- Email: [email protected]
AKT pathway
Ecotoxicology and Environmental Safety 183 (2019) 109465
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv
Expression of Clusterin suppresses Cr(VI)-induced premature senescence through activation of PI3K/AKT pathway
T
Yujing Zhang, Yiyuan Zhang, Yuanyuan Xiao, Caigao Zhong, Fang Xiao* Department of Health Toxicology, Xiangya School of Public Health, Central South University, Changsha, 410078, PR China
ARTICLE INFO
ABSTRACT
Keywords: Hexavalent chromium [Cr(VI)] Clusterin (CLU) Premature senescence Phosphatidylinositol 3-kinase (PI3K)/Protein kinase B (AKT) L-02 hepatocytes
Our group found that long-term low-dose exposure to hexavalent chromium [Cr(VI)] in L-02 hepatocytes resulted in premature senescence, which accompanied by the increased expression of Clusterin (CLU), but the functional role of CLU in premature senescence has never been explored. In the present study, the CLU overexpressed or silenced L-02 hepatocytes were established by lentiviral vector transfection. Cell viability assay, cell cycle analysis, western blotting, plate clone formation assay, and confocal microcopy were performed. The results indicated that Cr(VI)-induced premature senescence was associated with phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) pathway inhibition, and high expression of CLU in the senescent cells exerted its functional role of promoting cell proliferation. CLU could complex with eukaryotic translation initiation factor 3 subunit I (EIF3I) and prevent its degradation, leading to the increase of AKT activity in Cr(VI)-exposed senescent hepatocytes. Blockage of the PI3K/AKT pathway with its inhibitor LY294002 eliminated the inhibitory effect of CLU on Cr(VI)-induced premature senescence. We concluded that high expression of CLU suppressed Cr(VI)induced premature senescence through activation of PI3K/AKT pathway, which will provide the experimental basis for the study of Cr(VI)-induced liver cancer, especially for the elucidation of the mechanism of liver cancer cells escaping from senescence.
1. Introduction Hexavalent chromium [Cr(VI)] and its compounds are used in different industries worldwide in various applications, such as welding, plating, pigment production, and wood processing (Pan et al., 2017). As a confirmed human carcinogen, Cr(VI) has long been considered to increase lung cancer incidence by inhalation route of exposure (Abreu et al., 2018). In recent years, oral exposure to Cr(VI) attracts more attention since water contamination with Cr(VI) has become a worldwide problem of significant public health importance. It has been reported that oral ingestion of Cr(VI) through drinking water caused elevated primary liver cancer mortality (Linos et al., 2011), which highlighted that great attention should be paid to the research on Cr(VI)-induced hepatotoxicity. Previous studies on Cr(VI) mainly focused on apoptosis, while little was known about cellular senescence. We earlier demonstrated that Cr(VI) caused premature senescence in the hepatocytes (Zhang et al., 2016). The concept of senescence was first introduced by Hayflick et al., in 1965 (Hayflick, 1965). Cellular senescence is an important biological phenomenon that considered to be a safeguard mechanism to protect normal cells and organisms by preventing
uncontrolled proliferation of the cancer cells (Rodier and Campisi, 2011). The senescent cells often possess characteristic features including enlarged and fattened morphology, permanent growth arrest, augmented senescence-associated β-galactosidase (SA-β-gal) activity, and up-regulated senescence-associated genes such as p21 and transforming growth factor β-1 (TGF-β1) (Wang et al., 2017). Premature senescence can be triggered by various cellular stress, oncogenes activation, and cytotoxic agents exposure. Clusterin (CLU) is a stress-inducible secreted glycoprotein that implicated in a variety of biological processes (Vargas et al., 2017), including senescence. As a biomarker of senescence, CLU is up-regulated during senescence (Luo et al., 2014a). CLU is also found to be increased in the age-related diseases such as diabetes type II and Alzheimer's disease (Vishnu et al., 2016). Although the mechanisms regulating CLU during cellular senescence were not very clear, it is believed that ataxia telangiectasia mutant (ATM)- insulin-like growth factor 1 (IGF-1) axis plays a role in the up-stream regulation of CLU (Luo et al., 2014b). In normal cells, CLU not only acts as an “extracellular chaperone” that clears debris from injured cells, tissues or organs (Matukumalli et al., 2017), but also protects cells from apoptosis via interacting with B-cell
* Corresponding author. Department of Health Toxicology, Xiangya School of Public Health, Central South University, NO.238 Shangmayuanling Road, Kaifu District, Changsha, Hunan, 410078, China. E-mail address: [email protected] (F. Xiao).
https://doi.org/10.1016/j.ecoenv.2019.109465 Received 15 April 2019; Received in revised form 18 June 2019; Accepted 22 July 2019 0147-6513/ © 2019 Elsevier Inc. All rights reserved.
Ecotoxicology and Environmental Safety 183 (2019) 109465
Y. Zhang, et al.
lymphoma-2 (Bcl-2)-associated X protein (Bax) (Xu et al., 2015) and tumor necrosis factor (TNF) (Joo, 2011). We revealed that CLU expression was significantly increased in Cr (VI)-induced senescent cells, and it has been confirmed that the overexpressed CLU in primary liver cancer cells is closely related to the occurrence, development and metastasis of malignant tumor (Xiu et al., 2015). Cells undergo premature senescence is unlikely to become carcinogenesis due to irreversible cell cycle arrest and cessation of cell division and proliferation, while the cells escaped from premature senescence after carcinogen exposure have been proved to have the tendency of malignant transformation (Kohsaka et al., 2011). It is not clear why CLU expression was increased in both premature senescence and carcinogenesis, the two completely distinct cytotoxic outcomes. CLU can promote the occurrence and development of malignant tumors, and premature senescence is considered an obstacle in the carcinogenic process, thus we speculated that the high-expression of CLU in senescent cells may play a role in inhibiting premature senescence. The antiapoptotic effect of CLU depends on its interaction with Bax and TNF, cells undergo premature senescence cannot become apoptotic, thus CLU is unlikely to play an anti-apoptotic role in premature senescence cells. Since the premature senescent cells show stagnation of division and proliferation, the mechanism of CLU inhibiting premature senescence may be related to its influence on cell proliferation and differentiation. As a confirmed carcinogen, Cr(VI) also induces compensatory tumor-suppressive responses including apoptosis, necrosis, or cellular senescence, but the signals determining the main outcome were unclear. The present study will uncover the role of CLU in Cr(VI)-induced premature senescence. By suppressing Cr(VI)-induced senescence, CLU wou ld be expected to favor tumor progression. Although CLU is a novel senescent biomarker and its up-regulation is believed to be a secondary consequence of senescence phenotype caused by gradual stress accumulation, CLU function and its implication in both senescence and senescence-related physiological and pathological process need to be fully explored. Our preliminary results raise the possibility that CLU accumulation in senescent cells is probably coupled to the promotion of cell growth and proliferation which is specifically related to the inhibition of senescence and, therefore, most probably represents a useful indicator of Cr(VI)-triggered premature senescence.
(#3521), and β-actin (#4967) were obtained from Cell Signaling Technology (Beverly, MA, USA). Connective tissue growth factor (CTGF) (L20) (sc-14939), senescence marker protein 30 (SMP30) (E−11) (sc-390098), CLU (A-9) (sc-166907) (for western blotting and confocal microcopy analysis) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Fibronectin (FN) (BA1771) was purchased from BOSTER (Wuhan, China). Eukaryotic translation initiation factor 3 subunit I (EIF3I) (11287-1-AP) (for western blotting, co-immunoprecipitation (Co-IP), and confocal microcopy analysis) and CLU (12289-1-AP) (for Co-IP) were purchased from ProteinTech (Wuhan, China). 2.3. Cloning of CLU cDNA, viral infection and establishment of CLU knockdown cells The CLU over-expression and knockdown hepatocytes were established as described previously (Xiao et al., 2019). The commercial cDNA encoding CLU (pDONR223-CLU) (Changsha Yingrun Biotechnology Co., Ltd, Changsha, China) was amplified and cloned into pLVX-IRES-puro vector (Clontech, Mountain View, CA). Lentiviral carrying CLU cDNA was then generated. A sCLU-RNA interference (RNAi) lentiviral vector, pYr-LV-CLU small hairpin RNA (shRNA), was also constructed (Changsha Yingrun Biotechnology Co., Ltd, Changsha, China). Lentiviral carrying CLU shRNA or scrambled (Scr) shRNA was used to infect L-02 hepatocytes. 2.4. MTT assay for cell proliferation The MTT assay was applied to determine cell proliferation ability. The hepatocytes were harvested and seeded into 96-well plates (2000 cells/well). After incubation for 5 days, the cells were cultured with MTT solution for 2 h and then were treated with 200 μl dimethyl sulfoxide (DMSO). Absorbance was read at 490 nm to measure the cell quantity. 2.5. Analysis for apoptotic cells Cells were doubly stained with FITC (0.5 μg/ml) and PI (1 μg/ml). The suspensions were then determined by flow cytometry. Data was analyzed using CellQuest software. The population of early apoptosis cells (Annexin-V-FITC positive) and late apoptosis cells (Annexin-VFITC/PI positive) were quantified.
2. Materials and methods 2.1. Cell culture The immortalized human L-02 hepatocytes were purchased from China Center for Type Culture Collection of Wuhan University. The cells were cultured as previously described (Xiao et al., 2019). Briefly, L-02 hepatocytes were cultured in RPMI-1640 medium with 10% FBS and antibiotics (50 U/ml penicillin and 50 μg/ml streptomycin) in a humidied incubator with 5% CO2 at 37 °C. Cells are treated with the indicated concentrations of different chemicals.
2.6. Analysis for cell cycle The hepatocytes were exposed to the indicated concentrations of different chemicals. After incubation, cells were trypsinized and fixed with ethanol (ice-cold, 70%) for 1 h, then were incubated with RNase A (200 μg/ml) for 90 min at 37 °C, and followed by the incubation with PI (50 μg/ml) for 30 min in the dark. Finally, the samples were collected and analyzed by flow cytometry.
2.2. Reagents
2.7. SA-β-gal staining for senescent cells
Potassium dichromate (K2Cr2O7) was obtained from the chemical reagents company of Changsha (changsha, China). 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), AnnexinV- fluorescein isothiocyanate (FITC), propidium iodide (PI), and 4’,6Diamidino-2-phenylindole dihydrochloride (DAPI) were obtained from Sigma (St. Louis, MO, USA). The antibodies of p53 (#9282), phospho (p)-p53 (ser-15) (#9284), p-p53 (ser-392) (#9281), p-p53 (ser-20) (#9287), p21 (12D1) (#2947), retinoblastoma (Rb) (4H1) (#9309), p16 (D7C1M) (#80772), phosphatidylinositol 3-kinase (PI3K) p85 (19H8) (#4257), phosphatase and tensin homolog deleted on chromosome ten (PTEN) (138G6) (#9559), p-protein kinase B (AKT) (ser473) (D9E) (#4060), AKT (#9272), Cyclin D1 (#2922), mouse double minute 2 homolog (MDM2) (D1V2Z) (#86934), p-MDM2 (Ser-166)
Briefly, the hepatocytes were exposed to different chemicals and then were fixed with paraformaldehyde (4%, 10 min). After the fixation, the cells were incubated with freshly prepared staining solution at 37 °C for 48 h, and then were washed and dried in the dark at room temperature. Inverted microscope with a 200 magnification was applied to take light microscopic pictures. At least 3 random fields were evaluated in each well. 2.8. Western blotting Western blotting analysis for protein levels was performed as described previously (Qi et al., 2018). Briefly, cells were lysed using the 2
Ecotoxicology and Environmental Safety 183 (2019) 109465
Y. Zhang, et al.
variance (ANOVA). Comparison between two treated groups was performed using Student-Newman-Keuls (SNK) test. SPSS 19.0 software was used. P < 0.05 indicates the significant difference.
commercial Cell Lysis Kit (Sigma-Aldrich, St. Louis, MO, USA). Protein samples were separated and transferred to the membrane. Membranes were blocked with 4% nonfat milk and immunostained with the related primary antibodies overnight at 4 °C. After incubation with the proper secondary antibodies, the membranes were developed with luminol reagent and then exposed onto films.
