- Email: [email protected]
Expression of common carp growth hormone in the yeast Pichia pastoris and growth stimulation of juvenile tilapia (Oreochromis niloticus)
Aquaculture 216 (2003) 329 – 341 www.elsevier.com/locate/aqua-online
Expression of common carp growth hormone in the yeast Pichia pastoris and growth stimulation of juvenile tilapia (Oreochromis niloticus) Yinghua Li a,b, Junjie Bai a,*, Qing Jian a, Xing Ye a, Haihua Lao a, Xinhui Li a, Jianren Luo a, Xufang Liang b a
Pearl River Fisheries Research Institute, CAFS Key Laboratory of Tropical and Subtropical Fish Breeding and Cultivation, Ministry of Agriculture P.R.C., Guangzhou 510380, PR China b Department of Biotechnology, College of Life Science and Technology, Jinan University, Guangzhou 510632, PR China Received 23 January 2002; received in revised form 20 June 2002; accepted 7 August 2002
Abstract The cDNA encoding mature growth hormone (GH) was cloned from the pituitary of common carp (Cyprinus carpio) by RT-PCR. To construct the expression plasmid, the GH cDNA was inserted into the pUC18 plasmid and subsequently subcloned into vector pPICZaA, which contains the promotor from the alcohol oxidase (AOX1) gene and the a-factor signal peptide sequence. The yeast Pichia pastoris GS115 strain was transformed with the expression plasmid. Transgene expression was observed after screening of the transformants with Zeocink. Results showed that, with methanol induction, recombinant carp GH (rcGH) had been expressed and exported into the culture medium. The production peaked at 72 h of induction and the optimal pH for expression was 6.0. The yield was 300 – 400 mg l 1 in shaking-flask fermentation medium, accounting for 34.61% of the total supernatant secreted proteins. rcGH was separated through anion-exchange chromatography. The growth rate of juvenile tilapia (Oreochromis niloticus) injected with purified rcGH, was found to be 24.5% and 53.1% higher than the control at the dose of 0.10 and 1 Ag g 1 body weight week 1 respectively ( P<0.001), while the chemical composition of muscle was not affected significantly by the rcGH treatment. The available production of a large quantity of purified rcGH from this work will strengthen the functional study of rcGH for both theoretical and practical purposes. D 2003 Published by Elsevier Science B.V. Keywords: Common carp (Cyprinus carpio); GH cDNA; Pichia pastoris; Secreted expression; Purification; Growth; Tilapia
*
Corresponding author. Tel.: +86-20-81616127; fax: +86-20-81616162. E-mail address: [email protected] (J. Bai).
0044-8486/03/$ - see front matter D 2003 Published by Elsevier Science B.V. PII: S 0 0 4 4 - 8 4 8 6 ( 0 2 ) 0 0 4 0 6 - 4
330
Y. Li et al. / Aquaculture 216 (2003) 329–341
1. Introduction Fish growth hormone (GH) is a polypeptide hormone produced by the anterior pituitary cells which is involved in the regulation of growth, development, metabolism, appetite, and osmoregulation in fish (Donaldson et al., 1979; Gill et al., 1985; Agellon et al., 1988; Zohar, 1989; Tsai et al., 1993a,b; Farmanfarmaian and Sun, 1999; Silverstein et al., 2000). It has been widely used to study fish endocrinology, feed intake and efficiency, nutritional composition, and growth. However, the amount of native GH is extremely low and its availability is limited, so it is difficult to establish some useful methods, such as radioimmunoassay (RIA), radio receptor assay (RRA) and enzyme-linked immunosorbent assay (ELISA) to investigate fish growth physiology. Recombinant fish GH, which has been demonstrated to have the same function as native GH, can be employed instead of the native GH to study fish physiology. Previously, a number of cDNAs of fish GH have been cloned and expressed in Escherichia coli (Sekine et al., 1985; Agellon and Chen, 1986; Saito et al., 1988; Ho et al., 1991; Tsai et al., 1993a,b; Bai et al., 1999; Ayson et al., 2000). Recombinant GH expressed in E. coli has played an important role in basic research of fish physiology and in its applications in aquaculture. However, E. coli is a prokaryote and its intrinsic