology 87 (2) (2009) 137–142. R.L. Woods, Cardioprotective functions of atrial natriuretic peptide and B-type natriuretic peptide: a brief review, Clinical and Experimental Pharmacology and Physiology 31 (2004) 791–794. T. Tokudome, T. Horio, T. Soeki, K. Mori, I. Kishimoto, S. Suga, F. Yoshihara, Y. Kawano, M. Kohno, K. Kangawa, Inhibitory effect of C-type natriuretic peptide (CNP) on cultured cardiac myocyte hypertrophy: interference between CNP and endothelin-1 signaling pathways, Endocrinology 145 (2004) 2131–2140. H. Kalsch, T. Neumann, R. Erbel, Less increase of BNP and NT-proBNP levels in obese patient with decompensated heart failure Interpretation of natriuretic peptides in obesity, International Journal of Cardiology 133 (1) (2009) e22–e24. M.R. Mehra, P.A. Uber, M.N. Park, S.L. Scott, H.O. Ventura, B.C. Harris, E.D. Frohlich, Obesity and suppressed B-type natriuretic peptide levels in heart failure, Journal of the American College of Cardiology 43 (2004) 1590–1595. J.A. Taylor, R.H. Christenson, K. Rao, M. Jorge, S.S. Gottlieb, Btype natriuretic peptide and N-terminal pro B-type natriuretic peptide are depressed in obesity despite higher left ventricular end diastolic pressures, American Heart Journal 152 (2006) 1071–1076. W.L. Sexton, D.C. Poole, O. Mathieu-Costello, Microcirculatory structure–function relationships in skeletal muscle of diabetic rats, American Journal of Physiology: Heart and Circulatory Physiology 266 (1994) H1502–H15011. C.A. Kindig, W.L. Sexton, M.R. Fedde, D.C. Poole, Skeletal muscle microcirculatory structure and hemodynamics in diabetes, Respiration Physiology 111 (1998) 163–175. R. Rivela, M. Silvennoinen, A.-M. Touvra, T.M. Lehti, H. Kainulainen, V. Vihko, Effects of experimental type 1 diabetes and exercise training on angiogenic gene expression and capillarization in skeletal muscle, FASEB Journal 20 (2006) E921–E930. R. Rivela, M. Silvennoinen, M. Lehti, S. Jalava, V. Vihko, H. Kainulainen, Exercise-induced expression of angiogenic growth factors in skeletal muscle and in capillaries of healthy and diabetic mice, Cardiovascular Diabetology 7 (2008) 13, http://dx.doi.org/10.1186/14752840-7-13. F.C. Sasso, D. Torella, O. Carbonara, G.M. Ellison, M. Torella, M. Scardone, C. Marra, R. Nasti, R. Marfella, D. Cozzolino, C. Indolfi, M. Cotrufo, R. Torella, T. Salvatore, Increased vascular endothelial growth factor expression but impaired vascular endothelial growth factor receptor signaling in the myocardium if type 2 diabetic patients with chronic coronary heart disease, Journal of the American College of Cardiology 46 (2005) 827–834. E. Chou, I. Suzuma, K.J. Way, D. Opland, A.C. Clermont, K. Naruse, K. Suzuma, N.L. Bowling, C.J. Vlahos, L.P. Aiello, G.L. King, Decreased
[44]
[45] [46]
[47]
[48]
[49]
[50]
[51]
[52]
[53]
[54]
[55]
[56]
[57]
[58]
[59]
203
cardiac expression of vascular endothelia growth factor in insulinresistant and diabetic states. A possible explanation for impaired collateral formation in cardiac tissue, Circulation 105 (2002) 373–379. N. Sallam, M. Khazaei, I. Laher, Effect of moderate-intensity exercise on plasma C-reactive protein and aortic endothelial function in type 2 diabetic mice, Mediators of Inflammation 2010 (2010) 149678 (Epub 2010 August 2). S. Egginton, Physiological factors influencing capillary growth, Acta Physiologica (Oxford, England) 202 (2011) 225–239. Z. Liu, W.R. Miers, L. Wei, E.J. Barrett, The ubiquitin–proteasome proteolytic pathway in heart vs skeletal muscle: effects of acute diabetes, Biochemical and Biophysical Research Communications 276 (2000) 1255–1260. S.W. Lee, G. Dai, Z. Hu, X. Wang, J. Du, W.E. Mitch, Regulation of muscle protein degradation: coordinated control of apoptotic and ubiquitin–proteasome systems by phosphatidylinositol 3 kinase, Journal of the American Society of Nephrology 15 (2004) 1537–1545. P. Razeghi, K.K. Baskin, S. Sharma, M.E. Young, S. Stepkowski, M.F. Essop, H. Taegtmeyer, Atrophy, hypertrophy, and hypoxemia induce transcriptional regulators of the ubiquitin proteasome system in the rat heart, Biochemical and Biophysical Research Communications 342 (2006) 361–364. V. Adams, A. Linke, S. Gielen, S. Erbs, R. Hambrecht, G. Schuler, Modulation of Murf-1 and MAFbx expression in the myocardium by physical exercise training, European Journal of Cardiovascular Prevention and Rehabilitation 15 (2008) 293–299. Y. Park, J. Yang, H. Zhang, X. Chen, C. Zhang, Effect of PAR2 in regulating TNF-␣ and NAD(P)H oxidase in coronary arterioles in type 2 diabetic mice, Basic Research in Cardiology 106 (1) (2010) 111–123 (Epub 2010 October 24). R.L. Bradley, J.Y. Jeon, F.F. Liu, E. Maratos-Flier, Voluntary exercise improves insulin sensitivity and adipose tissue inflammation in dietinduced obese mice, American Journal of Physiology: Endocrinology and Metabolism 295 (3) (2008) E586–E594. D.L. Allen, L.A. Leinwand, Postnatal myosin heavy chain isoform expression in normal mice and mice null for IIb or IId myosin heavy chains, Developmental Biology 229 (2001) 383–395. W.H. Dillmann, Hormonal influences on cardiac myosin ATPase activity and myosin isoenzyme distribution, Molecular and Cellular Endocrinology 34 (1984) 169–181. M. Krenz, J. Robbins, Impact of beta-myosin heavy chain expression on cardiac function during stress, Journal of the American College of Cardiology 44 (2004) 2390–2397. J.J. Mercadier, A.M. Lompre, C. Wisnewsky, J.L. Samuel, J. Bercovici, B. Swynghedauw, K. Schwartz, Myosin isoenzyme changes in several models of rat cardiac hypertrophy, Circulation Research 49 (1981) 525–532. D.J. Paulson, M. Gupta, R. Zak, J. Zhao, Effects of exercise training and diabetes on cardiac myosin heavy chain composition, Molecular and Cellular Biochemistry 117 (1992) 175–179. R.C. Hickson, G.T. Hammons, J.O. Holoszy, Development and regression of exercise-induced cardiac hypertrophy in rats, American Journal of Physiology 236 (1979) H268–H272. H.L. Katzeff, K.M. Ojamaa, I. Klein, Effects of exercise on protein synthesis and myosin heavy chain gene expression in hypothyroid rats, American Journal of Physiology 267 (1994) E63–E67. J. Giger, A.X. Qin, P.W. Bodell, K.M. Baldwin, F. Haddad, Activity of the beta-myosin heavy chain antisense promoter responds to diabetes and hypothyroidism, American Journal of Physiology: Heart and Circulatory Physiology 292 (2007) H3065–H3071.