3. Results 3.1. Cr(VI) triggered premature senescence
2.9. Determination of cytokines levels
The hepatocytes were treated with 10 nM Cr(VI) twice a week for 24 h for 4 weeks. Continuous treatment of the hepatocytes with Cr(VI) efficiently blocked cell proliferation (Fig. 1A). Apoptosis has been implicated as the main mechanism for the inhibition of cell proliferation by heavy metals (Wang et al., 2018). FACS analysis with Annexin V and PI staining revealed long term low dosage Cr(VI) exposure, which was sufficient to suppress cell proliferation, didn't induce apoptosis (Fig. 1 B). We also examined the cell cycle profile and found that the growth inhibited cells revealed G1 phase cell cycle arrest (Fig. 1 C). It is confirmed that in addition to apoptosis, stressed cells could adopt the irreversible and permanent cell cycle arrest to undergo premature senescence (Muñoz-Espín and Serrano, 2014). As shown in Fig. 1D, Cr(VI) treatment group showed increased SA-β-Gal activity, indicating the occurrence of cellular senescence. There are three senescence-inducing pathways involving many tumor suppressors, namely, p53/p21 pathway, Rb/p16 pathway, and PTEN pathway (Bernardes de Jesus and Blasco, 2012). We then analyzed the protein expression patterns of these tumor suppressors using Western blot analysis. Since post-translational modifications such as phosphorylation play an important role in p53 protein stabilization, we first evaluate the protein levels of phosphorylated p53 and found only phosphorylation of 53 at ser 15 was increased. P53, p21, and PTEN protein levels were up-regulated, suggesting p53/p21 and PTEN pathways, but not Rb/p16 pathway were participated in Cr(VI)-induced senescence (Fig. 1E). We also detected the protein levels of biomarkers of premature senescence including FN1, CTGF, and SMP30 and found that all tested senescence-associated proteins were increased (Fig. 1F). Senescence is known to be accompanied with the increase secretion of secreted factors such as growth factors, chemokines (IL-8), pro-inflammatory cytokines (IL-1, IL-6), and proteases MMP3, which is termed the SASP (PA et al., 2014). The supernatant of the cells was collected and checked for the levels of IL-1, IL-6 and MMP3. Fig. 1G revealed that Cr(VI) increased the secretion of these factors in the senescent cells.
The supernatant of the hepatocytes were collected to determine senescence-associated secretory phenotype (SASP) associated cytokines including interleukin-1 (IL-1), IL-6, and proteases matrix metalloproteinase-3 (MMP3) using enzyme linked immunosorbent assay (ELISA) kits (Cusabio Co., Ltd, Wuhan, China). 2.10. Caspase-3 activity assay The assay was performed using Caspase-3 activity detection Kit (BiYunTian Biotechnology Research Institute, Shanghai, China) according to the protocol. 2.11. Plate clone formation assay Exponentially growing hepatocytes were collected and seeded in 6well plates. The density was about 1000 cells/well. Cells were incubated for 14 days to form the colonies. Colonies of every plate were stained with Giemsa for 20 min. The plates were photographed. The relative plate clone formation ability = (mean clone number in the treated group/mean clone number in control group) × 100%. 2.12. Co-IP Co-IP was performed using the Co-IP kit from Thermo Scientific Pierce (Waltham, MA, USA). Briefly, the isolated pre-cleared protein was incubated with anti-EIF3I or anti-CLU antibody overnight at 4 °C. After the incubation, the IP targets were disassociated. 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was used to resolve the eluted proteins, followed by western blotting using appropriate antibodies. 2.13. Confocal microcopy The hepatocytes were fixed with paraformaldehyde (4%, 20 min) and permeabilized with Triton X-100 (0.5%, 20 min). The cells were then blocked with 5% FBS for 30 min and incubated with the primary antibody at 4 °C overnight. After the incubation, cells were stained using fluorescein-conjugated secondary antibody for 1 h and 1 μg/mL DAPI for 7 min, then washed with PBS and imaged using a confocal microscope.
3.2. PI3K/AKT inhibition was associated with Cr(VI)-induced premature senescence PI3K/AKT signaling pathway is known to control and coordinate two major cellular processes: cell cycle progression and cell growth/ proliferation (Jiang et al., 2015a). Since cell cycle arrest and cell growth inhibition are the main characteristics of senescence, we speculated that PI3K/AKT pathway played a role in Cr(VI)-induced senescence. As shown in Fig. 2A, the senescent hepatocytes revealed decreased PI3K, p-AKT (ser-473), AKT, and Cyclin D1expressions, suggesting Cr(VI) inhibited PI3K/AKT pathway. IGF-1 has been proven to activate PI3K/AKT signaling pathway by binding with the IGF-1 receptor (IGF-1R), thereby facilitating cell proliferation and differentiation (Ma et al., 2010). We then explored the effect of IGF-1 on the protein expression alterations of Cr(VI)-induced PI3K/AKT pathway and senescence-inducing pathways. The application of IGF-1 alleviated Cr(VI)-induced PI3K/AKT pathway inhibition as well as the activation of senescence-inducing p53/p21 and PTEN pathways (Fig. 2B). Senescence stain in Fig. 2C showed that IGF-1 decreased the numbers of SAβ-Gal-positive cells induced by Cr(VI), cell cycle analysis in Fig. 2D showed that IGF-1 alleviated G1 phase arrest induced by Cr(VI). Since IGF-1 could suppress senescence caused by Cr(VI), we thought PI3K/ AKT inhibition is associated with Cr(VI)-induced senescence.
2.14. Quantitative real-time PCR (qPCR) qPCR was performed as described before (Qi et al., 2018). The analysis was done using SYBR®Premix Taq™ (Takara, Dalian, China) with an Applied Biosystems 7900HT Fast Real-Time PCR System (Applied Biosystems, Inc., Foster City, CA, USA) to determine the genes mRNA levels. ACTB was served as control. Forward (F) and Reverse (R) primer sequences were as follows: CLU: F (5′-3′), GAGCAGCTGAACGAGCAGTTT; R (5′-3′), CTTCGCC TTGCGTGAGGT; EIF3I: F (5′-3′), CGGGATGAAGCCGATCCTAC; R (5′3′), GGGTCCTTGGCCACAGTAAA. 2.15. Statistical analysis All data were expressed as mean ± standard deviation (SD). Differences among groups were calculated using one-way analysis of 3
Ecotoxicology and Environmental Safety 183 (2019) 109465
Y. Zhang, et al.
Fig. 1. Cr(VI) trigered premature senescence. The cells were treated with 10 nM Cr(VI) twice a week for 24 h for 4 weeks. (A) Cell proliferation was measured at different time points (day 0 to day 5) using MTT method. (B) The apoptotic cells were examined using Annexin V/PI staining by flow cytometry. (C) Cell cycle profile of the hepatocytes. (D) Cellular senescence was measured using the commercial β-Gal Staining Kit. (E) Western blotting analysis of the proteins (p53, p21, Rb, p16, PTEN) from the three senescence-inducing pathways. (F) Western blotting analysis of the senescence-associated proteins FN1, CTGF, and SMP30. (G) The levels of IL1, IL-6 and MMP3 were examined using ELISA method. *p < 0.05, compared with the control.
3.3. CLU increased cell proliferation
significant cell growth inhibition in the hepatocytes, this is consistent with the result in Fig. 3D which revealed that caspase-3 activity was decreased in CLU OE cells, and was increased in CLU sh cells, compared with the respective controls. Clone formation assays in Fig. 3E indicated that the ability to form colonies was increased in CLU OE cells and was reduced in CLU sh cells compared with the EV cells and Scr cells, respectively. We also determined cell cycle analysis of the transfected cells. As shown in Fig. 3F, CLU OE cells showed the decrease of G1 phase percentage and the increase of S and G2 phage percentages compared with the EV cells, indicating the OE cells gained the higher proliferation ability. In contrast, the CLU sh cells showed the increase of G1 phase percentage and the decrease of S and G2 phage percentages
We assayed CLU protein expression level in Cr(VI)-induced premature senescent cells. As shown in Fig. 3A, CLU was obviously upregulated in Cr(VI)-induced senescent hepatocytes. To test the functional role of CLU, we over-expressed or knocked down CLU in the hepatocytes. Immunoblotting result revealed significant increase of CLU in the cells after transfection with CLU-cDNA, and dramatic decrease of CLU in the cells transfected with CLU shRNA. Cells transfected with empty vector (EV) and scrambled (Scr) sequence were served as controls (Fig. 3B). As shown in Fig. 3C, CLU over-expression significantly increased cell proliferation while CLU knockdown induced 4
Ecotoxicology and Environmental Safety 183 (2019) 109465
Y. Zhang, et al.
Fig. 2. PI3K/AKT inhibition was associated with Cr(VI)-induced premature senescence. (A) The cells were treated with 10 nM Cr(VI) twice a week for 24 h for 4 consecutive weeks, and then were processed to determine the proteins expression of PI3K, p-AKT (ser-473), AKT, and Cyclin D1. (B) The cells were treated with 10 nM Cr(VI) twice a week for 24 h for 4 weeks with or without the pretreatment of IGF-1 (50 ng/l, 2 h). The expressions of proteins of PI3K/AKT pathway and senescence-inducing pathways (p-MDM2 (ser-166), MDM2, p-53 (ser-15), p53, p21, and PTEN) were examined by western blotting. (C) β-Gal Stain for senescent cells. (D) Cell cycle profile of the hepatocytes. *p < 0.05, compared with the control. #p < 0.05, compared with Cr(VI) treatment group.
compared with the Scr cells, indicating the sh cells gained the lower proliferation ability.
p-AKT (ser-473), AKT, and Cyclin D1 when compared with their respective controls, confirming that CLU could regulate PI3K/AKT signaling via interacting with EIF3I.
3.4. CLU regulated AKT via interacting with EIF3I
3.5. CLU inhibited premature senescence
It has been confirmed that CLU overexpression is associated with the up-regulation of the phosphorylation of AKT at ser 473 (Ammar and Closset, 2008), thus we speculated that the functional role of CLU may depend on the PI3K/AKT pathway which closely related to cell growth and proliferation. Evidence suggested CLU could activate AKT by complexing with EIF3I in human hepatocellular carcinoma cell line HCCLM3 (Wang et al., 2015). In order to understand the mechanisms by which CLU regulates PI3K/AKT signaling, we performed Co-IP assay. As shown in Fig. 4A, CLU interacted with EIF3I in both the L-02 EV and CLU OE cells. Confocal microscopy result further confirmed the direct interaction and co-localization of CLU and EIF3I in both the L-02 EV and CLU OE cells (Fig. 4B). We further revealed the up- or down-regulation of CLU in the hepatocytes resulted in the corresponding increase or decrease of EIF3I protein expression (Fig. 4C), while EIF3I mRNA level was not changed accordingly (Fig. 4D). These results suggested CLU could protect EIF3I from degradation. We also demonstrated that the phosphorylation of AKT was obviously repressed after the silence of EIF3I (Fig. 4E), indicating the regulatory effect of EIF3I on AKT. As shown in Fig. 4F, Up- or down-regulation of CLU in the hepatocytes also caused the corresponding increase or decrease at protein levels of PI3K,
The L-02 EV and CLU OE cells were exposed to 10 nM Cr(VI) twice a week for 24 h for 4 weeks and then were processed for senescence detection. As shown in Fig. 5A and after Cr(VI) exposure, while EV cells displayed increased SA-β-Gal activity, CLU over-expression alleviated Cr(VI)-induced premature senescence by significantly decreasing SA-βGal activity. When analyzing the cell cycle profile, we revealed that CLU over-expression reversed Cr(VI)-induced G1 phase cell cycle arrest by pushing the entrance of the cells from G1 phase to S phase and further to G2 phase (Fig. 5B). By examining the expressions of proteins associated with senescence-inducing pathways and with senescence biomarkers, we revealed that CLU over-expression inhibited Cr(VI)-induced increase of p53, p21, PTEN, FN1, CTGF, and SMP30 expressions (Fig. 5C). These results demonstrated that CLU could inhibit premature senescence. 3.6. CLU inhibited senescence through activation of PI3K/AKT pathway Based on the above results, we speculated that CLU could inhibit premature senescence by increasing cell proliferation through AKT 5
Ecotoxicology and Environmental Safety 183 (2019) 109465
Y. Zhang, et al.
Fig. 3. CLU increased cell proliferation. (A) The cells were treated with 10 nM Cr(VI) twice a week for 24 h for 4 weeks, and CLU level was assayed by western blotting. (B) Cells were transfected with CLU-cDNA or CLU shRNA. The expression of CLU in the OE or in the shRNA cells was determined using western blotting. (C) Cell proliferation was assayed by MTT assay. (D) The Caspase-3 activity was examined using the commercial kit. (E) Plate clone formation assay was performed to test the ability of the cells to form colonies. The relative plate clone formation ability = (mean clone number in the treated group/mean clone number in control group) × 100%. (F) Cell cycle analysis of the hepatocytes. *p < 0.05, compared with control.