characteristics differ from those of eukaryotes, such as protein processing, protein folding, and posttranslational modification. The low capacity of post-translation process in E. coli resulted in less active recombinant proteins and formation of insoluble inclusion bodies (De Bernardez Clark, 1998). With the development of eukaryotic expression systems, several fish GHs have been expressed in the yeast Saccharomyces cerevisiae (Hayami, 1989; Tsai et al., 1993a,b, 1994; Bai et al., 1999; Ma et al., 1999; Wang et al., 2000) and the yeast Pichia pastoris (Chen et al., 1998). The P. pastoris expression system offers advantages over S. cerevisiae in its high productivity, efficient secreted expression and stable genetics, so it has been an attractive candidate for production of foreign proteins (Romanos et al., 1993; Romanos, 1995; Geoffry and James, 1975). We have investigated the intracellular expression of carp GH in P. pastoris. The engineered P. pastoris strain used as food supplement showed significant growth-promoting effects on tilapia (Li et al., 2001), but the production of rcGH was low (1– 2% of the total cell proteins), making the downstream purification of rcGH difficult. P. pastoris has a higher secretory capacity and low levels of endogenous proteins than other yeasts, and the secreted recombinant protein comprises the majority of the total protein in the medium, which facilitates the downstream purification of the interested protein (Barr et al., 1992). Hence, we constructed an engineered strain of P. pastoris, which expresses and secretes carp GH. The purified rcGH was found able to significantly promote body weight growth of tilapia (Oreochromis niloticus).
2. Materials and methods 2.1. Preparation of total RNA and RT-PCR Common carp (Cyprinus carpio) was chosen from the farm of the Pearl River Fisheries Research Institute (PRFRI). Carp pituitary was dissected and immediately
Y. Li et al. / Aquaculture 216 (2003) 329–341
331
homogenized in the medium provided by the RNA isolation kit used. Total RNA was extracted using High Pure RNA Isolation Kit (Boehringer Mannheim), and used for RTPCR according to the Titank One Tube RT-PCR System (Boehringer Mannheim). A forward primer (FP1: 5V CGGAATTCGACAACCAGCGGCTGT 3V) and a reverse primer (RP1: 5V CGCGGATCCTTACTACAGGGTGCAGTTG 3V) were designed to synthesize the cDNA encoding the mature region of the carp GH, based on sequence reported by Koren et al. (1989). The cDNA obtained from RT-PCR was modified by introducing an EcoRI site at the 5Vend, a BamHI site and a TAA stop codon at the 3V end. PCR was performed with 35 cycles as follows: 30 s of denaturation at 94 jC, 30 s of annealing at 50 jC, and 45 s of extension at 68 jC, and then further incubation for 7 min at 72 jC. 2.2. Construction of plasmid pUC18/cGH The PCR products were electrophoresed through a 0.8% agarose gel, purified with the Wizard PCR DNA Purification System (Promega), and digested with both EcoRI and BamHI. The digested cDNA was inserted into pUC18, that was digested with the same restriction enzymes. E. coli DH5a was transformed with the ligation product according to Hanahan (1985). Luria-Bertani (LB) agar plates (1% tryptone, 0.5% yeast extract, 1% NaCl, pH 7.0) containing 100 Ag/ml ampicillin was used to screen the recombinant colonies. Plasmids from recombinant colonies were prepared using the Plasmid Minipreps Kit (Sangon, Shanghai). Insertion of the PCR product was verified by restriction enzyme digestion, agarose gel electrophoresis and sequencing. The cDNA sequence and deduced amino acid sequence were compared with the carp GH in the GenBank database. 