Expression of cardiac GATA4 and downstream genes after exercise training in the db/db mouse Tom L. Broderick a,∗ , Cassandra R. Parrott a , Donghao Wang b , Marek Jankowski b , Jolanta Gutkowska b b
a Laboratory of Diabetes and Exercise Metabolism, Midwestern University, Glendale, AZ, USA Laboratory of Cardiovascular Biochemistry, Centre Hospitalier de L’Université de Montréal-Hôtel-Dieu Research Centre, Montréal, Québec, Canada
Received 27 February 2012; received in revised form 30 May 2012; accepted 7 June 2012
Abstract GATA4 is a transcriptional factor expressed in heart that regulates the synthesis of structural and cardioprotective genes. We have demonstrated that low GATA4 expression in the db/db mouse heart is associated with reduced expression of key downstream genes, including oxytocin (OT) natriuretic peptide (A-, B-type), nitric oxide synthase (eNOS), and myosin heavy chain (␣-MHC). In this study, the effect of exercise on GATA4 expression and related genes was determined in the db/db mouse, a model that represents human type 2 diabetes. Vascular endothelial growth factor (VEGF) and hypoxia-induced factor-␣ expression were also measured after 8 weeks of treadmill running. Compared with control littermates, db/db mice exhibited hyperglycemia and obesity, and exercise failed to improve these parameters. GATA4 expression was reduced in db/db hearts and this was associated with reduced expression of OT, OTR, ANP, BNP, eNOS, ␣-MHC, and ratio of ␣- to -MHC, whereas mRNA expression of -MHC and VEGF remained unchanged compared with control hearts. Exercise training increased GATA4 expression (mRNA and protein) but most genes regulated by GATA4 were not observed to increase accordingly. However, protein expression of eNOS, mRNA expression of ␣-MHC, ratio of ␣- to -MHC, and protein expression of VEGF were increased in db/db hearts after exercise. In conclusion, while GATA4 expression is increased following exercise, not all structural and cardioprotective genes are expressed, suggesting other transcription factors may be involved in this regulation. Regardless of this effect, the positive effect of exercise training on key protective genes is evident in the db/db mouse heart. © 2012 Elsevier Ireland Ltd. All rights reserved. Keywords: GATA4; Oxytocin; Natriuretic peptides; VEGF; Exercise; db/db
1. Introduction Diabetes is a major risk for cardiovascular diseases [1]. Left ventricular dysfunction is a significant adverse outcome that occurs in type 2 diabetes in the absence of existing co-morbidities such as ischemic, hypertensive and valvular heart disease [2]. Type 2 diabetes is also associated with a heightened mortality rate following ischemic events [3]. Disturbances in cardiac energy metabolism, endothelial dysfunction, and altered transcription of genes encoding for ∗ Corresponding author at: Department of Physiology, Laboratory of Diabetes and Exercise Metabolism, Midwestern University, 19555 North 59th Avenue, Glendale, AZ 85308, USA. Tel.: +1 623 572 3664; fax: +1 623 572 3673. E-mail address: [email protected] (T.L. Broderick).
0928-4680/$ – see front matter © 2012 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.pathophys.2012.06.001
contractile proteins and cardioprotective peptides contribute to deteriorating left ventricular function in diabetes [4–7]. GATA4 is a zinc finger-containing transcription factor involved in cardiomyocyte differentiation during embryonic development, and is also highly expressed in adult cardiac cells [8]. GATA4 regulates the transcription of structural and cardioprotective genes, including myosin heavy chain (MHC), A-, and B-type atrial natriuretic peptides (NP), oxytocin (OT), and endothelial nitric oxide synthesis (eNOS). GATA4 also regulates the expression of the angiogenic marker vascular endothelial growth (VEGF-1) factor [9], which is also regulated by eNOS. As a result, GATA4 is essential for various adaptive responses in the heart including myocyte survival, angiogenesis, and hypertrophy in response to exercise [8–11]. In the db/db mouse heart, GATA4 expression is reduced and we have shown that this is associated
194
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
with a corresponding decrease in the synthesis of GATA4associated genes and peptides [12]. Regular physical activity is a key strategy to reduce the risk of cardiovascular disease in patients with type 2 diabetes. Exercise controls body weight, improves glucose control, and reduces the incidence of type 2 diabetes [13,14]. Further, cardiomyopathy and sensitivity to ischemic damage can be attenuated by regular exercise [15]. Reduction in plasma lipids and adiposity, improved insulin sensitivity, and more efficient energy metabolism have all been implicated to explain the beneficial effect of exercise on the myocardium [15]. Additionally, a direct role of transcription factors has been proposed to account for these positive effects based on the observation that the physiological stimulus of exercise regularly induces cardiac hypertrophy [16,17]. However, the impact of exercise training on key GATA4-regulated genes in the db/db mouse heart is poorly understood. The present study investigates the effect of type 2 diabetes on GATA4 content and expression of downstream regulated structural and cardioprotective genes in response to exercise training. We use the db/db mouse model of diabetes due to its close representation to human type 2 diabetes. The onset of diabetes is gradual with mice exhibiting obesity, hyperglycemia, and subsequent hyperinsulinemia as a result of two mutant copies of the leptin receptor gene. To our knowledge, this is the first study to explore the effects of exercise on GATA-4 regulated downstream genes in the db/db mouse.