signaling. Since CLU OE hepatocytes showed activated AKT signaling, we applied LY294002 to inhibit AKT in CLU OE hepatocytes. CLU OE cells and CLU OE cells treated with LY294002 were exposed to 10 nM Cr(VI) twice a week for 24 h for 4 weeks before processing for western blotting analysis. The immunoblotting results confirmed the inhibitory efficiency of LY294002 (Fig. 6A). Cr(VI) treatment inhibited the proteins expressions of AKT signaling. The occurrence of premature senescence was then evaluated by β-Gal staining and the result in Fig. 6B showed that while Cr(VI) and LY294002 showed no significant effect on premature senescence occurrence in CLU OE cells, the application of LY294002 in Cr(VI)-treated CLU OE cells showed significant increased
numbers of SA-β-Gal-positive cells, indicating that blockage of PI3K/ AKT pathway with LY294002 eliminated the inhibitory effect of CLU on Cr(VI)-triggered premature senescence. The cell cycle profiles in Fig. 6C and the protein expression result in Fig. 6D confirmed the above results and demonstrated that the inhibition of AKT induced by LY294002 in CLU OE cells exposed to Cr(VI) caused obvious G1 phase cell cycle arrest, senescence-inducing pathways activation, as well as senescence biomarkers (FN1, CTGF, and SMP30). These results together suggested that CLU inhibits senescence through activation of PI3K/AKT pathway.
6
Ecotoxicology and Environmental Safety 183 (2019) 109465
Y. Zhang, et al.
Fig. 4. CLU regulated AKT through interacting with EIF3I. (A) The interaction of CLU with EIF3I was assayed by Co-IP. (B) Co-localization of CLU (red) and EIF3I (green) in the hepatocytes was demonstrated using immunofluorescence (magnification × 1000). (C) EIF3I protein level was detected by western blotting. (D) mRNA level of CLU and EIF3I in L-02 CLU OE and CLU sh cells was detected using qPCR. (E) The hepatocytes were transfected with EIF3I shRNA (Scr-transfected cells served as control). The protein levels of EIF3I, p-AKT (ser-473), and AKT were assayed using western blotting. (F) The levels of proteins associated with PI3K/AKT signaling including PI3K, p-AKT (ser-473), AKT, and Cyclin D1 were assayed using western blotting. *p < 0.05, compared with the control. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
4. Discussion
inhibiting the activity of CDKs (Chikara et al., 2017). Although p16mediated senescence could act through the Rb pathway to inhibit CDK action and lead to G1 cell cycle arrest (Rayess et al., 2012), we are surprised that Rb-p16 pathway were not involved in Cr(VI)-induced premature senescence. Several studies suggested that Bcl-2 family proteins are associated with cell proliferation, and the present study revealed that Cr(VI) down-regulated pro-survival proteins Bcl-2 and Mcl-1, but up-regulated pro-apoptotic proteins Bad and Bax, suggesting the inhibition of cell proliferation in Cr(VI)-induced senescent hepatocytes. Bcl-2 family can be transcriptionally regulated in response to cytokines or pathways involved in proliferation, such as PI3K/AKT signaling (Zou et al., 2016). In the present study we focused on PI3K/ AKT due to its well-established role in regulating cell growth, proliferation, as well as senescence (Sahin and Depinho, 2015). PI3K/AKT signaling has been proved to be strictly regulated in normal cells depending on whether the cells undergo proliferation or cellular senescence (Bononi et al., 2011). The alteration of AKT signaling was considered to be one of the mechanisms that associated with premature senescence since the inhibition of PI3K/AKT pathway directly increases expression of p53 and p21and triggers premature senescence (Thill et al., 2011). In the contrast, the activation of the PI3K/AKT pathway represses premature senescence (Li et al., 2013). We observed that the
In recent years, the frequent occurrence of chromium contamination makes the study of oral exposure of Cr(VI)-induced hepatotoxicity a hot topic in toxicology. Previous studies on cytotoxicity of Cr(VI) mainly focused on apoptosis rather than premature senescence. It has been proved that normal proliferating cells could undergo apoptosis or premature senescence after large or mild/moderate stimulation (Chen et al., 2016). Since the environmental exposure to Cr(VI) and its compounds is often in the long-term low-dose manner, we believe that study on premature senescence has both practical significances and great theoretical values. In the present study we demonstrated that the hepatocytes exposed to Cr(VI) resulted in persistent growth arrest with a distinct morphological and biochemical phenotype. It is known that cyclin-dependent kinase (CDK) complexes could control the G1 to S cell cycle progression. The senescence pathways such as p53/p21 and PTEN were shown to permanently arrest growth and prevent carcinogenesis. P53, the tumor suppressor that significantly up-regulated in Cr(VI)-induced senescent hepatocytes, plays a role in anti-proliferative processes by mediating DNA repair and cell cycle checkpoints (Lukin et al., 2015). As the main target of p53, p21 causes G1 phase cell cycle arrest by directly 7
Ecotoxicology and Environmental Safety 183 (2019) 109465
Y. Zhang, et al.
Fig. 5. CLU inhibited premature senescence. Cells were exposed to 10 nM Cr(VI) twice a week for 24 h for 4 weeks. (A) SA-β-Gal staining for premature senescence hepatocytes. (B) Cell cycle analysis of the hepatocytes. (C) The expressions of proteins associated with senescence-inducing pathways (p53, p21, and PTEN) and with senescence biomarkers (FN1, CTGF, and SMP30) were determined using western blotting. *p < 0.05, compared to the respective control. #p < 0.05, compared to the groups without Cr(VI) exposure.
senescent hepatocytes revealed decreased levels of PI3K, p-AKT (ser473), AKT, and Cyclin D1, suggesting that Cr(VI) inhibited PI3K/AKT pathway. Since PI3K/AKT signaling pathway activator IGF-1 could suppress Cr(VI)-induced senescence, we confirmed that PI3K/AKT inhibition is associated with Cr(VI)-induced senescence. Cr(VI)-induced premature senescent cells showed high expression of CLU, and we demonstrated that CLU over-expression significantly increased cell proliferation while CLU knockdown induced significant cell growth inhibition. Our results revealed that CLU protected Cr(VI)-exposed cells from being senescent, indicating that high expression of CLU in senescent cells played a role in counteracting senescence though possible mechanisms. CLU, which is ubiquitously expressed in different tissues, could regulate cell survival, proliferation, and various stress responses (Rohne et al., 2015). CLU has two subtypes, namely nuclear CLU (nCLU) and secretory CLU (sCLU). It is confirmed that sCLU is the predominant form of CLU under physiological condition, and CLU in the present research referred to sCLU. As yet we have not found any reports about the molecular mechanism of CLU in premature senescence. Although CLU is well known for its anti-apoptotic function, senescence and apoptosis are two different concepts, thus CLU is unlikely to play an anti-apoptotic role in Cr (VI)-induced premature senescent hepatocytes. Due to the stagnation of division and proliferation of
senescent cells, we speculated that the mechanism of CLU inhibiting premature senescence may be related to PI3K/AKT signaling. PTEN protein has been proved to be a negative regulator of PI3K/AKT pathway (Xu et al., 2018), and the possible regulatory effect of CLU on AKT has never been studied in premature senescence. Evidence suggested CLU could activate AKT by interacting with EIF3I, resulting in increased MMP13 expression and hepatocellular carcinoma metastasis. In our present study, we established interactome of CLU in Cr(VI)-induced premature senescent hepatocytes. Co-IP and immunofluorescence assays confirmed that CLU was physically interacted with EIF3I. Furthermore, we also demonstrated that CLU overexpression was accompanied with up-regulated EIF3I protein level, but not with EIF3I mRNA level in Cr(VI)-induced senescent cells, suggesting that CLU could protect EIF3I from degradation. We also revealed that phosphorylation of AKT was significantly inhibited when EIF3I was silenced. It is known that EIF3I interacts with AKT and inhibits protein phosphatase 2A (PP2A)-mediated dephosphorylation, leading to AKT activation (Wang et al., 2013). Therefore, we believe that CLU interacts with EIF3I and prevent its degradation, then resulting in AKT activation in Cr (VI)-induced senescent hepatocytes. We also revealed that blockage of PI3K/AKT pathway with its inhibitor LY294002 eliminated the inhibitory effect of CLU on premature senescence, confirming that 8
Ecotoxicology and Environmental Safety 183 (2019) 109465
Y. Zhang, et al.
Fig. 6. CLU inhibited senescence through activation of PI3K/AKT pathway. CLU OE cells and CLU OE cells pre-treated with LY294002 (20 μM, 2 h) were incubated with 10 nM Cr(VI) twice a week for 24 h for 4 weeks. (A) Proteins expressions of AKT signaling (PI3K, p-AKT (ser-473), and AKT) were determined using western blotting. (B) SA-β-Gal staining for the detection of SA-β-Gal activity. (C) Cell cycle analysis of the hepatocytes. (D) The proteins expressions of senescence pathways (p53, p21, and PTEN) and the senescence biomarkers (FN1, CTGF, and SMP30) were determined using western blotting. *p < 0.05, compared to the respective control. #p < 0.05, compared to the groups without LY294002 exposure.