2.3. Construction of expression plasmid pPICZaA/cGH A second reverse primer (RP2: 5VCGGAATTCTTACTACAGAGTGCAGT 3V) was designed, which was highly similar to RP1 except for the EcoRI site to replace the BamHI site, to subclone the cGH cDNA into the EcoRI site of pPICZaA, which provided a Zeocink-resistant gene for both selection in E. coli and in P. pastoris. Upon PCR using primers FP1 and RP2, the cDNA fragment was modified from pUC18/cGH to introduce two EcoRI sites at both ends. PCR program was as follows: 35 cycles; 30 s of denaturation at 94 jC, 30 s of annealing at 50 jC, and 45 s of extension at 72 jC, and finally incubation for 7 min at 72 jC. The products were electrophoresed through a 0.8% low melting point agarose gel. After extraction from the gel with the Agarose Gel DNA Extraction kit (Boehringer Mannheim) and digestion with EcoRI, the PCR product was ligated to the P. pastoris shuttle expression vector pPICZaA, which was also digested with EcoRI and then dephosphorylated by calf intestinal alkaline phosphatase (CIP). E. coli Top 10 (Invitrogen) strain was transformed, and low salt LB medium plates (same as LB except for a concentration of 0.5% NaCl instead of 1% NaCl) containing 25 Ag ml 1 Zeocink (Invitrogen) were used to screen transformants. The plasmids with the cGH fragment were selected by EcoRI digestion. The inserted fragment was oriented by PCR with 5V AOX1 Pichia Primer (Invitrogen) and RP2 primer. With a-factor Pichia Primer (Invi-
332
Y. Li et al. / Aquaculture 216 (2003) 329–341
trogen), the sequencing result confirmed that the cGH cDNA had been cloned in frame with the a-factor signal peptide sequence. 2.4. Transformation of P. pastoris and screening for Mut+ phenotype The recombinant plasmid pPICZaA/cGH and pPICZaA parent plasmid were digested with DraI, the restriction site for which is located within the 5VAOX1 region of pPICZaA. The competent P. pastoris strain GS115 was transformed with 2– 5 Ag linear plasmid by electroporation as described by Cregg et al. (1985). Pulse of the mixture of competent cells and linear plasmid was according to the parameters for yeast (1.0 kv, 25 AF, and 200 V) suggested by the manufacturer of the electroporator (GenPulser, BioRad). Transformants were selected for Zeocink resistance onto YPD (1% yeast extract, 2% peptone, 2% dextrose) agar plates containing 100 Ag/ml Zeocink. Transformants were streaked onto both YPM (same as YPD medium but containing 0.5% methanol instead of dextrose) and YPD agar medium to screen for methanol utilization plus (Mut+) and methanol utilization slow (Muts) phenotypes. 2.5. Secreted expression of rcGH in P. pastoris 2.5.1. Selection of high expression yeast clone To select the most productive clone, 16 Mut+ yeast clones were inoculated in 25 ml of buffered liquid BMGY medium (1% yeast extract; 2% peptone; 100 mM potassium phosphate, pH 6.0; 1.34% yeast nitrogen base; 410 5% biotin; 1% glycerol) and grown at 30 jC in a shaking incubator until the culture’s OD600 reached 8 –10 (about 28– 32 h). Cells were harvested by centrifugation at 5000 rpm for 5 min at room temperature and gently resuspended in 25 ml of buffered liquid BMMY medium (same as BMMY but containing 0.5% methanol instead of 1% glycerol) to induce the AOX1 promoter. Absolute methanol was added every 24 h to a final concentration of 0.5% (V/V) to maintain induction for 72 h. The supernatant was analyzed by SDS-PAGE. Western blotting was performed using rabbit anti-carp GH antiserum as described by Sambrook et al. (1989). 2.5.2. Effect of pH and induction duration on expression GS115 (pPICZaA/cGH) was cultured to mid-log-phase in 25 ml liquid BMGY media, then centrifuged and the cell pellet resuspended in liquid BMMY media, which were already adjusted to pH 4.5, 5.5, 6.0 and 6.5 with phosphoric acid or KOH. Expression of the transgene in the culture was induced as described previously. The culture was sampled at 72-h post-induction and then analyzed with SDS-PAGE. A time course study of expression also was performed in order to determine the time point when the production of recombinant protein was highest. The culture was sampled at 24-, 48-, 72- and 96-h postinduction and analyzed with SDS-PAGE. The strongest density protein lane was scanned with Tiger Gel Image Analysis System (Chongqing University, Chongqing, China) to calculate the percentage of rcGH in the total supernatant proteins. Production of rcGH was visually estimated with band intensity against the standard Low Molecular Weight Protein Marker.