2. Methods 2.1. Mouse model of diabetes The Midwestern University Research and Animal Care Committee approved this study. All animals used in this study were cared in accordance to the recommendations in The Guide for the Care and Use of Laboratory Animals, National Institute of Health, Publ. No. 85-23, 1986. Mice of the db/db strain (C57BL/KsJ-leptdb -leptdb ) were obtained from Jackson Laboratories (Bar Harbor, ME) at the age of 6 weeks. This strain displays many of the metabolic perturbations associated with type 2 diabetes. The onset of diabetes is gradual and characterized by the obese phenotype with hyperglycemia and subsequent hyperinsulinemia as a result of two mutant copies of the leptin receptor gene. The lean littermates possess one mutant and one normal copy of the leptin gene (db/+). 2.2. Exercise training protocol At 8 weeks of age, db/db mice were randomly assigned to four groups: control sedentary (CN), diabetic sedentary (DS), control runners (CT), and diabetic runners (DT). Treadmill training consisted of moderate intensity exercise 5 days per week on an electrically driven treadmill (Columbus Instr., OH) for a period of 8 weeks, as reported earlier [18]. In brief,
the training regimen consisted of a 3-week graded increase in exercise duration and intensity as follows: week 1, 10 min at 10 m/min; week 2, 20 min at 10 m/min; week 3, 30 min at 12 m/min and weeks 4–8, 30 min at 15 m/min. Mice were provided with food and water ad libitum and were kept in a room with alternating 12-h light/dark cycle and kept at 22 ◦ C. 2.3. Blood and tissue sampling At the end of the exercise training protocol, and 48 h after the last exercise session, overnight-fasted mice were sacrificed in the morning between 8 and 11 AM. This 48-h period was selected to eliminate the effect of the last exercise bout on insulin sensitivity [19]. A blood sample was obtained from the submandibular vein and mice were then immediately sacrificed by cervical dislocation. Blood was centrifuged (3000 rpm at 4 ◦ C, for 5 min), and plasma was kept at −80 ◦ C for later analysis. Hearts were rapidly removed and frozen with clamps pre-cooled to the temperature of liquid N2 for analysis of genes. Frozen tissue was first ground to powder under liquid nitrogen and then thoroughly homogenized using a Teflon pestle in a glass homogenization tube cooled in ice. 2.4. Real time PCR Total RNA was extracted from freeze-clamped hearts with Trizol reagent (Invitrogen Life Technologies, Burlington, ON) according to the manufacturer’s protocol. To remove genomic DNA, RNA samples were incubated with 2 U deoxyribonuclease I (DNase I; Invitrogen Life Technologies, Burlington, ON)/g RNA for 30 min at 37 ◦ C. PCR was carried out in the iCycler IQ Real time PCR detection system (Bio-Rad Laboratories, Hercules, CA), using SYBR® green chemistry. The samples were analyzed in duplicate or triplicate. For amplification, 2 l of diluted cDNA were added to a 20 l reaction mixture containing 1× iQ SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA) and 200 nM forward and reverse primers. The thermal cycling program was 95 ◦ C for 2 min, followed by 40 cycles of 95 ◦ C for 30 s, 60 ◦ C for 30 s, and 72 ◦ C for 30 s. The primers were purchased from Invitrogen Life Technologies (Burlington, ON). Primer sets served to generate amplicons (Table 1). Optical data were recorded during the annealing step of each cycle. After PCR, the reaction products were melted for 1 min at 95 ◦ C, the temperature was lowered to 55 ◦ C, and then gradually increased to 95 ◦ C in 1.0 ◦ C increments, 10 s per increment. Optical data were collected over the duration of the temperature increments, with a dramatic drop in fluorescence occurring. This was done to ensure that only 1 PCR product was amplified per reaction. The relative expression of the RT-PCR products was determined by the Ct method. This method calculates relative expression using the following equation: Fold induction = 2−[ΔΔCt] , where Ct = the threshold cycle, i.e. the cycle number at which the sample’s relative fluorescence rises
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
195
Table 1 PCR primer sequences. Gene
Sense primer (5 –3 )
Antisense primer (5 –3 )
Accession no.
ANP BNP eNOS IRAP GATA HIF-1 ␣-MHC -MHC HSP NAB1 OT OTR VEGF Actin GAPDH
CCTGTGTACAGTGCGGTGTC CTGAAGGTGCTGTCCCAGAT AACCAGCGTCCTGCAAAC CAAAGACCGAGCCAACCTGATC CACTATGGGCACAGCAGCTCC AGTCGGACAGCCTCA CTGCTGGAGAGGTTATTCCTCG TGCAAGGCTCCAGGTCTGAGGGC GGTGGTGCTGTCCGACATG TGCTGACAAGAAGAGATGAG CCTACAGCGGATCTCAGACTGA CGACTCAGGACGAAGGTGGAGGA CACCCACGACAGAAGG ACCAACTGGGACGATATGGAGAAGA TTCACCACCATGGAGAAGGC
CCTAGAAGCACTGCCGTCTC GTTCTTTTGTGAGGCCTTGG AACCAGCGTCCTGCAAAC GCTAAAGAGGAACAACCAGCC TTGGAGCTGGCCTGCGATGTC TGCTGCCTTGTATGGGA GGAAGAGTGAGCGGCGCCATCAAGG GCCAACACCAACCTGTCCAAGTTC TACGCCTCAGCGATCTCCTTC TCCTGGTTTCCACAGACTAC TCAGAGCCAGTAAGCCAAGCA AAGATGACCTTCATCATTGTTC TCACAGTGAACGCTCCC TACGACCAGAGGCATACAGGGACAA GGCATGGACTGTGGTCATGA
NM NM NM NM NM NM NM NM NM NM NM NM NM NM NM
008725 008726 008713 172827 008092 010431 001164171 080728 010478 008667 011025 001081147 001025250 007393 008084
ANP, atrial natriuretic peptide; BNP, brain natriuretic peptide; eNOS, endothelial nitric oxide synthase; IRAP, insulin regulated aminopeptidase; G4, GATA binding protein4; HIF-1, hypoxia-indiced factor; ␣-MHC, alpha myosin heavy chain; -MHC, beta myosin heavy chain; HSP70, heat shock protein; NAB1, NGF1A-binding protein; OT, oxytocin; OTR, oxytocin receptor; VEGF, vascular endothelial growth factor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
above background fluorescence, and Ct = [Ct gene of interest (unknown sample) − Ct GAPDH (unknown sample)] − [Ct gene of interest (calibrator sample) − Ct GAPDH (calibrator sample)]. One of the control samples was chosen as the calibrator sample and tested in each PCR. Each sample was run in duplicate, and mean Ct was taken in the Ct equation. GAPDH and actin were chosen for normalization because this gene showed consistent expression relative to
other housekeeping genes among the treatment groups in our experiments. 2.5. Western blot analysis Heart samples (∼100 mg) were prepared by homogenization in modified RIPA buffer (1× PBS, 1% Igepal CA-630, 0.5% sodium deoxycholate, 0.1% SDS, 10 mg/mL PMSF,
Fig. 1. Physical characteristics of control mice, db/db mice, and db/db mice after exercise training on body weight (A), blood glucose (B), heart weight (C), and the heart weight-to-body weight ratio (D). Values are expressed as mean ± SEM for 10–12 mice in each group. CN, control mice; DS, diabetic sedentary mice; DT, diabetic trained mice. *p < 0.05, **p < 0.01, ***p < 0.001.