CLU inhibits senescence through activation of PI3K/AKT pathway. Senescence is known to be the barrier of tumorigenesis. The cells escaping from premature senescence have the tendency of malignant transformation, thus overcoming senescence state is an important step for the growth and immortality of cancer cells. CLU expression was significantly increased in Cr (VI)-induced senescent hepatocytes, and it is known that CLU was closely related to the occurrence, development and malignant proliferation of primary liver cancer. If CLU played an inhibitory role in Cr(VI)-induced hepatocytes premature senescence, activation of PI3K/AKT pathway caused by CLU will play a positive role in Cr (VI)-induced malignant transformation. Although in an inactive state, senescent cells are still metabolically and physiologically alive, and they could secret various factors which may alter the intracellular and surrounding microenvironment. These factors include numerous pro-inflammatory growth factors, chemokines, cytokines, as well as proteases, a feature termed SASP, which has powerful paracrine activities. SASP can be either beneficial or harmful because it plays the dual role of suppressing cancer development and promoting the repair of injured tissue (Campisi, 2013). The present study revealed that Cr (VI) increased the secretion levels of IL-1, IL-6, and MMP3 in the senescent cells. It is confirmed that MMP3, the extracellular matrix modifying enzyme, could disrupt normal tissue structure and drive invasive properties along with factors such as IL-1, IL-6, and IL-8 (Jiang et al., 2015b). Based on the previous finding of our group, short-term high-dose Cr (VI) exposure causes apoptosis, while long-term low-dose exposure triggers premature senescence. Since population exposure to Cr (VI) and its compounds is mostly in the long-term low-dose manner, the
present study will guide the research focus of Cr (VI)-induced cytotoxicity to premature senescence that has more practical significance, and will further elucidate the mechanism of hepatotoxicity caused by Cr (VI). This study for the first time explained why CLU was highly expressed in both premature senescence and malignant transformation, which are two distinct cytotoxic outcomes. In addition, previous studies have confirmed that overcoming premature senescence is the key step in the occurrence and development of malignant tumors, the cells escaping from premature senescence after the induction of carcinogenic factors (such as Cr(VI)) have the tendency of malignant transformation, and high expression of CLU is likely to help these “escapers” to undergo further tumorgenesis. Since the occurrence of primary liver cancer after Cr (VI) exposure is a multi-gene, multi-factor, and multi-step process, the study on the mechanism of CLU in premature senescence will provide the experimental basis for the research of Cr (VI)-induced liver cancer, especially for the elucidation of the mechanism of liver cancer cells escaping from senescence, and will also provide new ideas and strategies for the targeted therapy of hepatocellular carcinoma caused by chromium and other environmental toxicants. Conflicts of interest The authors have no conflicts of interest to declare. Acknowledgements We thank all of the individuals in this laboratory for their valuable suggestions. The current work was supported by National Natural 9
Ecotoxicology and Environmental Safety 183 (2019) 109465
Y. Zhang, et al.
Science Foundation of China (NO. 81773478) and Natural Science Foundation of Hunan Province, China (NO. 2019JJ40402).
of its chains show opposing effects on cellular lipid accumulation. Sci. Rep. 7 4123541235. Muñoz-Espín, D., Serrano, M., 2014. Cellular senescence: from physiology to pathology. Nat. Rev. Mol. Cell Biol. 15, 482–496. PA, P., AR, Y., M.,N., 2014. Inside and out: the activities of senescence in cancer. Nat. Rev. Cancer 14, 547–558. Pan, C.-H., Jeng, H.A., Lai, C.-H., 2017. Biomarkers of oxidative stress in electroplating workers exposed to hexavalent chromium. J. Expo. Sci. Environ. Epidemiol. 28, 76. Qi, L., Zhang, Y., Ming, Z., Lan, G., Xiao, Y., Fang, X.J.T.R., 2018. The role of IP3R-SOCCs in Cr(VI)-induced cytosolic Ca2+ overload and apoptosis. In: L-02 Hepatocytes, vol. 7. Rayess, H., Wang, M.B., Srivatsan, E.S., 2012. Cellular senescence and tumor suppressor gene p16. Int. J. Cancer 130, 1715–1725. Rodier, F., Campisi, J., 2011. Four faces of cellular senescence. JCB (J. Cell Biol.) 192, 547–556. Rohne, P., Prochnow, H., Koch-Brandt, C., 2015. The CLU-files: disentanglement of a mystery. Biomol. Concepts 7, 1–15. Sahin, E., Depinho, R.A., 2015. Linking functional decline of telomeres, mitochondria and stem cells during ageing. Nature 464, 520–528. Thill, M., Berna, M.J., Kunst, F., Wege, H., Strunnikova, N.V., Gordiyenko, N., Grierson, R., Richard, G., Csaky, K.G., 2011. SU5416 induces premature senescence in endothelial progenitor cells from patients with age-related macular degeneration. Mol. Vis. 17, 85. Vargas, A., Kim, H.S., Baral, E., Yu, W.-Q., Craft, C.M., Lee, E.-J., 2017. Protective effect of clusterin on rod photoreceptor in rat model of retinitis pigmentosa. PLoS One 12 e0182389-e0182389. Vishnu, V.Y., Modi, M., Sharma, S., Mohanty, M., Goyal, M.K., Lal, V., Khandelwal, N., Mittal, B.R., Prabhakar, S., 2016. Role of plasma clusterin in alzheimer's disease-A pilot study in a tertiary hospital in northern India. PLoS One 11 e0166369-e0166369. Wang, C., Jin, G., Jin, H., Wang, N., Luo, Q., Zhang, Y., Gao, D., Jiang, K., Gu, D., Shen, Q., 2015. Clusterin facilitates metastasis by EIF3I/Akt/MMP13 signaling in hepatocellular carcinoma. Oncotarget 6, 2903–2916. Wang, R., Yu, Z., Sunchu, B., Shoaf, J., Dang, I., Zhao, S., Caples, K., Bradley, L., Beaver, L.M., Ho, E., Löhr, C.V., Perez, V.I., 2017. Rapamycin inhibits the secretory phenotype of senescent cells by a Nrf2-independent mechanism. Aging Cell 16, 564–574. Wang, Y., Su, H., Song, X., Fiati Kenston, S.S., Zhao, J., Gu, Y., 2018. Luteolin inhibits multi-heavy metal mixture-induced HL7702 cell apoptosis through downregulation of ROS-activated mitochondrial pathway. Int. J. Mol. Med. 41, 233–241. Wang, Y.W., Lin, K.T., Chen, S.C., Gu, D.L., Chen, C.F., Tu, P.H., Jou, Y.S., 2013. Overexpressed-eIF3I interacted and activated oncogenic Akt1 is a theranostic target in human hepatocellular carcinoma. Hepatology 58, 239–250. Xiao, Y., Zeng, M., Yin, L., Li, N., Xiao, F., 2019. Clusterin increases mitochondrial respiratory chain complex I activity and protects against hexavalent chromium-induced cytotoxicity in L-02 hepatocytes. Toxicol Res (Camb). 8, 15–24. Xiu, P., Dong, X.-F., Li, X.-P., Li, J., 2015. Clusterin: review of research progress and looking ahead to direction in hepatocellular carcinoma. World J. Gastroenterol. 21, 8262–8270. Xu, M., Chen, X., Han, Y., Ma, C., Ma, L., Li, S., 2015. Clusterin silencing sensitizes pancreatic cancer MIA-PaCa-2 cells to gmcitabine via regulation of NF-kB/Bcl-2 signaling. Int. J. Clin. Exp. Med. 8, 12476–12486. Xu, W., Yang, Z., Xie, C., Zhu, Y., Shu, X., Zhang, Z., Li, N., Chai, N., Zhang, S., Wu, K., Nie, Y., Lu, N., 2018. PTEN lipid phosphatase inactivation links the hippo and PI3K/ Akt pathways to induce gastric tumorigenesis. J. Exp. Clin. Cancer Res. : CR (Clim. Res.) 37 198-198. Zhang, Y., Zhang, Y., Zhong, C., Fang, X., 2016. Cr(VI) induces premature senescence through ROS-mediated p53 pathway in L-02 hepatocytes. Sci. Rep. 6, 34578. Zou, Y., Li, Q., Jiang, L., Guo, C., Li, Y., Yu, Y., Li, Y., Duan, J., Sun, Z., 2016. DNA hypermethylation of CREB3L1 and Bcl-2 associated with the mitochondrial-mediated apoptosis via PI3K/akt pathway in human BEAS-2B cells exposure to silica nanoparticles. PLoS One 11 e0158475-e0158475.
References Abreu, P.L., Cunha-Oliveira, T., Ferreira, L.M.R., Urbano, A.M., 2018. Hexavalent chromium, a lung carcinogen, confers resistance to thermal stress and interferes with heat shock protein expression in human bronchial epithelial cells. Biometals 31, 477–487. Ammar, H., Closset, J., 2008. Clusterin activates survival through the phosphatidylinositol 3-kinase/Akt pathway. J. Biol. Chem. 283, 12851–12861. Bernardes de Jesus, B., Blasco, M.A., 2012. Assessing cell and organ senescence biomarkers. Circ. Res. 111, 97–109. Bononi, A., Agnoletto, C., De, M.E., Marchi, S., Patergnani, S., Bonora, M., Giorgi, C., Missiroli, S., Poletti, F., Rimessi, A., 2011. Protein kinases and phosphatases in the control of cell fate. Enzym. Res. 2011, 329098. Campisi, J., 2013. Aging, cellular senescence, and cancer. Annu. Rev. Physiol. 75, 685–705. Chen, D., Xia, D., Pan, Z., Xu, D., Zhou, Y., Wu, Y., Cai, N., Tang, Q., Wang, C., Yan, M., Zhang, J.J., Zhou, K., Wang, Q., Feng, Y., Wang, X., Xu, H., Zhang, X., Tian, N., 2016. Metformin protects against apoptosis and senescence in nucleus pulposus cells and ameliorates disc degeneration in vivo. Cell Death Dis. 7 e2441-e2441. Chikara, S., Lindsey, K., Dhillon, H., Mamidi, S., Kittilson, J., Christofidou-Solomidou, M., Reindl, K.M., 2017. Enterolactone induces G(1)-phase cell cycle arrest in nonsmall cell lung cancer cells by downregulating cyclins and cyclin-dependent kinases. Nutr. Cancer 69, 652–662. Hayflick, L., 1965. The limited in vitro lifetime of human diploid cell strains. Exp. Cell Res. 37, 614–636. Jiang, L., Wang, C., Lei, F., Zhang, L., Zhang, X., Liu, A., Wu, G., Zhu, J., Song, L., 2015a. miR-93 promotes cell proliferation in gliomas through activation of PI3K/Akt signaling pathway. Oncotarget 6, 8286–8299. Jiang, Y.N., Yan, H.Q., Huang, X.B., Wang, Y.N., Li, Q., Gao, F.G., 2015b. Interleukin 6 trigged ataxia-telangiectasia mutated activation facilitates lung cancer metastasis via MMP-3/MMP-13 up-regulation. Oncotarget 6, 40719–40733. Joo, K.J., 2011. Role of clusterin and tumor necrosis factor receptors on the apoptosis of prostate cancer cells. Microbiol. Immunol. 29, 43. Kohsaka, S., Sasai, K., Takahashi, K., Akagi, T., Tanino, M., Kimura, T., Nishihara, H., Tanaka, S., 2011. A population of BJ fibroblasts escaped from Ras-induced senescence susceptible to transformation. Biochem. Biophys. Res. Commun. 410, 878–884. Li, J., Yu, L., Zhao, Y., Fu, G., Zhou, B., 2013. Thymosin Î24 reduces senescence of endothelial progenitor cells via the PI3K/Akt/eNOS signal transduction pathway. Mol. Med. Rep. 7, 598–602. Linos, A., Petralias, A., Christophi, C.A., Christoforidou, E., Kouroutou, P., Stoltidis, M., Veloudaki, A., Tzala, E., Makris, K.C., Karagas, M.R., 2011. Oral ingestion of hexavalent chromium through drinking water and cancer mortality in an industrial area of Greece - an ecological study. Environ. Health 10. Lukin, D.J., Carvajal, L.A., Liu, W.-j., Resnick-Silverman, L., Manfredi, J.J., 2015. p53 Promotes cell survival due to the reversibility of its cell-cycle checkpoints. Mol. Cancer Res. : MCR 13, 16–28. Luo, X., Suzuki, M., Ghandhi, S.A., Amundson, S.A., Boothman, D.A., 2014a. ATM regulates insulin-like growth factor 1-secretory clusterin (IGF-1-sCLU) expression that protects cells against senescence. PLoS One 9 e99983-e99983. Luo, X., Suzuki, M., Ghandhi, S.A., Amundson, S.A., Boothman, D.A., 2014b. ATM regulates insulin-like growth factor 1-secretory clusterin (IGF-1-sCLU) expression that protects cells against senescence. PLoS One 9, e99983. Ma, J., Sawai, H., Matsuo, Y., Ochi, N., Yasuda, A., Takahashi, H., Wakasugi, T., Funahashi, H., Sato, M., Takeyama, H., 2010. IGF-1 mediates PTEN suppression and enhances cell invasion and proliferation via activation of the IGF-1/PI3K/Akt signaling pathway in pancreatic cancer cells. J. Surg. Res. 160, 90–101. Matukumalli, S.R., Tangirala, R., Rao, C.M., 2017. Clusterin: full-length protein and one
10
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv
Expression of Clusterin suppresses Cr(VI)-induced premature senescence through activation of PI3K/AKT pathway
T
Yujing Zhang, Yiyuan Zhang, Yuanyuan Xiao, Caigao Zhong, Fang Xiao* Department of Health Toxicology, Xiangya School of Public Health, Central South University, Changsha, 410078, PR China
ARTICLE INFO
ABSTRACT
Keywords: Hexavalent chromium [Cr(VI)] Clusterin (CLU) Premature senescence Phosphatidylinositol 3-kinase (PI3K)/Protein kinase B (AKT) L-02 hepatocytes
Our group found that long-term low-dose exposure to hexavalent chromium [Cr(VI)] in L-02 hepatocytes resulted in premature senescence, which accompanied by the increased expression of Clusterin (CLU), but the functional role of CLU in premature senescence has never been explored. In the present study, the CLU overexpressed or silenced L-02 hepatocytes were established by lentiviral vector transfection. Cell viability assay, cell cycle analysis, western blotting, plate clone formation assay, and confocal microcopy were performed. The results indicated that Cr(VI)-induced premature senescence was associated with phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) pathway inhibition, and high expression of CLU in the senescent cells exerted its functional role of promoting cell proliferation. CLU could complex with eukaryotic translation initiation factor 3 subunit I (EIF3I) and prevent its degradation, leading to the increase of AKT activity in Cr(VI)-exposed senescent hepatocytes. Blockage of the PI3K/AKT pathway with its inhibitor LY294002 eliminated the inhibitory effect of CLU on Cr(VI)-induced premature senescence. We concluded that high expression of CLU suppressed Cr(VI)induced premature senescence through activation of PI3K/AKT pathway, which will provide the experimental basis for the study of Cr(VI)-induced liver cancer, especially for the elucidation of the mechanism of liver cancer cells escaping from senescence.