Y. Li et al. / Aquaculture 216 (2003) 329–341
333
2.5.3. Protein purification Secreted rcGH from P. pichia was purified through anion-exchange chromatography on a preparative column Q-Sephrose (AKTA prime system, Amersham Pharmacia). After centrifugation, the culture supernatant was equilibrated to adjust both its ionic strength and pH and then was loaded on the column balanced with buffer A (50 mmol l 1 Tris – Cl, pH 9.0). Unbound proteins were eluted with buffer A from the loaded column, followed by stepwise elution with buffer A and buffer B (buffer A+1 mol l 1 NaCl). The elution fraction was collected and examined on SDS-PAGE. The purified rcGH was lyophilized and then stored at 4 jC. 2.6. Assay the biological activity of rcGH 2.6.1. Growth-promoting effect Sixty tilapia (O. niloticus) fingerlings (17.13F0.56 g, 8.08F0.12 cm BL) were selected from the PRFRI farm and then randomly distributed into three tanks (806050-cm tanks, n=20/tank) supplied with continuous flowing water. The fish were fed to satiation with eel feed once daily, and acclimated for 1 week before hormone treatment. Purified rcGH powder was dissolved in 0.7% sterile saline (pH 9.5). The hormone was delivered weekly by intraperitoneal (i.p.) injection in a volume of 0.1 ml at the dose of 0.1 Ag g 1 body weight week 1 for one test group and 1 Ag g 1 body weight week 1 for the other. The dosage was selected based on the data provided by previous research (Agellon et al., 1988; Silverstein et al., 2000). The control group was injected with sterile saline only. Body weight of each fish was measured weekly. T-test was performed to determine the significance of any difference between means of test and control groups. 2.6.2. Compositional analysis in muscle Muscle compositional analysis was slightly modified from that of Rasmussen et al. (2001) and Silverstein et al. (2000). At the end of the test, four fish (29.21F0.43 g, 10.19F0.21 cm) from group 2 and from the control group were chosen, anaesthetized with 0.005% benzocaine (Sigma), and then individually weighted. Each fish was skinned and gutted. The fillet of each fish carcass from the same group was mixed and homogenized. A 5-g fillet from each sample was used for protein and moisture analysis and 30 g for ash and lipid analyses. Moisture, ash and protein (Kjeldahl-N) content were determined according to AOAC (1984). Lipid extraction and quantification were carried out using the chloroform methanol extraction method (Blign and Dyer, 1959). The determinations were made in duplicate and then averaged.