196
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
Fig. 2. Expression of IRAP mRNA (A) and protein (B) hearts from in control mice, db/db mice, and db/db mice subjected to exercise training. Values are expressed as mean ± SEM obtained from 2 separate experiments each performed with 5 hearts. CN, control mice; DS, diabetic sedentary mice; DT, diabetic trained mice. **p < 0.01.
aprotinin, 100 mM sodium orthovanadate and 4% protease inhibitor). After 2 h in constant agitation at 4 ◦ C, the samples were centrifuged at 10,000 × g for 20 min at 4 ◦ C. The supernatants were collected and the protein concentration was determined by modified Bradford assay. Thirty micrograms of total protein were applied to each well of 10% SDS polyacrylamide gel and electrophoresed for 2 h at 130 V along with a set of molecular weight markers (RPN800, Amersham Biosciences, Baie d’Urfe, PQ). The resolved protein bands were then transferred onto PVDF membranes (Hybond-C; Amersham Pharmacia Biotech Inc., Piscataway, NJ) at 30 V for 120 min at room temperature using a transfer buffer (25 mmol/L Tris base, 192 mmol/L glycine, 20% methanol). The blots were blocked overnight at 4 ◦ C with blocking buffer (5% non-fat milk in 10 mmol/L Tris, pH 7.5, 100 mmol/L NaCl, 0.1% Tween 20). The membranes were then probed with specific primary antibodies overnight at 4 ◦ C. The primary antibodies obtained from Santa Cruz Biotechnology (Santa Cruz, CA) are following: GATA4 (1:500, sc-25310), Nab1 (1:1000, sc-12147), HSP70 (1:10,000, sc-32239), OTR (1:2000, sc-8102), eNOS (1:1000, sc-654), and VEGF (1:2000, sc-152); IRAP (1:10,000, kindly provided by Dr. Pilch, Boston University School of Medicine, MA); HIF1␣ (1:2000, NB100-105, Novus Biologicals, Oakville, ON, Canada). As an internal control, blots were reprobed with either anti--actin antibody (1:2000; sc-1616, Santa Cruz Biotechnology, Santa Cruz, CA) or anti--GAPDH antibody
Fig. 3. Cardiac GATA4 mRNA expression (A) and protein expression (B) in control and db/db hearts. Values are expressed as mean ± SEM obtained from 2 separate experiments each performed with 5 hearts. CN, control mice; DS, diabetic sedentary mice; DT, diabetic trained mice. *p < 0.05, ***p < 0.001.
(1:20,000, G9545-200UL, Sigma Aldrich, Oakville, ON, Canada). Blots were then washed using TBS washing buffer (10 mmol/L Tris, pH 7.5, 100 mmol/L NaCl, 0.1% Tween 20) and incubated with horseradish peroxidase-conjugated immunoglobulin G (GE Healthcare UK Limited) during 1 h at room temperature. The blots finally were detected by chemiluminescence detection system (RPN2132, Amersham Biosciences, Baie d’Urfe, PQ) and visualized by exposure to Kodak X-Omat film. Densitometric measurement of the bands was performed using Photoshop 7 software. 2.6. Statistical analysis Statistical analysis was performed using the statistical software package Prism 3.0. ANOVA nonparametric test and Bonferroni post hoc test were applied to analyze differences in three tested groups. All values are expressed as mean ± SEM with significance defined as p ≤ 0.05.
3. Results 3.1. Physical characteristics of db/db mice The physical characteristics of db/db mice obtained at the end of exercise training are illustrated in Fig. 1. Body weight was significantly higher in DS mice compared with CN mice and exercise training failed to reduce body weight.
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
197
Fig. 4. Cardiac oxytocin mRNA expression (A), oxytocin receptor mRNA expression (B) and oxytocin receptor protein expression (C) in control and db/db hearts. Values are expressed as mean ± SEM obtained from 2 separate experiments each performed with 5 hearts. CN, control mice; DS, diabetic sedentary mice; DT, diabetic trained mice. *p < 0.05, **p < 0.01, ***p < 0.001.
Similarly, plasma glucose was significantly elevated in DS mice compared with CN mice and DT mice remained hyperglycemic after exercise training. There were no differences in heart weight between CN mice and DS mice. However, heart weight was significantly lower in DT mice compared with CN mice. The heart-to-body weight ratios were lower in both DS and DT mice compared with CN mice. Also consistent with the db/db mouse, as shown in Fig. 2, is the significantly decreased mRNA and protein expression of IRAP in DS hearts compared with CN hearts. IRAP codistributes with GLUT4 and a depression in expression of IRAP reflects decreased glucose uptake [12]. In DT hearts, expression of IRAP also remained low compared with CN hearts. 3.2. Cardiac GATA4 and downstream genes As illustrated in Fig. 3, gene expression of GATA4 was significantly lower in hearts from DS mice compared with CN hearts. A significant reduction of GATA4 protein in DS hearts was also observed. Exercise proved to be beneficial in attenuating the reduction in GATA4 mRNA and protein expression from occurring in DT hearts. Expression of the cardiac oxytocin system is a function of GATA4 [20]. As shown in Fig. 4, expression of OT and
OTR was reduced in DS hearts compared with CN hearts. Despite the increase in GATA4 expression seen in DT hearts, this was not associated with the accompanying changes in the expression of OT and OTR. Expression of ANP and BNP is illustrated in Fig. 5. Further associated with reduced expression of GATA4 in db/db hearts is the down-regulation of ANP and BNP. Although not significant, mRNA expression of ANP was 45% lower in DS hearts compared with CN hearts, whereas expression of BNP mRNA was significantly reduced in DS hearts. No improvement in the expression of ANP and BNP mRNA levels was observed in DT hearts. Fig. 6 shows that mRNA expression of ␣-MHC expression was altered by exercise training and the diabetic state. Indeed, expression of ␣-MHC expression was increased in CT hearts compared with CN hearts. In DS hearts, expression of ␣MHC was reduced by ∼50% compared to CN hearts. After exercise training, however, mRNA expression of ␣-MHC was significantly increased in DT hearts compared with CN and DS hearts. -MHC expression was not affected by exercise training in control and diabetic hearts, but expression was significantly lower in DT hearts compared with CT hearts. As a result of the minor changes in the expression -MHC, the ratio of ␣- to -MHC mirrored the changes seen in ␣-MHC
198
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
Expression of the cardiac hypertrophy marker Nab-1 is shown in Fig. 9. Gene expression of Nab-1 mRNA was not altered by either the diabetic state or with exercise training. However, Nab-1 protein levels were significantly lower in DS and DT hearts compared with CN hearts. Expression of HSP-70 is shown in Fig. 10. There were no changes in the mRNA HSP-70 expression between CN and DS hearts. However, mRNA expression was significantly increased by exercise training in CT hearts only. Protein expression, on the other hand, was significantly decreased in DS hearts compared with CN, and exercise training had no effect on protein expression of HSP-70.