1. Introduction Hexavalent chromium [Cr(VI)] and its compounds are used in different industries worldwide in various applications, such as welding, plating, pigment production, and wood processing (Pan et al., 2017). As a confirmed human carcinogen, Cr(VI) has long been considered to increase lung cancer incidence by inhalation route of exposure (Abreu et al., 2018). In recent years, oral exposure to Cr(VI) attracts more attention since water contamination with Cr(VI) has become a worldwide problem of significant public health importance. It has been reported that oral ingestion of Cr(VI) through drinking water caused elevated primary liver cancer mortality (Linos et al., 2011), which highlighted that great attention should be paid to the research on Cr(VI)-induced hepatotoxicity. Previous studies on Cr(VI) mainly focused on apoptosis, while little was known about cellular senescence. We earlier demonstrated that Cr(VI) caused premature senescence in the hepatocytes (Zhang et al., 2016). The concept of senescence was first introduced by Hayflick et al., in 1965 (Hayflick, 1965). Cellular senescence is an important biological phenomenon that considered to be a safeguard mechanism to protect normal cells and organisms by preventing
uncontrolled proliferation of the cancer cells (Rodier and Campisi, 2011). The senescent cells often possess characteristic features including enlarged and fattened morphology, permanent growth arrest, augmented senescence-associated β-galactosidase (SA-β-gal) activity, and up-regulated senescence-associated genes such as p21 and transforming growth factor β-1 (TGF-β1) (Wang et al., 2017). Premature senescence can be triggered by various cellular stress, oncogenes activation, and cytotoxic agents exposure. Clusterin (CLU) is a stress-inducible secreted glycoprotein that implicated in a variety of biological processes (Vargas et al., 2017), including senescence. As a biomarker of senescence, CLU is up-regulated during senescence (Luo et al., 2014a). CLU is also found to be increased in the age-related diseases such as diabetes type II and Alzheimer's disease (Vishnu et al., 2016). Although the mechanisms regulating CLU during cellular senescence were not very clear, it is believed that ataxia telangiectasia mutant (ATM)- insulin-like growth factor 1 (IGF-1) axis plays a role in the up-stream regulation of CLU (Luo et al., 2014b). In normal cells, CLU not only acts as an “extracellular chaperone” that clears debris from injured cells, tissues or organs (Matukumalli et al., 2017), but also protects cells from apoptosis via interacting with B-cell
* Corresponding author. Department of Health Toxicology, Xiangya School of Public Health, Central South University, NO.238 Shangmayuanling Road, Kaifu District, Changsha, Hunan, 410078, China. E-mail address: [email protected] (F. Xiao).
https://doi.org/10.1016/j.ecoenv.2019.109465 Received 15 April 2019; Received in revised form 18 June 2019; Accepted 22 July 2019 0147-6513/ © 2019 Elsevier Inc. All rights reserved.
Ecotoxicology and Environmental Safety 183 (2019) 109465
Y. Zhang, et al.
lymphoma-2 (Bcl-2)-associated X protein (Bax) (Xu et al., 2015) and tumor necrosis factor (TNF) (Joo, 2011). We revealed that CLU expression was significantly increased in Cr (VI)-induced senescent cells, and it has been confirmed that the overexpressed CLU in primary liver cancer cells is closely related to the occurrence, development and metastasis of malignant tumor (Xiu et al., 2015). Cells undergo premature senescence is unlikely to become carcinogenesis due to irreversible cell cycle arrest and cessation of cell division and proliferation, while the cells escaped from premature senescence after carcinogen exposure have been proved to have the tendency of malignant transformation (Kohsaka et al., 2011). It is not clear why CLU expression was increased in both premature senescence and carcinogenesis, the two completely distinct cytotoxic outcomes. CLU can promote the occurrence and development of malignant tumors, and premature senescence is considered an obstacle in the carcinogenic process, thus we speculated that the high-expression of CLU in senescent cells may play a role in inhibiting premature senescence. The antiapoptotic effect of CLU depends on its interaction with Bax and TNF, cells undergo premature senescence cannot become apoptotic, thus CLU is unlikely to play an anti-apoptotic role in premature senescence cells. Since the premature senescent cells show stagnation of division and proliferation, the mechanism of CLU inhibiting premature senescence may be related to its influence on cell proliferation and differentiation. As a confirmed carcinogen, Cr(VI) also induces compensatory tumor-suppressive responses including apoptosis, necrosis, or cellular senescence, but the signals determining the main outcome were unclear. The present study will uncover the role of CLU in Cr(VI)-induced premature senescence. By suppressing Cr(VI)-induced senescence, CLU wou ld be expected to favor tumor progression. Although CLU is a novel senescent biomarker and its up-regulation is believed to be a secondary consequence of senescence phenotype caused by gradual stress accumulation, CLU function and its implication in both senescence and senescence-related physiological and pathological process need to be fully explored. Our preliminary results raise the possibility that CLU accumulation in senescent cells is probably coupled to the promotion of cell growth and proliferation which is specifically related to the inhibition of senescence and, therefore, most probably represents a useful indicator of Cr(VI)-triggered premature senescence.
(#3521), and β-actin (#4967) were obtained from Cell Signaling Technology (Beverly, MA, USA). Connective tissue growth factor (CTGF) (L20) (sc-14939), senescence marker protein 30 (SMP30) (E−11) (sc-390098), CLU (A-9) (sc-166907) (for western blotting and confocal microcopy analysis) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Fibronectin (FN) (BA1771) was purchased from BOSTER (Wuhan, China). Eukaryotic translation initiation factor 3 subunit I (EIF3I) (11287-1-AP) (for western blotting, co-immunoprecipitation (Co-IP), and confocal microcopy analysis) and CLU (12289-1-AP) (for Co-IP) were purchased from ProteinTech (Wuhan, China). 2.3. Cloning of CLU cDNA, viral infection and establishment of CLU knockdown cells The CLU over-expression and knockdown hepatocytes were established as described previously (Xiao et al., 2019). The commercial cDNA encoding CLU (pDONR223-CLU) (Changsha Yingrun Biotechnology Co., Ltd, Changsha, China) was amplified and cloned into pLVX-IRES-puro vector (Clontech, Mountain View, CA). Lentiviral carrying CLU cDNA was then generated. A sCLU-RNA interference (RNAi) lentiviral vector, pYr-LV-CLU small hairpin RNA (shRNA), was also constructed (Changsha Yingrun Biotechnology Co., Ltd, Changsha, China). Lentiviral carrying CLU shRNA or scrambled (Scr) shRNA was used to infect L-02 hepatocytes. 2.4. MTT assay for cell proliferation The MTT assay was applied to determine cell proliferation ability. The hepatocytes were harvested and seeded into 96-well plates (2000 cells/well). After incubation for 5 days, the cells were cultured with MTT solution for 2 h and then were treated with 200 μl dimethyl sulfoxide (DMSO). Absorbance was read at 490 nm to measure the cell quantity. 2.5. Analysis for apoptotic cells Cells were doubly stained with FITC (0.5 μg/ml) and PI (1 μg/ml). The suspensions were then determined by flow cytometry. Data was analyzed using CellQuest software. The population of early apoptosis cells (Annexin-V-FITC positive) and late apoptosis cells (Annexin-VFITC/PI positive) were quantified.
2. Materials and methods 2.1. Cell culture The immortalized human L-02 hepatocytes were purchased from China Center for Type Culture Collection of Wuhan University. The cells were cultured as previously described (Xiao et al., 2019). Briefly, L-02 hepatocytes were cultured in RPMI-1640 medium with 10% FBS and antibiotics (50 U/ml penicillin and 50 μg/ml streptomycin) in a humidied incubator with 5% CO2 at 37 °C. Cells are treated with the indicated concentrations of different chemicals.
2.6. Analysis for cell cycle The hepatocytes were exposed to the indicated concentrations of different chemicals. After incubation, cells were trypsinized and fixed with ethanol (ice-cold, 70%) for 1 h, then were incubated with RNase A (200 μg/ml) for 90 min at 37 °C, and followed by the incubation with PI (50 μg/ml) for 30 min in the dark. Finally, the samples were collected and analyzed by flow cytometry.
2.2. Reagents
2.7. SA-β-gal staining for senescent cells
Potassium dichromate (K2Cr2O7) was obtained from the chemical reagents company of Changsha (changsha, China). 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), AnnexinV- fluorescein isothiocyanate (FITC), propidium iodide (PI), and 4’,6Diamidino-2-phenylindole dihydrochloride (DAPI) were obtained from Sigma (St. Louis, MO, USA). The antibodies of p53 (#9282), phospho (p)-p53 (ser-15) (#9284), p-p53 (ser-392) (#9281), p-p53 (ser-20) (#9287), p21 (12D1) (#2947), retinoblastoma (Rb) (4H1) (#9309), p16 (D7C1M) (#80772), phosphatidylinositol 3-kinase (PI3K) p85 (19H8) (#4257), phosphatase and tensin homolog deleted on chromosome ten (PTEN) (138G6) (#9559), p-protein kinase B (AKT) (ser473) (D9E) (#4060), AKT (#9272), Cyclin D1 (#2922), mouse double minute 2 homolog (MDM2) (D1V2Z) (#86934), p-MDM2 (Ser-166)
Briefly, the hepatocytes were exposed to different chemicals and then were fixed with paraformaldehyde (4%, 10 min). After the fixation, the cells were incubated with freshly prepared staining solution at 37 °C for 48 h, and then were washed and dried in the dark at room temperature. Inverted microscope with a 200 magnification was applied to take light microscopic pictures. At least 3 random fields were evaluated in each well. 2.8. Western blotting Western blotting analysis for protein levels was performed as described previously (Qi et al., 2018). Briefly, cells were lysed using the 2
Ecotoxicology and Environmental Safety 183 (2019) 109465
Y. Zhang, et al.
variance (ANOVA). Comparison between two treated groups was performed using Student-Newman-Keuls (SNK) test. SPSS 19.0 software was used. P < 0.05 indicates the significant difference.
commercial Cell Lysis Kit (Sigma-Aldrich, St. Louis, MO, USA). Protein samples were separated and transferred to the membrane. Membranes were blocked with 4% nonfat milk and immunostained with the related primary antibodies overnight at 4 °C. After incubation with the proper secondary antibodies, the membranes were developed with luminol reagent and then exposed onto films.