3. Results 3.1. Cloning of cDNA for cGH mature peptide and construction of pUC18/cGH PCR products were electrophrosed on the agarose gel and the targeted DNA fragment, approximately 580 bp, was excised from the gel and cloned into pUC18 to construct pUC18/cGH. The recombinant plasmid was confirmed by releasing 580 bp DNA fragment
334
Y. Li et al. / Aquaculture 216 (2003) 329–341
after EcoRI and BamHI digestion. Sequencing the pUC18/cGH showed that the cloned cDNA is almost identical to the previous report except for two nucleotides, but the predicted amino acid sequence from cDNA is exactly the same as the previous report (Koren et al., 1989). The sequence we cloned in this paper had been submitted to GenBank; the accession number is AF 332594. 3.2. Construction of expression plasmid pPICZaA/cGH The PCR products amplified with FP1 and RP2 were approximately 580 bp (Fig. 1, lane 3). After EcoRI digestion, purification and ligation to pPICZaA, the construct was used to transform the E. coli Top 10. The plasmid extracted from Zeocink-resistant transformants was digested with EcoRI and a 580 bp fragment was obtained as expected (Fig. 1, lane 2). The approximately 930 bp PCR products (Fig. 1, lane 4) amplified with the 5VAOX1 Primer and RP2 primer, including 580 bp GH cDNA and 353 bp nucleotides from the native vector, indicted that the insertion direction was correct. This expression plasmid was designated pPICZaA/cGH. Sequencing showed that the open reading frame of cGH cDNA was completely in frame with that of the a-factor signal peptide (data not shown). 3.3. Transformation of P. pastoris and Mut+ phenotype selection After transformation, about 100 Zeocink-resistant colonies appeared. Fifty colonies were picked to verify the Mut+ phenotype. Forty-eight colonies were Mut+ because they
Fig. 1. PCR products and construction of expression plasmid M1, M2: DNA marker. Lane 1: Restriction digestion of vector pPICZaA with EcoRI. Lane 2: Restriction digestion of plasmid pPICZaA/cGH with EcoRI. Lane 3: PCR products amplified with forward primer 1 and reverse primer 2. Lane 4: PCR products amplified with 5V AOX1 primer and reverse primer 2.
Y. Li et al. / Aquaculture 216 (2003) 329–341
335
grew well on both YPM and YPD agar plates, indicating that they can produce alcohol oxidase to metabolize methanol so that they are able to grow on medium with methanol as the sole carbon source. The other two colonies are Muts because they grew well on YPD plate, but slowly on YPM plate. Mut+ clones were chosen for the subsequent expression study. 3.4. Selection of high expression strain and western blotting Upon induction by methanol, 13 of the 16 clones secreted a specific 22-kDa protein with the same size as the standard carp GH. This protein band was absent in the other three clones and in the control transformant with the parent vector (data not shown). The productivity varied among the 13 clones. The clone showing the highest production of rcGH was named GS115 (pPICZaA/cGH) and selected for further analysis. Western blotting analysis showed that the 22-kDa protein band of GS115 (pPICZaA/GH) reacted specifically with the rabbit anti-carp GH antiserum (Fig. 2). The growth curve of GS115 (pPICZaA/GH) in 52-h culture period was drawn to choose the right time point to initiate induction. The cells grew very slowly within first 8 h and then the growth rate sped up to log-phase growth. At 32 h, the growth reached the stationary phase, with the OD600 as high as 11. After 40 h, growth rate began to decrease slowly. 3.5. Effects of pH and induction course on rcGH productivity GS115 (pPICZaA/cGH) was used to analyse expression levels of rcGH at pH 4.5, 5.5, 6.0 and 6.5. Upon induction with 0.5% methanol for 3 days, the culture supernatant at each pH was analyzed by SDS-PAGE. Results are shown in Fig. 3, which indicated that pH significantly affected the production of rcGH. At pH 4.5, almost no rcGH could be
Fig. 2. Western Blotting with the rabbit anti-common carp GH antiserum as probe. Lane 1: Supernatant sample from control yeast strain Gs115 (pPICZaA). Lane 2: Supernatant sample from engineered yeast strain Gs115 (pPICZaA/cGH).
336
Y. Li et al. / Aquaculture 216 (2003) 329–341
Fig. 3. Expression of rcGH in P. pastoris at pH 4.5, 5.5, 6.0 and 6.5 M: Low Molecular Weight Protein Marker. (1) Standard cGH. (2) GS115 (pPICZaA). (3 – 6) Expression at pH 6.5, 6.0, 5.5, and 4.5, respectively.
detected, and the optimal pH for rcGh expression was 6.0. The expression levels at 24, 48, 72 and 96 h of induction were quantified to choose the most suitable time to harvest the cells. SDS-PAGE (Fig. 4) showed that rcGH had been expressed after 24-h induction, peaked at 72 h, and followed by a weak decrease at 96 h. The scanning result showed that the secreted rcGH protein band (in lane 4 of Fig. 4) accounted for 34.61% of the total supernatant proteins (data not shown). By comparison with the standard protein markers, the estimated product of rcGH was 300– 400 mg l 1.