4. Discussion
Fig. 5. Cardiac ANP mRNA expression (A) and BNP mRNA expression (B) in control and db/db hearts. Values are expressed as mean ± SEM obtained from 2 separate experiments each performed with 5 hearts. CN, control mice; DS, diabetic sedentary mice; DT, diabetic trained mice. *p < 0.05, ***p < 0.001.
expression. The ratio was increased with exercise training, and decreased in hearts of sedentary diabetic mice. We have previously shown that synthesis of nitric oxide is a component of the oxytocin–natriuretic peptide system in the heart [7]. As illustrated in Fig. 7, both mRNA and protein expression of eNOS were reduced in DS hearts, a finding that is consistent with reductions in OT and NP expression in db/db hearts [7]. Exercise training failed to increase the mRNA expression of eNOS, but was benefit and induced a significant increase in the protein expression compared with DS hearts. Fig. 8 illustrates the expression of angiogenic markers HIF-1 and VEGF, the latter dependent on GATA4 function. There were no significant differences in mRNA or protein expression in these markers between CN and DS groups. However, exercise training resulted in significant increases in protein expression of both VEGF and HIF-1 compared with CN and DS hearts, with the greatest increases seen in HIF-1 in DT hearts. A significant increase in mRNA expression in VEGF and HIF-1 was observed in CT hearts, although mRNA expression was increased by ∼30% and ∼60%, respectively, in DT hearts.
One strategy that favorably impacts cardiovascular outcomes in patients with type 2 diabetes is regular physical activity. Beneficial effects on cardiovascular risk factors have been reported in exercising overweight diabetic patients independently of weight loss [21]. Improvement of cardiovascular risk factors, such as lipids, oxidative stress, and endothelial dysfunction reported in representative experimental models, such as in the obese diabetic db/db mouse, also occur in the absence of any beneficial effects on obesity and hyperglycemia [22–24]. In this study, we examined the effects of diabetes and the combined effects of diabetes and exercise on cardiac expression of GATA4 and related genes. We chose the db/db mouse as model of study because over 90% of human cases of diabetes cases fall into the type 2 category and this model is a close counterpart to the human condition. However, a hallmark feature of this model is hyperleptinemia, as a result of leptin resistance, which is rarely a cause of diabetes but nonetheless reported in obesity and diabetes [25]. We showed that db/db mice remained hyperglycemic and obese after exercise training, findings that confirm results from earlier studies using treadmill running as an exercise paradigm [18,23,24]. Despite the lack of benefit on these markers after exercise, improvements in the expression of certain genes were observed. Our results show that mRNA and protein expression of GATA4 in the db/db heart are reduced. This is consistent with earlier work that report decreased expression of cardiac GATA4 in the presence of acute hyperglycemia, and similarly in the streptozotocin model of type 1 diabetes and the db/db mouse [26]. Decreased cardiac expression of GATA4, to our knowledge, has not been reported in adult human diabetic myocardium, although low levels of GATA4 have been linked to atrial septal defect in neonatal diabetes [27]. The consequences of this reduction in GATA4 on the synthesis of ascribed downstream genes were also examined. Decreased expression of OT and its receptor, ANP, BNP, eNOS, and ␣-MHC was observed in db/db hearts. These findings are in line with our recent work [7] and also reported by others [28]. In ob/ob mouse myocardium, decreased expression of OT, natriuretic peptides and eNOS has been reported, findings
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
199
Fig. 6. Cardiac ␣-MHC mRNA expression (A), -MHC mRNA expression (B) and the /␣ mRNA MHC ratio (C) in control and db/db hearts. Values are expressed as mean ± SEM obtained from 2 separate experiments each performed with 5 hearts. CN, control mice; CT, control trained mice; DS, diabetic sedentary mice; DT, diabetic trained mice. *p < 0.05, **p < 0.01.
also observed in the fat-fed C57BL/6 mouse, suggesting that the expression of these genes is not solely related to defective leptin signaling, but also by lifestyle modification [28]. A reduction in GATA4 may explain these changes by view of support of GATA4-deleted and overexpression leads to corresponding changes in gene expression [10,11,29,30]. However, the exact mechanism causing the reduction in the expression of OT, natriuretic peptides, and eNOS in myocardium is still not well understood. Earlier reports link a deficiency in these peptides to increased apoptosis, fibrosis, and hypertrophy of cardiomyocytes [7,28]. A cardioprotective role of OT is proposed in view of its ability to stimulate glucose uptake cardiomyocytes and exerting a robust antiischemic effect [31,32]. Impaired diuresis, natriuresis, and vasoconstriction are reported with a deficiency in OT, ANP and BNP [33,34]. Reduced plasma BNP levels have been observed in obese patients, and this could account for the greater propensity toward sodium retention, volume expansion, and heart failure observed in these patients [35–37]. Although expression of VEGF is a function of GATA4 [9], the reduction in GATA4 in db/db hearts was not accompanied with a corresponding change in the expression of this angiogenic marker. The hyperglycemic state typically induces remodeling in both skeletal muscle and myocardium and observed changes include a lower capillary-to-fiber ratio which reduces capillary diffusion [38,39]. There appears to be some inconsistencies in the literature regarding the effects of
experimental diabetes on VEGF expression in myocardium, with reports showing either higher or lower expression. However, in the present study, we found that there were no differences in the expression of this marker between db/db and control hearts. The reasons for these inconsistencies are unknown, and may relate to the duration and severity of diabetes or to a down-regulation of the VEGF-A receptor expressed in the myocardium and differences in the expression of antiangiogenic factors [40,41]. In the myocardium of diabetic patients, inconsistencies regarding the VEGF expression also exist, but reduced neoangiogenesis is nonetheless observed in patients with ischemic cardiomyopathy despite increased VEGF expression [42,43]. The results of these studies clearly demonstrate the impact of the various forms of the diabetic state on angiogenic signaling in the heart. Our results show that exercise training was of benefit on GATA4 expression in db/db mice, resulting in a significant increase in mRNA and protein expression. This improvement occurred despite the fact that mice remained in the hyperglycemic state. This increase in GATA4 expression was not associated with corresponding changes in the expression of GATA4-regulated downstream genes, although of the genes studied, eNOS, ␣-MHC, and VEGF expression were increased as a function of GATA4. Attention has been given to the role of exercise training on eNOS expression in the db/db model with the reported changes typically beneficial, suggesting improved endothelial function [7,22,23]. In the db/db
200
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
Fig. 7. Cardiac eNOS mRNA expression (A) and eNOS protein expression (B) in control and db/db hearts. Values are expressed as mean ± SEM obtained from 2 separate experiments each performed with 5 hearts. CN, control mice; DS, diabetic sedentary mice; DT, diabetic trained mice. *p < 0.05, ***p < 0.001.
mouse, short term exercise improves aortic function without reducing plasma levels of inflammatory markers [44], and long term exercise was reported to restore coronary artery endothelial function by increased nitric oxide bioavailability independent of the hyperglycemic state [23]. We show that cardiac eNOS expression was increased in db/db mice following exercise, even in the presence of persistent hyperglycemic and obese states, indicating a beneficial effect on vascular function. Along with increased expression of GATA4 in myocardium of trained db/db mice is the observed improvement of VEGF protein expression. This, in conjunction with the eNOS findings, may further indicate improved vascular function in the db/db heart. The effect of exercise training on the expression of this marker has been reported in skeletal muscle and in the streptozotocin-induced diabetic mouse with slight improvements observed [41]. However, we are the first to show that protein expression of VEGF is increased in myocardium following exercise in the db/db mouse. VEGF expression occurs in response to various factors, including the shear stress of blood flow during exercise as well as from expression of eNOS and HIF-1 [45]. We demonstrated increased expression of eNOS in db/db hearts which may explain the increase in VEGF in db/db hearts after exercise. Similarly, the increased expression of HIF-1, as a result of training-induced hypoxemia, would also explain the improvement in VEGF expression [45].