3. Results 3.1. Cr(VI) triggered premature senescence
2.9. Determination of cytokines levels
The hepatocytes were treated with 10 nM Cr(VI) twice a week for 24 h for 4 weeks. Continuous treatment of the hepatocytes with Cr(VI) efficiently blocked cell proliferation (Fig. 1A). Apoptosis has been implicated as the main mechanism for the inhibition of cell proliferation by heavy metals (Wang et al., 2018). FACS analysis with Annexin V and PI staining revealed long term low dosage Cr(VI) exposure, which was sufficient to suppress cell proliferation, didn't induce apoptosis (Fig. 1 B). We also examined the cell cycle profile and found that the growth inhibited cells revealed G1 phase cell cycle arrest (Fig. 1 C). It is confirmed that in addition to apoptosis, stressed cells could adopt the irreversible and permanent cell cycle arrest to undergo premature senescence (Muñoz-Espín and Serrano, 2014). As shown in Fig. 1D, Cr(VI) treatment group showed increased SA-β-Gal activity, indicating the occurrence of cellular senescence. There are three senescence-inducing pathways involving many tumor suppressors, namely, p53/p21 pathway, Rb/p16 pathway, and PTEN pathway (Bernardes de Jesus and Blasco, 2012). We then analyzed the protein expression patterns of these tumor suppressors using Western blot analysis. Since post-translational modifications such as phosphorylation play an important role in p53 protein stabilization, we first evaluate the protein levels of phosphorylated p53 and found only phosphorylation of 53 at ser 15 was increased. P53, p21, and PTEN protein levels were up-regulated, suggesting p53/p21 and PTEN pathways, but not Rb/p16 pathway were participated in Cr(VI)-induced senescence (Fig. 1E). We also detected the protein levels of biomarkers of premature senescence including FN1, CTGF, and SMP30 and found that all tested senescence-associated proteins were increased (Fig. 1F). Senescence is known to be accompanied with the increase secretion of secreted factors such as growth factors, chemokines (IL-8), pro-inflammatory cytokines (IL-1, IL-6), and proteases MMP3, which is termed the SASP (PA et al., 2014). The supernatant of the cells was collected and checked for the levels of IL-1, IL-6 and MMP3. Fig. 1G revealed that Cr(VI) increased the secretion of these factors in the senescent cells.
The supernatant of the hepatocytes were collected to determine senescence-associated secretory phenotype (SASP) associated cytokines including interleukin-1 (IL-1), IL-6, and proteases matrix metalloproteinase-3 (MMP3) using enzyme linked immunosorbent assay (ELISA) kits (Cusabio Co., Ltd, Wuhan, China). 2.10. Caspase-3 activity assay The assay was performed using Caspase-3 activity detection Kit (BiYunTian Biotechnology Research Institute, Shanghai, China) according to the protocol. 2.11. Plate clone formation assay Exponentially growing hepatocytes were collected and seeded in 6well plates. The density was about 1000 cells/well. Cells were incubated for 14 days to form the colonies. Colonies of every plate were stained with Giemsa for 20 min. The plates were photographed. The relative plate clone formation ability = (mean clone number in the treated group/mean clone number in control group) × 100%. 2.12. Co-IP Co-IP was performed using the Co-IP kit from Thermo Scientific Pierce (Waltham, MA, USA). Briefly, the isolated pre-cleared protein was incubated with anti-EIF3I or anti-CLU antibody overnight at 4 °C. After the incubation, the IP targets were disassociated. 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was used to resolve the eluted proteins, followed by western blotting using appropriate antibodies. 2.13. Confocal microcopy The hepatocytes were fixed with paraformaldehyde (4%, 20 min) and permeabilized with Triton X-100 (0.5%, 20 min). The cells were then blocked with 5% FBS for 30 min and incubated with the primary antibody at 4 °C overnight. After the incubation, cells were stained using fluorescein-conjugated secondary antibody for 1 h and 1 μg/mL DAPI for 7 min, then washed with PBS and imaged using a confocal microscope.
3.2. PI3K/AKT inhibition was associated with Cr(VI)-induced premature senescence PI3K/AKT signaling pathway is known to control and coordinate two major cellular processes: cell cycle progression and cell growth/ proliferation (Jiang et al., 2015a). Since cell cycle arrest and cell growth inhibition are the main characteristics of senescence, we speculated that PI3K/AKT pathway played a role in Cr(VI)-induced senescence. As shown in Fig. 2A, the senescent hepatocytes revealed decreased PI3K, p-AKT (ser-473), AKT, and Cyclin D1expressions, suggesting Cr(VI) inhibited PI3K/AKT pathway. IGF-1 has been proven to activate PI3K/AKT signaling pathway by binding with the IGF-1 receptor (IGF-1R), thereby facilitating cell proliferation and differentiation (Ma et al., 2010). We then explored the effect of IGF-1 on the protein expression alterations of Cr(VI)-induced PI3K/AKT pathway and senescence-inducing pathways. The application of IGF-1 alleviated Cr(VI)-induced PI3K/AKT pathway inhibition as well as the activation of senescence-inducing p53/p21 and PTEN pathways (Fig. 2B). Senescence stain in Fig. 2C showed that IGF-1 decreased the numbers of SAβ-Gal-positive cells induced by Cr(VI), cell cycle analysis in Fig. 2D showed that IGF-1 alleviated G1 phase arrest induced by Cr(VI). Since IGF-1 could suppress senescence caused by Cr(VI), we thought PI3K/ AKT inhibition is associated with Cr(VI)-induced senescence.
2.14. Quantitative real-time PCR (qPCR) qPCR was performed as described before (Qi et al., 2018). The analysis was done using SYBR®Premix Taq™ (Takara, Dalian, China) with an Applied Biosystems 7900HT Fast Real-Time PCR System (Applied Biosystems, Inc., Foster City, CA, USA) to determine the genes mRNA levels. ACTB was served as control. Forward (F) and Reverse (R) primer sequences were as follows: CLU: F (5′-3′), GAGCAGCTGAACGAGCAGTTT; R (5′-3′), CTTCGCC TTGCGTGAGGT; EIF3I: F (5′-3′), CGGGATGAAGCCGATCCTAC; R (5′3′), GGGTCCTTGGCCACAGTAAA. 2.15. Statistical analysis All data were expressed as mean ± standard deviation (SD). Differences among groups were calculated using one-way analysis of 3
Ecotoxicology and Environmental Safety 183 (2019) 109465
Y. Zhang, et al.
Fig. 1. Cr(VI) trigered premature senescence. The cells were treated with 10 nM Cr(VI) twice a week for 24 h for 4 weeks. (A) Cell proliferation was measured at different time points (day 0 to day 5) using MTT method. (B) The apoptotic cells were examined using Annexin V/PI staining by flow cytometry. (C) Cell cycle profile of the hepatocytes. (D) Cellular senescence was measured using the commercial β-Gal Staining Kit. (E) Western blotting analysis of the proteins (p53, p21, Rb, p16, PTEN) from the three senescence-inducing pathways. (F) Western blotting analysis of the senescence-associated proteins FN1, CTGF, and SMP30. (G) The levels of IL1, IL-6 and MMP3 were examined using ELISA method. *p < 0.05, compared with the control.
3.3. CLU increased cell proliferation
significant cell growth inhibition in the hepatocytes, this is consistent with the result in Fig. 3D which revealed that caspase-3 activity was decreased in CLU OE cells, and was increased in CLU sh cells, compared with the respective controls. Clone formation assays in Fig. 3E indicated that the ability to form colonies was increased in CLU OE cells and was reduced in CLU sh cells compared with the EV cells and Scr cells, respectively. We also determined cell cycle analysis of the transfected cells. As shown in Fig. 3F, CLU OE cells showed the decrease of G1 phase percentage and the increase of S and G2 phage percentages compared with the EV cells, indicating the OE cells gained the higher proliferation ability. In contrast, the CLU sh cells showed the increase of G1 phase percentage and the decrease of S and G2 phage percentages
We assayed CLU protein expression level in Cr(VI)-induced premature senescent cells. As shown in Fig. 3A, CLU was obviously upregulated in Cr(VI)-induced senescent hepatocytes. To test the functional role of CLU, we over-expressed or knocked down CLU in the hepatocytes. Immunoblotting result revealed significant increase of CLU in the cells after transfection with CLU-cDNA, and dramatic decrease of CLU in the cells transfected with CLU shRNA. Cells transfected with empty vector (EV) and scrambled (Scr) sequence were served as controls (Fig. 3B). As shown in Fig. 3C, CLU over-expression significantly increased cell proliferation while CLU knockdown induced 4
Ecotoxicology and Environmental Safety 183 (2019) 109465
Y. Zhang, et al.
Fig. 2. PI3K/AKT inhibition was associated with Cr(VI)-induced premature senescence. (A) The cells were treated with 10 nM Cr(VI) twice a week for 24 h for 4 consecutive weeks, and then were processed to determine the proteins expression of PI3K, p-AKT (ser-473), AKT, and Cyclin D1. (B) The cells were treated with 10 nM Cr(VI) twice a week for 24 h for 4 weeks with or without the pretreatment of IGF-1 (50 ng/l, 2 h). The expressions of proteins of PI3K/AKT pathway and senescence-inducing pathways (p-MDM2 (ser-166), MDM2, p-53 (ser-15), p53, p21, and PTEN) were examined by western blotting. (C) β-Gal Stain for senescent cells. (D) Cell cycle profile of the hepatocytes. *p < 0.05, compared with the control. #p < 0.05, compared with Cr(VI) treatment group.
compared with the Scr cells, indicating the sh cells gained the lower proliferation ability.
p-AKT (ser-473), AKT, and Cyclin D1 when compared with their respective controls, confirming that CLU could regulate PI3K/AKT signaling via interacting with EIF3I.
3.4. CLU regulated AKT via interacting with EIF3I
3.5. CLU inhibited premature senescence
It has been confirmed that CLU overexpression is associated with the up-regulation of the phosphorylation of AKT at ser 473 (Ammar and Closset, 2008), thus we speculated that the functional role of CLU may depend on the PI3K/AKT pathway which closely related to cell growth and proliferation. Evidence suggested CLU could activate AKT by complexing with EIF3I in human hepatocellular carcinoma cell line HCCLM3 (Wang et al., 2015). In order to understand the mechanisms by which CLU regulates PI3K/AKT signaling, we performed Co-IP assay. As shown in Fig. 4A, CLU interacted with EIF3I in both the L-02 EV and CLU OE cells. Confocal microscopy result further confirmed the direct interaction and co-localization of CLU and EIF3I in both the L-02 EV and CLU OE cells (Fig. 4B). We further revealed the up- or down-regulation of CLU in the hepatocytes resulted in the corresponding increase or decrease of EIF3I protein expression (Fig. 4C), while EIF3I mRNA level was not changed accordingly (Fig. 4D). These results suggested CLU could protect EIF3I from degradation. We also demonstrated that the phosphorylation of AKT was obviously repressed after the silence of EIF3I (Fig. 4E), indicating the regulatory effect of EIF3I on AKT. As shown in Fig. 4F, Up- or down-regulation of CLU in the hepatocytes also caused the corresponding increase or decrease at protein levels of PI3K,
The L-02 EV and CLU OE cells were exposed to 10 nM Cr(VI) twice a week for 24 h for 4 weeks and then were processed for senescence detection. As shown in Fig. 5A and after Cr(VI) exposure, while EV cells displayed increased SA-β-Gal activity, CLU over-expression alleviated Cr(VI)-induced premature senescence by significantly decreasing SA-βGal activity. When analyzing the cell cycle profile, we revealed that CLU over-expression reversed Cr(VI)-induced G1 phase cell cycle arrest by pushing the entrance of the cells from G1 phase to S phase and further to G2 phase (Fig. 5B). By examining the expressions of proteins associated with senescence-inducing pathways and with senescence biomarkers, we revealed that CLU over-expression inhibited Cr(VI)-induced increase of p53, p21, PTEN, FN1, CTGF, and SMP30 expressions (Fig. 5C). These results demonstrated that CLU could inhibit premature senescence. 3.6. CLU inhibited senescence through activation of PI3K/AKT pathway Based on the above results, we speculated that CLU could inhibit premature senescence by increasing cell proliferation through AKT 5
Ecotoxicology and Environmental Safety 183 (2019) 109465
Y. Zhang, et al.
Fig. 3. CLU increased cell proliferation. (A) The cells were treated with 10 nM Cr(VI) twice a week for 24 h for 4 weeks, and CLU level was assayed by western blotting. (B) Cells were transfected with CLU-cDNA or CLU shRNA. The expression of CLU in the OE or in the shRNA cells was determined using western blotting. (C) Cell proliferation was assayed by MTT assay. (D) The Caspase-3 activity was examined using the commercial kit. (E) Plate clone formation assay was performed to test the ability of the cells to form colonies. The relative plate clone formation ability = (mean clone number in the treated group/mean clone number in control group) × 100%. (F) Cell cycle analysis of the hepatocytes. *p < 0.05, compared with control.