Fig. 4. Expressions of rcGH at 24-, 48-, 72-, 96-h post induction M: Low Molecular Weight Protein Marker. (1) Standard cGH. (2) GS115 (pPICZaA). (3 – 6) rcGH expressed at 96-, 72-, 48-, 24-h post-induction. (7) Purified rcGH.
Y. Li et al. / Aquaculture 216 (2003) 329–341
337
Fig. 5. Elution curve of anion exchange chromatography, the rcGH was eluted at the third peak, where the concentration of NaCl was 0.25 M.
3.6. Purification of rcGH By stepwise elution with NaCl and SDS-PAGE detection, the rcGH was eluted at the third peak (Fig. 5), where the concentration of NaCl was 0.25 M. This elution condition
Fig. 6. The growth-promoting effect of rcGH injection on tilapia, the weights of rcGH-treated and control fish are shown in meanFS.E. Ctrl, Group 1, Group 2. *Indicate p<0.05, **Indicate p<0.01.
338
Y. Li et al. / Aquaculture 216 (2003) 329–341
Table 1 Chemical composition of muscle in control and GH-treated fish Composition
PercentFS.E. (n=4) Control
GH-treated
Protein Moisture Lipid Ash
21.27F0.9 75.65F1.2 0.99F0.2 1.24F0.5
21.37F0.7 75.58F0.9 1.12F0.3 1.17F0.3
was similar to the previous rcGH purification reported by Fine et al. (1993). In the target fraction, rcGH accounted for 90% of all protein by means of gel image scanning. 3.7. Growth-promoting activity The growth of fish in one control and two GH-injected groups is shown in Fig. 6. Each point represents the average weight of individual fish (meanFS.E.). After 5-week treatment, the growth rates of groups 1 and 2 were 24.5% and 53.1% higher than the salinetreated control group, respectively. Additionally, the effect of GH treatment was significant ( P<0.05) for group 2 by week 2 and for group 1 by week 3 compared to that of control group. The significant difference lasted throughout the experiment. A dose of 0.1 Ag g 1 body weight week 1 was sufficient to stimulate a significant increase of tilapia in weight, but the effect was less powerful than the dose of 1 Ag g 1 body weight week 1. These results revealed that a biologically active rcGH was expressed and secreted in P. pastoris, which showed a significant growth-promoting effect on tilapia. 3.8. Chemical composition analysis The results of muscle composition analysis are listed in Table 1. No significant difference in chemical composition was observed between muscle obtained from treatment fish and that of control. Though not significant ( P>0.05), the content of protein and lipid were slightly higher in group 2, compared with the control group, but the content of moisture and ash trended to decrease. However, it should be mentioned that the small sample sizes might have limited the experimental power of the analysis.