Fig. 8. Cardiac VEGF mRNA (A) and protein (B) expression, and HIF-1 mRNA (C) and protein (D) expression in control and db/db hearts. Values are expressed as mean ± SEM obtained from 5 to 6 hearts in each group. CN, control mice; CT, control trained mice; DS, diabetic sedentary mice; DT, diabetic trained mice. *p < 0.05, **p < 0.01.
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
Fig. 9. Cardiac NAB-1 mRNA expression (A) and NAB-1 protein expression (B) in control and db/db hearts. Values are expressed as mean ± SEM obtained from 2 separate experiments each performed with 5 hearts. CN, control mice; DS, diabetic sedentary mice; DT, diabetic trained mice. ***p < 0.001.
The mechanism explaining the increase in GATA4 expression in db/db hearts following exercise is unknown. Hyperglycemia has been previously proposed as a mechanism to deplete GATA4 levels in the diabetic heart [26,46]. Our finding is rather intriguing as exercise training was not effective in reducing the extent of hyperglycemia in db/db mice, and still GATA4 levels were increased. Degradation of GATA4 by hyperglycemia is mediated by an increase in reactive oxygen species and by ubiquitination through the ubiquitin–proteosome system, with increased expression of E3-ubiquitin ligase CHIP as mechanism [26,47,48]. One explanation that could account for the preservation of GATA4 content db/db hearts after exercise training is that exercise overcomes the degradation effects of hyperglycemia and ubiquitination. Evidence for this effect is suggested in a recent study demonstrating a reduction in the expression of the E3-ubiquitin ligase Murf1 in hearts of trained rats [49]. It is proposed that the reduction in the expression of this ligase is linked to the inflammatory marker TNF-␣, known to be elevated in db/db hearts [50], which can be mitigated by regular exercise [51]. Several factors regulate the expression of ␣- and -MHC isoforms in the heart, including the developmental milieu, pathological states, and exercise training [16,52–55]. In the diabetic heart, a shift from the normally predominant ␣-MHC toward -MHC is typically observed [4,56]. Up-regulation of
201
Fig. 10. Cardiac HSP70 mRNA expression (A) and HSP70 protein expression (B) in control and db/db hearts. Values are expressed as mean ± SEM obtained from 2 separate experiments each performed with 5 hearts. CN, control mice; CT, control trained mice; DS, diabetic sedentary mice; DT, diabetic trained mice. **p < 0.01, ***p < 0.001.
-MHC expression in the heart is also observed in response to the hemodynamic load of exercise training [17,57]. We show that expression of -MHC was not affected by the diabetic state. Similarly, expression of -MHC was not affected by exercise training, where a slight decrease in the expression of -MHC was observed. Failure of endurance training to increase the expression of -MHC was observed is not consistent with previous work, and this finding may represent a maladaptation to exercise in the db/db model. In young hypothyroid rats, it is interesting to note that exercise training was not associated with cardiac hypertrophy and had no effect in attenuating the increase in the expression of -MHC [58,59]. In the streptozotocin diabetic rat heart, expression of -MHC is increased and exercise training failed to downregulate the expression of this protein [56], findings which are in contrast to our data. The reasons for this discrepancy are not clear, but may relate to differences in the diabetic model used, the severity of the diabetic state, and volume of exercise training. 5. Conclusions We demonstrate that hearts from db/db mice exhibit decreased levels of GATA4 and down-regulation of most of
202
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
its ascribed gene transcripts. Although exercise had a stimulatory effect on cardiac GATA4 mRNA and protein expression, this was not associated with corresponding increases in the expression of most regulated genes studied, possibly indicating either impaired synthesis as a result of exercise training or from impaired activation of other GATA transcription factors in the db/db myocardium. Regardless, exercise training increased eNOS, ␣-MHC, and VEGF expression, suggesting a beneficial response on vascular and cardiac function.
Acknowledgements This work was supported by the Canadian Institute of Health Research (CIHR, MOP-53217, NET Program) and the Canadian Heart and Stroke Foundation (CHSF, NET Program) as grants to JG and MJ, and by the Office of Research and Sponsored Programs of Midwestern University and the Diabetes Action and Research Education Foundation to TLB.
References [1] W.B. Kannel, D.L. McGee, Diabetes and cardiovascular risk factors: the Framingham study, Circulation 59 (1979) 8–13. [2] Z.Y. Fang, J.B. Prins, T.H. Marwick, Diabetic cardiomyopathy: evidence, mechanisms, and therapeutic implications, Endocrine Reviews 25 (2004) 543–567. [3] R.D. Abbott, R.P. Donahue, W.B. Kannel, P.W. Wilson, The impact of diabetes on survival following myocardial infarction in men vs women. The Framingham Study, Journal of the American Medical Association 260 (1988) 3456–3460. [4] C. Depre, M.E. Young, J. Ying, H.S. Ahuja, Q. Han, N. Garza, P.J. Davies, H. Taegtmeyer, Streptozotocin-induced changes in cardiac gene expression in the absence of severe contractile dysfunction, Journal of Molecular and Cellular Cardiology 32 (2000) 985–996. [5] S.W. Schaffer, M.S. Mozaffari, M. Artman, G.L. Wilson, Basis for myocardial mechanical defects associated with non-insulin-dependent diabetes, American Journal of Physiology 256 (1989) E25–E30. [6] W.C. Stanley, G.D. Lopaschuk, J.G. McCormack, Regulation of energy substrate metabolism in the diabetic heart, Cardiovascular Research 34 (1997) 25–33. [7] J. Gutkowska, T.L. Broderick, D. Bogdan, D. Wang, J.-M. Lavoie, M. Jankowski, Downregulation of oxytocin and natriuretic peptides in diabetes: possible implications in cardiomyopathy, Journal of Physiology 587 (19) (2009) 4725–4736. [8] J.D. Molkentin, The zinc finger-containing transcription factors GATA4, -5, and -6. Ubiquitously expressed regulators of tissue-specific gene expression, Journal of Biological Chemistry 275 (50) (2000) 38949–38952. [9] J. Heineke, M. Auger-Messier, J. Xu, T. Oka, M.A. Sargent, A. York, R. Klevitsky, S. Vaikunth, S.A. Duncan, B.J. Aronow, J. Robbins, T.M. Crombleholme, J.D. Molkentin, Cardiomyocyte GATA4 functions as a stress-responsive regulator of angiogenesis in the murine heart, Journal of Clinical Investigation 117 (2007) 3198–3210. [10] E. Bisping, S. Ikeda, S.W. Kong, O. Tarnavski, N. Bodyak, J.R. McMullen, S. Rajagopal, J.K. Son, Q. Ma, Z. Springer, P.M. Kang, S. Izumo, W.T. Pu, Gata4 is required for maintenance of postnatal cardiac function and protection from pressure overload-induced heart failure, Proceedings of the National Academy of Sciences of the United States of America 103 (2006) 14471–14476.