signaling. Since CLU OE hepatocytes showed activated AKT signaling, we applied LY294002 to inhibit AKT in CLU OE hepatocytes. CLU OE cells and CLU OE cells treated with LY294002 were exposed to 10 nM Cr(VI) twice a week for 24 h for 4 weeks before processing for western blotting analysis. The immunoblotting results confirmed the inhibitory efficiency of LY294002 (Fig. 6A). Cr(VI) treatment inhibited the proteins expressions of AKT signaling. The occurrence of premature senescence was then evaluated by β-Gal staining and the result in Fig. 6B showed that while Cr(VI) and LY294002 showed no significant effect on premature senescence occurrence in CLU OE cells, the application of LY294002 in Cr(VI)-treated CLU OE cells showed significant increased
numbers of SA-β-Gal-positive cells, indicating that blockage of PI3K/ AKT pathway with LY294002 eliminated the inhibitory effect of CLU on Cr(VI)-triggered premature senescence. The cell cycle profiles in Fig. 6C and the protein expression result in Fig. 6D confirmed the above results and demonstrated that the inhibition of AKT induced by LY294002 in CLU OE cells exposed to Cr(VI) caused obvious G1 phase cell cycle arrest, senescence-inducing pathways activation, as well as senescence biomarkers (FN1, CTGF, and SMP30). These results together suggested that CLU inhibits senescence through activation of PI3K/AKT pathway.
6
Ecotoxicology and Environmental Safety 183 (2019) 109465
Y. Zhang, et al.
Fig. 4. CLU regulated AKT through interacting with EIF3I. (A) The interaction of CLU with EIF3I was assayed by Co-IP. (B) Co-localization of CLU (red) and EIF3I (green) in the hepatocytes was demonstrated using immunofluorescence (magnification × 1000). (C) EIF3I protein level was detected by western blotting. (D) mRNA level of CLU and EIF3I in L-02 CLU OE and CLU sh cells was detected using qPCR. (E) The hepatocytes were transfected with EIF3I shRNA (Scr-transfected cells served as control). The protein levels of EIF3I, p-AKT (ser-473), and AKT were assayed using western blotting. (F) The levels of proteins associated with PI3K/AKT signaling including PI3K, p-AKT (ser-473), AKT, and Cyclin D1 were assayed using western blotting. *p < 0.05, compared with the control. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
4. Discussion
inhibiting the activity of CDKs (Chikara et al., 2017). Although p16mediated senescence could act through the Rb pathway to inhibit CDK action and lead to G1 cell cycle arrest (Rayess et al., 2012), we are surprised that Rb-p16 pathway were not involved in Cr(VI)-induced premature senescence. Several studies suggested that Bcl-2 family proteins are associated with cell proliferation, and the present study revealed that Cr(VI) down-regulated pro-survival proteins Bcl-2 and Mcl-1, but up-regulated pro-apoptotic proteins Bad and Bax, suggesting the inhibition of cell proliferation in Cr(VI)-induced senescent hepatocytes. Bcl-2 family can be transcriptionally regulated in response to cytokines or pathways involved in proliferation, such as PI3K/AKT signaling (Zou et al., 2016). In the present study we focused on PI3K/ AKT due to its well-established role in regulating cell growth, proliferation, as well as senescence (Sahin and Depinho, 2015). PI3K/AKT signaling has been proved to be strictly regulated in normal cells depending on whether the cells undergo proliferation or cellular senescence (Bononi et al., 2011). The alteration of AKT signaling was considered to be one of the mechanisms that associated with premature senescence since the inhibition of PI3K/AKT pathway directly increases expression of p53 and p21and triggers premature senescence (Thill et al., 2011). In the contrast, the activation of the PI3K/AKT pathway represses premature senescence (Li et al., 2013). We observed that the
In recent years, the frequent occurrence of chromium contamination makes the study of oral exposure of Cr(VI)-induced hepatotoxicity a hot topic in toxicology. Previous studies on cytotoxicity of Cr(VI) mainly focused on apoptosis rather than premature senescence. It has been proved that normal proliferating cells could undergo apoptosis or premature senescence after large or mild/moderate stimulation (Chen et al., 2016). Since the environmental exposure to Cr(VI) and its compounds is often in the long-term low-dose manner, we believe that study on premature senescence has both practical significances and great theoretical values. In the present study we demonstrated that the hepatocytes exposed to Cr(VI) resulted in persistent growth arrest with a distinct morphological and biochemical phenotype. It is known that cyclin-dependent kinase (CDK) complexes could control the G1 to S cell cycle progression. The senescence pathways such as p53/p21 and PTEN were shown to permanently arrest growth and prevent carcinogenesis. P53, the tumor suppressor that significantly up-regulated in Cr(VI)-induced senescent hepatocytes, plays a role in anti-proliferative processes by mediating DNA repair and cell cycle checkpoints (Lukin et al., 2015). As the main target of p53, p21 causes G1 phase cell cycle arrest by directly 7
Ecotoxicology and Environmental Safety 183 (2019) 109465
Y. Zhang, et al.
Fig. 5. CLU inhibited premature senescence. Cells were exposed to 10 nM Cr(VI) twice a week for 24 h for 4 weeks. (A) SA-β-Gal staining for premature senescence hepatocytes. (B) Cell cycle analysis of the hepatocytes. (C) The expressions of proteins associated with senescence-inducing pathways (p53, p21, and PTEN) and with senescence biomarkers (FN1, CTGF, and SMP30) were determined using western blotting. *p < 0.05, compared to the respective control. #p < 0.05, compared to the groups without Cr(VI) exposure.
senescent hepatocytes revealed decreased levels of PI3K, p-AKT (ser473), AKT, and Cyclin D1, suggesting that Cr(VI) inhibited PI3K/AKT pathway. Since PI3K/AKT signaling pathway activator IGF-1 could suppress Cr(VI)-induced senescence, we confirmed that PI3K/AKT inhibition is associated with Cr(VI)-induced senescence. Cr(VI)-induced premature senescent cells showed high expression of CLU, and we demonstrated that CLU over-expression significantly increased cell proliferation while CLU knockdown induced significant cell growth inhibition. Our results revealed that CLU protected Cr(VI)-exposed cells from being senescent, indicating that high expression of CLU in senescent cells played a role in counteracting senescence though possible mechanisms. CLU, which is ubiquitously expressed in different tissues, could regulate cell survival, proliferation, and various stress responses (Rohne et al., 2015). CLU has two subtypes, namely nuclear CLU (nCLU) and secretory CLU (sCLU). It is confirmed that sCLU is the predominant form of CLU under physiological condition, and CLU in the present research referred to sCLU. As yet we have not found any reports about the molecular mechanism of CLU in premature senescence. Although CLU is well known for its anti-apoptotic function, senescence and apoptosis are two different concepts, thus CLU is unlikely to play an anti-apoptotic role in Cr (VI)-induced premature senescent hepatocytes. Due to the stagnation of division and proliferation of
senescent cells, we speculated that the mechanism of CLU inhibiting premature senescence may be related to PI3K/AKT signaling. PTEN protein has been proved to be a negative regulator of PI3K/AKT pathway (Xu et al., 2018), and the possible regulatory effect of CLU on AKT has never been studied in premature senescence. Evidence suggested CLU could activate AKT by interacting with EIF3I, resulting in increased MMP13 expression and hepatocellular carcinoma metastasis. In our present study, we established interactome of CLU in Cr(VI)-induced premature senescent hepatocytes. Co-IP and immunofluorescence assays confirmed that CLU was physically interacted with EIF3I. Furthermore, we also demonstrated that CLU overexpression was accompanied with up-regulated EIF3I protein level, but not with EIF3I mRNA level in Cr(VI)-induced senescent cells, suggesting that CLU could protect EIF3I from degradation. We also revealed that phosphorylation of AKT was significantly inhibited when EIF3I was silenced. It is known that EIF3I interacts with AKT and inhibits protein phosphatase 2A (PP2A)-mediated dephosphorylation, leading to AKT activation (Wang et al., 2013). Therefore, we believe that CLU interacts with EIF3I and prevent its degradation, then resulting in AKT activation in Cr (VI)-induced senescent hepatocytes. We also revealed that blockage of PI3K/AKT pathway with its inhibitor LY294002 eliminated the inhibitory effect of CLU on premature senescence, confirming that 8
Ecotoxicology and Environmental Safety 183 (2019) 109465
Y. Zhang, et al.
Fig. 6. CLU inhibited senescence through activation of PI3K/AKT pathway. CLU OE cells and CLU OE cells pre-treated with LY294002 (20 μM, 2 h) were incubated with 10 nM Cr(VI) twice a week for 24 h for 4 weeks. (A) Proteins expressions of AKT signaling (PI3K, p-AKT (ser-473), and AKT) were determined using western blotting. (B) SA-β-Gal staining for the detection of SA-β-Gal activity. (C) Cell cycle analysis of the hepatocytes. (D) The proteins expressions of senescence pathways (p53, p21, and PTEN) and the senescence biomarkers (FN1, CTGF, and SMP30) were determined using western blotting. *p < 0.05, compared to the respective control. #p < 0.05, compared to the groups without LY294002 exposure.