4. Discussion This experiment developed an easy expression system capable of providing biologically active rcGH in large quantity. Production of the rcGH under the control of the alcohol oxidase (AOX1) promotor and its purification were described here. Highly purified rcGH was obtained through anion-exchange chromatography and showed a significant effect on the growth of tilapia body weight. pPICZaA, a recently developed expression vector, provided direct and efficient screening for the recombinant transformants with the Zeocink-resistance gene as a dominant selective marker. Because 100% of the Zeocink-resistant transformants contained the target
Y. Li et al. / Aquaculture 216 (2003) 329–341
339
gene (P. pastoris Expression Manual, Invitrogen), it was unnecessary to detect the integration of target gene, while other P. pastoris vectors using a yeast HIS4 gene as a selectable marker require detection of integration by PCR, and the positive rate is only 15 – 60%. In this study, 13 out of 16 colonies selected directly from the Zeocink-containing plates expressed rcGH. The percentage of the positive transformants was sufficient for selection of a high expression strain. rcGH was present in the culture supernatant with the same molecular weight as the standard carp GH, indicating that the a-factor signal peptide was recognized and processed correctly. The secreted rcGH accounted for 34.6% of all the protein in the culture supernatant by gel scanning of the protein band, which could minimize time-consuming and laborious downstream purification. The amount of rcGH (300 – 400 mg l 1) produced by P. pastoris (pPICZaA/cGH) was higher than that of intracellular expression carp GH in P. pichia in our previous study (200 mg l 1) and that of Lateolabrox japonicus GH by Chen et al. (1998) (100 mg l 1), though it was not as high as that of other recombinant proteins produced in P. pastoris. Expression levels of foreign protein depend not only on the native sequence of cDNA, such as codon bias, but also on other factors, such as copy number, temperature, pH, induction duration, and concentration of inducer (D’Anjou and Daugulis, 2000). In the present study, the induction duration and pH had already been optimized. The expression of rcGH in P. pastoris was time-dependent and the optimal induction duration was between 72 and 96 h. The recombinant expression of rcGH was affected by pH. Optimum production of rcGH in the medium occurred at pH 6.0. The above study was limited to shaking-flask culture, and production could be expected to be about 10 fold higher by high-density fermentation, because P. pastoris is a yeast well suited for fermentation (Cregg et al., 1993). It is evident that future work is necessary to investigate the optimal conditions for rcGH production in large-scale fermentation. Our results demonstrated that weekly injections of rcGH could significantly accelerate the growth of tilapia. The growth stimulation effect was similar to those observed by Tsai et al. (1994) and Wang et al. (2000). In our small samples, the rcGH-treated fish revealed no significant changes of content of protein, lipid, moisture, and ash in muscle. This is in agreement with Agellon et al.’s (1988) study, in which rainbow trout injected with recombinant GH showed no significant changes in muscle composition. Effects of GH treatment, either exogenous (administered) or endogenous (transgenic) on body composition are contentious, especially on lipid (Cook et al., 2000; Silverstein et al., 2000). In our study, the GH-treated tilapia showed a slightly higher percentage of lipid that was undesirable in aquaculture applications. In other researcher’s work (Adelman, 1978; Wilson et al., 1988), fatter fish were also obtained after GH treatment. Further investigation should elucidate the molecular mechanism of GH on muscle composition. The available production of a large quantity of purified rcGH from this work will strengthen the functional study of rcGH for both theoretical and practical purposes.
Acknowledgements The authors are very grateful to Dr. Jeffrey T. Silverstein for his critical review of the manuscript, and to Dr. Yue Zhang for his help during the study. This project was supported
340
Y. Li et al. / Aquaculture 216 (2003) 329–341
by Fishery Science and Technology Ninth Five-Year Key Project of Chinese Ministry of Agriculture (No. 95-B-96-02-02-04) and Chinese Academy of Fishery Sciences Key Project Fund (No. 99-08-02).