[11] Q. Liang, J.J. De Windt, S.A. Witt, T.R. Kimball, B.E. Markham, J.D. Molkentin, The transcription factors GATA4 and GATA6 regulate cardiomyocyte hypertrophy in vitro and in vivo, Journal of Biological Chemistry 276 (2001) 30245–30253. [12] T.L. Broderick, M. Jankowski, D. Wang, D. Bogdan, C.R. Parrott, J. Gutkowska, Down-regulation in GATA4 and downstream structural and contractile proteins in the db/db mouse heart, ISRN Endocrinology 2012 (2012) 736860. [13] N.G. Boule, E. Haddad, G.P. Kenny, G.A. Wells, R.J. Sigal, Effects of exercise on glycemic control and body mass in type 2 diabetes mellitus: a meta-analysis of controlled clinical trials, Journal of the American Medical Association 286 (2001) 1218–1227. [14] R.S. Paffenbarger Jr., R.T. Hyde, A.L. Wing, I.M. Lee, D.L. Jung, J.D. Kampert, The association of changes in physical-activity level and other lifestyle characteristics with mortality among men, New England Journal of Medicine 328 (1993) 538–545. [15] C. Saraceni, T.L. Broderick, Cardiac and metabolic consequences of exercise training in experimental diabetes, Current Diabetes Reviews 3 (2007) 75–84. [16] D.P. Fitzsimons, P.W. Bodell, R.E. Herrick, K.M. Baldwin, Left ventricular functional capacity in the endurance-trained rodent, Journal of Applied Physiology 69 (1990) 305–312. [17] K. Rafalski, A. Abdourahman, J.G. Edwards, Early adaptations to training: upregulation of alpha-myosin heavy chain gene expression, Medicine and Science in Sports and Exercise 39 (2007) 75–82. [18] J. Sennott, J. Morrissey, P.R. Standley, T.L. Broderick, Treadmill exercise training fails to restore defects in glucose, insulin and muscle glut4 content in the db/db mouse model of diabetes, Pathophysiology 15 (2008) 173–179. [19] D.E. James, K.M. Burleigh, E.W. Kraegen, D.J. Chisholm, Effect of acute exercise and prolonged training on insulin response to intravenous glucose in vivo in rat, Journal of Applied Physiology 55 (1983) 1660–1664. [20] J. Uchida, S. Fuke, T. Tsukahara, Upregulations of Gata4 and oxytocin are important in cardiomyocyte differentiation processes of P19CL6 cells, Journal of Cellular Biochemistry 100 (3) (2007) 629–641. [21] E.W. Gregg, R.B. Gerzoff, T.J. Thompson, D.F. Williamson, Trying to lose weight, losing weight, and 9-year mortality in overweight U.S. adults with diabetes, Diabetes Care 27 (2004) 657–662. [22] K.A. Esser, W. Su, S. Matveev, V. Wong, L. Zeng, J.J. McCarthy, E.J. Smart, Z. Guo, M.C. Gong, Voluntary wheel running ameliorates vascular smooth muscle hyper-contractility in type 2 diabetic db/db mice, Applied Physiology, Nutrition, and Metabolism 32 (2007) 711–720. [23] F. Moien-Afshari, S. Ghosh, S. Elmi, M. Khazaei, M.M. Rahman, N. Sallam, I. Laher, Exercise restores coronary vascular function independent of myogenic tone or hyperglycemic status in db/db mice, American Journal of Physiology: Heart and Circulatory Physiology 295 (2008) H1470–H1480. [24] F. Moien-Afshari, S. Ghosh, S. Elmi, M.M. Rahman, N. Sallam, M. Khazaei, T.J. Kieffer, R.W. Brownsey, I. Laher, Exercise restores endothelial function independently of weight loss or hyperglycaemic status in db/db mice, Diabetologia 15 (7) (2008) 1327–1337. [25] G.A. Bray, D.A. York, Clinical review 90: leptin and clinical medicine: a new piece in the puzzle of obesity, Journal of Clinical Endocrinology and Metabolism 82 (1997) 2771–2776. [26] S. Kobayashi, K. Mao, H. Zheng, X. Wang, C. Patterson, T.D. O’connell, Q. Liang, Diminished GATA4 protein levels contribute to hyperglycemia-induced cardiomyocyte injury, Journal of Biological Chemistry 282 (30) (2007) 21945–21952. [27] E. D’Amato, F. Giacopelli, G. Giannattasio, R. Bocciardi, M. Musso, R. Lorini, R. Ravazzolo, Genetic investigation in an Italian child with an unusual association of atrial septal defect, attributable to a new familial GATA4 gene mutation, and neonatal diabetes due to pancreatic agenesis, Diabetic Medicine 27 (2010) 1195–2000. [28] E.D. Bartels, J.M. Nielsen, L.S. Bisgaard, J.P. Goetze, L.B. Nielsen, Decreased expression of natriuretic peptides associated with lipid
T.L. Broderick et al. / Pathophysiology 19 (2012) 193–203
[29]
[30]
[31]
[32]
[33]
[34]
[35]
[36]
[37]
[38]
[39]
[40]
[41]
[42]
[43]
accumulation in cardiac ventricle of obese mice, Endocrinology 151 (2010) 5218–5225. T. Oka, M. Maillet, A.J. Watt, R.J. Schwartz, B.J. Aronow, S.A. Duncan, J.D. Molkentin, Cardiac-specific deletion of Gata4 reveals its requirement for hypertrophy, compensation, and myocyte viability, Circulation Research 98 (2006) 837–845. F. Charron, G. Tsimiklis, M. Arcand, L. Robitaille, Q. Liang, J.D. Molkentin, S. Meloche, M. Nemer, Tissue-specific GATA factors are transcriptional effectors of the small GTPase RhoA, Genes and Development 15 (2001) 2702–2719. M. Florian, M. Jankowski, J. Gutkowska, Oxytocin increases glucose uptake in neonatal cardiomyocytes, Endocrinology 151 (2010) 482–491. M. Ondrejcakova, T. Ravingerova, J. Bakos, D. Pancza, D. Jezova, Oxytocin exerts protective effects on in vitro myocardial injury induced by ischemia and reperfusion, Canadian Journal of Physiology and Pharmacology 87 (2) (2009) 137–142. R.L. Woods, Cardioprotective functions of atrial natriuretic peptide and B-type natriuretic peptide: a brief review, Clinical and Experimental Pharmacology and Physiology 31 (2004) 791–794. T. Tokudome, T. Horio, T. Soeki, K. Mori, I. Kishimoto, S. Suga, F. Yoshihara, Y. Kawano, M. Kohno, K. Kangawa, Inhibitory effect of C-type natriuretic peptide (CNP) on cultured cardiac myocyte hypertrophy: interference between CNP and endothelin-1 signaling pathways, Endocrinology 145 (2004) 2131–2140. H. Kalsch, T. Neumann, R. Erbel, Less increase of BNP and NT-proBNP levels in obese patient with