CLU inhibits senescence through activation of PI3K/AKT pathway. Senescence is known to be the barrier of tumorigenesis. The cells escaping from premature senescence have the tendency of malignant transformation, thus overcoming senescence state is an important step for the growth and immortality of cancer cells. CLU expression was significantly increased in Cr (VI)-induced senescent hepatocytes, and it is known that CLU was closely related to the occurrence, development and malignant proliferation of primary liver cancer. If CLU played an inhibitory role in Cr(VI)-induced hepatocytes premature senescence, activation of PI3K/AKT pathway caused by CLU will play a positive role in Cr (VI)-induced malignant transformation. Although in an inactive state, senescent cells are still metabolically and physiologically alive, and they could secret various factors which may alter the intracellular and surrounding microenvironment. These factors include numerous pro-inflammatory growth factors, chemokines, cytokines, as well as proteases, a feature termed SASP, which has powerful paracrine activities. SASP can be either beneficial or harmful because it plays the dual role of suppressing cancer development and promoting the repair of injured tissue (Campisi, 2013). The present study revealed that Cr (VI) increased the secretion levels of IL-1, IL-6, and MMP3 in the senescent cells. It is confirmed that MMP3, the extracellular matrix modifying enzyme, could disrupt normal tissue structure and drive invasive properties along with factors such as IL-1, IL-6, and IL-8 (Jiang et al., 2015b). Based on the previous finding of our group, short-term high-dose Cr (VI) exposure causes apoptosis, while long-term low-dose exposure triggers premature senescence. Since population exposure to Cr (VI) and its compounds is mostly in the long-term low-dose manner, the
present study will guide the research focus of Cr (VI)-induced cytotoxicity to premature senescence that has more practical significance, and will further elucidate the mechanism of hepatotoxicity caused by Cr (VI). This study for the first time explained why CLU was highly expressed in both premature senescence and malignant transformation, which are two distinct cytotoxic outcomes. In addition, previous studies have confirmed that overcoming premature senescence is the key step in the occurrence and development of malignant tumors, the cells escaping from premature senescence after the induction of carcinogenic factors (such as Cr(VI)) have the tendency of malignant transformation, and high expression of CLU is likely to help these “escapers” to undergo further tumorgenesis. Since the occurrence of primary liver cancer after Cr (VI) exposure is a multi-gene, multi-factor, and multi-step process, the study on the mechanism of CLU in premature senescence will provide the experimental basis for the research of Cr (VI)-induced liver cancer, especially for the elucidation of the mechanism of liver cancer cells escaping from senescence, and will also provide new ideas and strategies for the targeted therapy of hepatocellular carcinoma caused by chromium and other environmental toxicants. Conflicts of interest The authors have no conflicts of interest to declare. Acknowledgements We thank all of the individuals in this laboratory for their valuable suggestions. The current work was supported by National Natural 9
Ecotoxicology and Environmental Safety 183 (2019) 109465
Y. Zhang, et al.
Science Foundation of China (NO. 81773478) and Natural Science Foundation of Hunan Province, China (NO. 2019JJ40402).
of its chains show opposing effects on cellular lipid accumulation. Sci. Rep. 7 4123541235. Muñoz-Espín, D., Serrano, M., 2014. Cellular senescence: from physiology to pathology. Nat. Rev. Mol. Cell Biol. 15, 482–496. PA, P., AR, Y., M.,N., 2014. Inside and out: the activities of senescence in cancer. Nat. Rev. Cancer 14, 547–558. Pan, C.-H., Jeng, H.A., Lai, C.-H., 2017. Biomarkers of oxidative stress in electroplating workers exposed to hexavalent chromium. J. Expo. Sci. Environ. Epidemiol. 28, 76. Qi, L., Zhang, Y., Ming, Z., Lan, G., Xiao, Y., Fang, X.J.T.R., 2018. The role of IP3R-SOCCs in Cr(VI)-induced cytosolic Ca2+ overload and apoptosis. In: L-02 Hepatocytes, vol. 7. Rayess, H., Wang, M.B., Srivatsan, E.S., 2012. Cellular senescence and tumor suppressor gene p16. Int. J. Cancer 130, 1715–1725. Rodier, F., Campisi, J., 2011. Four faces of cellular senescence. JCB (J. Cell Biol.) 192, 547–556. Rohne, P., Prochnow, H., Koch-Brandt, C., 2015. The CLU-files: disentanglement of a mystery. Biomol. Concepts 7, 1–15. Sahin, E., Depinho, R.A., 2015. Linking functional decline of telomeres, mitochondria and stem cells during ageing. Nature 464, 520–528. Thill, M., Berna, M.J., Kunst, F., Wege, H., Strunnikova, N.V., Gordiyenko, N., Grierson, R., Richard, G., Csaky, K.G., 2011. SU5416 induces premature senescence in endothelial progenitor cells from patients with age-related macular degeneration. Mol. Vis. 17, 85. Vargas, A., Kim, H.S., Baral, E., Yu, W.-Q., Craft, C.M., Lee, E.-J., 2017. Protective effect of clusterin on rod photoreceptor in rat model of retinitis pigmentosa. PLoS One 12 e0182389-e0182389. Vishnu, V.Y., Modi, M., Sharma, S., Mohanty, M., Goyal, M.K., Lal, V., Khandelwal, N., Mittal, B.R., Prabhakar, S., 2016. Role of plasma clusterin in alzheimer's disease-A pilot study in a tertiary hospital in northern India. PLoS One 11 e0166369-e0166369. Wang, C., Jin, G., Jin, H., Wang, N., Luo, Q., Zhang, Y., Gao, D., Jiang, K., Gu, D., Shen, Q., 2015. Clusterin facilitates metastasis by EIF3I/Akt/MMP13 signaling in hepatocellular carcinoma. Oncotarget 6, 2903–2916. Wang, R., Yu, Z., Sunchu, B., Shoaf, J., Dang, I., Zhao, S., Caples, K., Bradley, L., Beaver, L.M., Ho, E., Löhr, C.V., Perez, V.I., 2017. Rapamycin inhibits the secretory phenotype of senescent cells by a Nrf2-independent mechanism. Aging Cell 16, 564–574. Wang, Y., Su, H., Song, X., Fiati Kenston, S.S., Zhao, J., Gu, Y., 2018. Luteolin inhibits multi-heavy metal mixture-induced HL7702 cell apoptosis through downregulation of ROS-activated mitochondrial pathway. Int. J. Mol. Med. 41, 233–241. Wang, Y.W., Lin, K.T., Chen, S.C., Gu, D.L., Chen, C.F., Tu, P.H., Jou, Y.S., 2013. Overexpressed-eIF3I interacted and activated oncogenic Akt1 is a theranostic target in human hepatocellular carcinoma. Hepatology 58, 239–250. Xiao, Y., Zeng, M., Yin, L., Li, N., Xiao, F., 2019. Clusterin increases mitochondrial respiratory chain complex I activity and protects against hexavalent chromium-induced cytotoxicity in L-02 hepatocytes. Toxicol Res (Camb). 8, 15–24. Xiu, P., Dong, X.-F., Li, X.-P., Li, J., 2015. Clusterin: review of research progress and looking ahead to direction in hepatocellular carcinoma. World J. Gastroenterol. 21, 8262–8270. Xu, M., Chen, X., Han, Y., Ma, C., Ma, L., Li, S., 2015. Clusterin silencing sensitizes pancreatic cancer MIA-PaCa-2 cells to gmcitabine via regulation of NF-kB/Bcl-2 signaling. Int. J. Clin. Exp. Med. 8, 12476–12486. Xu, W., Yang, Z., Xie, C., Zhu, Y., Shu, X., Zhang, Z., Li, N., Chai, N., Zhang, S., Wu, K., Nie, Y., Lu, N., 2018. PTEN lipid phosphatase inactivation links the hippo and PI3K/ Akt pathways to induce gastric tumorigenesis. J. Exp. Clin. Cancer Res. : CR (Clim. Res.) 37 198-198. Zhang, Y., Zhang, Y., Zhong, C., Fang, X., 2016. Cr(VI) induces premature senescence through ROS-mediated p53 pathway in L-02 hepatocytes. Sci. Rep. 6, 34578. Zou, Y., Li, Q., Jiang, L., Guo, C., Li, Y., Yu, Y., Li, Y., Duan, J., Sun, Z., 2016. DNA hypermethylation of CREB3L1 and Bcl-2 associated with the mitochondrial-mediated apoptosis via PI3K/akt pathway in human BEAS-2B cells exposure to silica nanoparticles. PLoS One 11 e0158475-e0158475.
References Abreu, P.L., Cunha-Oliveira, T., Ferreira, L.M.R., Urbano, A.M., 2018. Hexavalent chromium, a lung carcinogen, confers resistance to thermal stress and interferes with heat shock protein expression in human bronchial epithelial cells. Biometals 31, 477–487. Ammar, H., Closset, J., 2008. Clusterin activates survival through the phosphatidylinositol 3-kinase/Akt pathway. J. Biol. Chem. 283, 12851–12861. Bernardes de Jesus, B., Blasco, M.A., 2012. Assessing cell and organ senescence biomarkers. Circ. Res. 111, 97–109. Bononi, A., Agnoletto, C., De, M.E., Marchi, S., Patergnani, S., Bonora, M., Giorgi, C., Missiroli, S., Poletti, F., Rimessi, A., 2011. Protein kinases and phosphatases in the control of cell fate. Enzym. Res. 2011, 329098. Campisi, J., 2013. Aging, cellular senescence, and cancer. Annu. Rev. Physiol. 75, 685–705. Chen, D., Xia, D., Pan, Z., Xu, D., Zhou, Y., Wu, Y., Cai, N., Tang, Q., Wang, C., Yan, M., Zhang, J.J., Zhou, K., Wang, Q., Feng, Y., Wang, X., Xu, H., Zhang, X., Tian, N., 2016. Metformin protects against apoptosis and senescence in nucleus pulposus cells and ameliorates disc degeneration in vivo. Cell Death Dis. 7 e2441-e2441. Chikara, S., Lindsey, K., Dhillon, H., Mamidi, S., Kittilson, J., Christofidou-Solomidou, M., Reindl, K.M., 2017. Enterolactone induces G(1)-phase cell cycle arrest in nonsmall cell lung cancer cells by downregulating cyclins and cyclin-dependent kinases. Nutr. Cancer 69, 652–662. Hayflick, L., 1965. The limited in vitro lifetime of human diploid cell strains. Exp. Cell Res. 37, 614–636. Jiang, L., Wang, C., Lei, F., Zhang, L., Zhang, X., Liu, A., Wu, G., Zhu, J., Song, L., 2015a. miR-93 promotes cell proliferation in gliomas through activation of PI3K/Akt signaling pathway. Oncotarget 6, 8286–8299. Jiang, Y.N., Yan, H.Q., Huang, X.B., Wang, Y.N., Li, Q., Gao, F.G., 2015b. Interleukin 6 trigged ataxia-telangiectasia mutated activation facilitates lung cancer metastasis via MMP-3/MMP-13 up-regulation. Oncotarget 6, 40719–40733. Joo, K.J., 2011. Role of clusterin and tumor necrosis factor receptors on the apoptosis of prostate cancer cells. Microbiol. Immunol. 29, 43. Kohsaka, S., Sasai, K., Takahashi, K., Akagi, T., Tanino, M., Kimura, T., Nishihara, H., Tanaka, S., 2011. A population of BJ fibroblasts escaped from Ras-induced senescence susceptible to transformation. Biochem. Biophys. Res. Commun. 410, 878–884. Li, J., Yu, L., Zhao, Y., Fu, G., Zhou, B., 2013. Thymosin Î24 reduces senescence of endothelial progenitor cells via the PI3K/Akt/eNOS signal transduction pathway. Mol. Med. Rep. 7, 598–602. Linos, A., Petralias, A., Christophi, C.A., Christoforidou, E., Kouroutou, P., Stoltidis, M., Veloudaki, A., Tzala, E., Makris, K.C., Karagas, M.R., 2011. Oral ingestion of hexavalent chromium through drinking water and cancer mortality in an industrial area of Greece - an ecological study. Environ. Health 10. Lukin, D.J., Carvajal, L.A., Liu, W.-j., Resnick-Silverman, L., Manfredi, J.J., 2015. p53 Promotes cell survival due to the reversibility of its cell-cycle checkpoints. Mol. Cancer Res. : MCR 13, 16–28. Luo, X., Suzuki, M., Ghandhi, S.A., Amundson, S.A., Boothman, D.A., 2014a. ATM regulates insulin-like growth factor 1-secretory clusterin (IGF-1-sCLU) expression that protects cells against senescence. PLoS One 9 e99983-e99983. Luo, X., Suzuki, M., Ghandhi, S.A., Amundson, S.A., Boothman, D.A., 2014b. ATM regulates insulin-like growth factor 1-secretory clusterin (IGF-1-sCLU) expression that protects cells against senescence. PLoS One 9, e99983. Ma, J., Sawai, H., Matsuo, Y., Ochi, N., Yasuda, A., Takahashi, H., Wakasugi, T., Funahashi, H., Sato, M., Takeyama, H., 2010. IGF-1 mediates PTEN suppression and enhances cell invasion and proliferation via activation of the IGF-1/PI3K/Akt signaling pathway in pancreatic cancer cells. J. Surg. Res. 160, 90–101. Matukumalli, S.R., Tangirala, R., Rao, C.M., 2017. Clusterin: full-length protein and one
10