decompensated heart failure Interpretation of natriuretic peptides in obesity, International Journal of Cardiology 133 (1) (2009) e22–e24. M.R. Mehra, P.A. Uber, M.N. Park, S.L. Scott, H.O. Ventura, B.C. Harris, E.D. Frohlich, Obesity and suppressed B-type natriuretic peptide levels in heart failure, Journal of the American College of Cardiology 43 (2004) 1590–1595. J.A. Taylor, R.H. Christenson, K. Rao, M. Jorge, S.S. Gottlieb, Btype natriuretic peptide and N-terminal pro B-type natriuretic peptide are depressed in obesity despite higher left ventricular end diastolic pressures, American Heart Journal 152 (2006) 1071–1076. W.L. Sexton, D.C. Poole, O. Mathieu-Costello, Microcirculatory structure–function relationships in skeletal muscle of diabetic rats, American Journal of Physiology: Heart and Circulatory Physiology 266 (1994) H1502–H15011. C.A. Kindig, W.L. Sexton, M.R. Fedde, D.C. Poole, Skeletal muscle microcirculatory structure and hemodynamics in diabetes, Respiration Physiology 111 (1998) 163–175. R. Rivela, M. Silvennoinen, A.-M. Touvra, T.M. Lehti, H. Kainulainen, V. Vihko, Effects of experimental type 1 diabetes and exercise training on angiogenic gene expression and capillarization in skeletal muscle, FASEB Journal 20 (2006) E921–E930. R. Rivela, M. Silvennoinen, M. Lehti, S. Jalava, V. Vihko, H. Kainulainen, Exercise-induced expression of angiogenic growth factors in skeletal muscle and in capillaries of healthy and diabetic mice, Cardiovascular Diabetology 7 (2008) 13, http://dx.doi.org/10.1186/14752840-7-13. F.C. Sasso, D. Torella, O. Carbonara, G.M. Ellison, M. Torella, M. Scardone, C. Marra, R. Nasti, R. Marfella, D. Cozzolino, C. Indolfi, M. Cotrufo, R. Torella, T. Salvatore, Increased vascular endothelial growth factor expression but impaired vascular endothelial growth factor receptor signaling in the myocardium if type 2 diabetic patients with chronic coronary heart disease, Journal of the American College of Cardiology 46 (2005) 827–834. E. Chou, I. Suzuma, K.J. Way, D. Opland, A.C. Clermont, K. Naruse, K. Suzuma, N.L. Bowling, C.J. Vlahos, L.P. Aiello, G.L. King, Decreased
[44]
[45] [46]
[47]
[48]
[49]
[50]
[51]
[52]
[53]
[54]
[55]
[56]
[57]
[58]
[59]
203
cardiac expression of vascular endothelia growth factor in insulinresistant and diabetic states. A possible explanation for impaired collateral formation in cardiac tissue, Circulation 105 (2002) 373–379. N. Sallam, M. Khazaei, I. Laher, Effect of moderate-intensity exercise on plasma C-reactive protein and aortic endothelial function in type 2 diabetic mice, Mediators of Inflammation 2010 (2010) 149678 (Epub 2010 August 2). S. Egginton, Physiological factors influencing capillary growth, Acta Physiologica (Oxford, England) 202 (2011) 225–239. Z. Liu, W.R. Miers, L. Wei, E.J. Barrett, The ubiquitin–proteasome proteolytic pathway in heart vs skeletal muscle: effects of acute diabetes, Biochemical and Biophysical Research Communications 276 (2000) 1255–1260. S.W. Lee, G. Dai, Z. Hu, X. Wang, J. Du, W.E. Mitch, Regulation of muscle protein degradation: coordinated control of apoptotic and ubiquitin–proteasome systems by phosphatidylinositol 3 kinase, Journal of the American Society of Nephrology 15 (2004) 1537–1545. P. Razeghi, K.K. Baskin, S. Sharma, M.E. Young, S. Stepkowski, M.F. Essop, H. Taegtmeyer, Atrophy, hypertrophy, and hypoxemia induce transcriptional regulators of the ubiquitin proteasome system in the rat heart, Biochemical and Biophysical Research Communications 342 (2006) 361–364. V. Adams, A. Linke, S. Gielen, S. Erbs, R. Hambrecht, G. Schuler, Modulation of Murf-1 and MAFbx expression in the myocardium by physical exercise training, European Journal of Cardiovascular Prevention and Rehabilitation 15 (2008) 293–299. Y. Park, J. Yang, H. Zhang, X. Chen, C. Zhang, Effect of PAR2 in regulating TNF-␣ and NAD(P)H oxidase in coronary arterioles in type 2 diabetic mice, Basic Research in Cardiology 106 (1) (2010) 111–123 (Epub 2010 October 24). R.L. Bradley, J.Y. Jeon, F.F. Liu, E. Maratos-Flier, Voluntary exercise improves insulin sensitivity and adipose tissue inflammation in dietinduced obese mice, American Journal of Physiology: Endocrinology and Metabolism 295 (3) (2008) E586–E594. D.L. Allen, L.A. Leinwand, Postnatal myosin heavy chain isoform expression in normal mice and mice null for IIb or IId myosin heavy chains, Developmental Biology 229 (2001) 383–395. W.H. Dillmann, Hormonal influences on cardiac myosin ATPase activity and myosin isoenzyme distribution, Molecular and Cellular Endocrinology 34 (1984) 169–181. M. Krenz, J. Robbins, Impact of beta-myosin heavy chain expression on cardiac function during stress, Journal of the American College of Cardiology 44 (2004) 2390–2397. J.J. Mercadier, A.M. Lompre, C. Wisnewsky, J.L. Samuel, J. Bercovici, B. Swynghedauw, K. Schwartz, Myosin isoenzyme changes in several models of rat cardiac hypertrophy, Circulation Research 49 (1981) 525–532. D.J. Paulson, M. Gupta, R. Zak, J. Zhao, Effects of exercise training and diabetes on cardiac myosin heavy chain composition, Molecular and Cellular Biochemistry 117 (1992) 175–179. R.C. Hickson, G.T. Hammons, J.O. Holoszy, Development and regression of exercise-induced cardiac hypertrophy in rats, American Journal of Physiology 236 (1979) H268–H272. H.L. Katzeff, K.M. Ojamaa, I. Klein, Effects of exercise on protein synthesis and myosin heavy chain gene expression in hypothyroid rats, American Journal of Physiology 267 (1994) E63–E67. J. Giger, A.X. Qin, P.W. Bodell, K.M. Baldwin, F. Haddad, Activity of the beta-myosin heavy chain antisense promoter responds to diabetes and hypothyroidism, American Journal of Physiology: Heart and Circulatory Physiology 292 (2007) H3065–H3071.