References Adelmen, L.R., 1978. Influences of temperature on growth promotion and body composition of carp (Cyprinus carpio) due to bovine growth hormone. Trans. Am. Fish. Soc. 107, 747 – 750. Agellon, L.B., Chen, T.T., 1986. Rainbow trout growth hormone: molecular cloning of cDNA and expression in Escherichia coli. DNA 5, 463 – 471. Agellon, L.B., Emery, C.J., Jones, J.M., Davies, S.L., Dingle, A.D., Chen, T.T., 1988. Promotion of rapid growth of rainbow trout (Salmo gairdneri) by a recombinant fish growth hormone. Can. J. Fish. Aquat. Sci. 45, 146 – 151. AOAC, 1984. Official Methods of Analysis of the Association of Official Analytical Chemists, 14th ed. Association of Official Analytical Chemists, Arlington, VA, 1141 pp. Ayson, F.G., de Jesus, E.G., Amemiya, Y., Moriyama, S., Hirana, T., Kawauchi, H., 2000. Isolation, cDNA cloning and growth promoting activity of rabbitfish (Siganus guttatus) growth hormone. Gen. Comp. Endocrinol. 117, 251 – 259. Bai, J.J., Ma, J., Jian, Q., Li, X.H., Luo, J.R., 1999. Clone of cDNA for common carp GH and its expression in prokaryocyte. Chin. J. Biochem. Mol. Biol. 15, 409 – 412. Barr, K.A., Hopkins, S.A., Sreekrishna, K., 1992. Protocol for efficient secretion of HAS developed from P. pastoris. Pharm. Eng. 12, 48 – 51. Bligh, E.G., Dyer, W.J., 1959. A rapid method of total lipid extraction and purification. Can. J. Biochem. Physiol. 37, 911 – 917. Chen, D., Yang, F., Wang, W., Xu, X., 1998. Intracellular expression of Lateolabrox japonicus growth hormone in methyltrophic yeast, Pichia pastoris. Prog. Biochem. Biophys. 25, 140 – 143. Cook, J.T., McNiven, M.A., Richardson, G.F., Sutterlin, A.M., 2000. Growth rate, body composition and feed digestibility conversion of growth-enhanced transgenic Atlantic salmon (Salmo salar). Aquaculture 188, 15 – 32. Cregg, J.M., Barringer, K.J., Hessler, A.Y., 1985. Pichia pastoris as a host system for transformations. Mol. Cell. Biol. 5, 3376 – 3385. Cregg, J.M., Vedvick, T.S., Raschke, W.C., 1993. Recent advances in the expression of foreign genes in Pichia pastoris. Bio/Technology 11, 905 – 910. D’Anjou, M.C., Daugulis, A.J., 2000. A rational approach to improving productivity in recombinant Pichia pastoris fermentation. Biotechnol. Bioeng. 72, 1 – 11. De Bernardez Clark, E., 1998. Refolding of recombinant proteins. Curr. Opin. Biotechnol. 9, 157 – 163. Donaldson, E.M., Fagerlund, U.H., Higgs, D.A., McBride, J.R., 1979. Hormonal enhancement of growth. Fish Physiol. 8, 455 – 597. Farmanfarmaian, A., Sun, L.Z., 1999. Growth hormone effects on essential amino acid absorption, muscle amino acid profile, N-retention and nutritional requirement of striped bass hybrids. Genet. Anal.: Biomol. Eng. 15, 107 – 113. Fine, M., Sakal, E., Vashdi, D., Daniel, V., Levanon, A., Lipshitz, O., Gertler, A., 1993. Recombinant carp (Cyprinus carpio) growth hormone: expression, purification, and determination of biology activity in vitro and in vivo. Gen. Comp. Endocrinol. 89, 51 – 61. Geoffry, P.C., James, M.C., 1975. Applications of yeast in biotechnology: protein production and genetic analysis. Curr. Opin. Biotechnol. 10, 422 – 427. Gill, J.A., Sumter, E.M., Donaldson, H.M., Dye, H.M., Souza, L.M., Berg, T., Wypych, J., Langley, K., 1985. Recombinant chicken and bovine growth hormone accelerate growth in aquacultured juvenile Pacific Salmon (Oncorhynchus kisutch). Bio/Technology 3, 643 – 646. Hanahan, D., 1985. Techniques for transformation of E. coli. DNA Cloning. IRL Press, Oxford, UK, pp. 109 – 135. Hayami, T., 1989. Production of recombinant tuna growth hormone by a yeast, Saccharomyces cerevisiae. Agric. Biol. Chem. 53, 2917 – 2922.
Y. Li et al. / Aquaculture 216 (2003) 329–341
341
Ho, W.K., Wong, M.W., Chan, A.P., 1991. Cloning and sequencing of the grass carp (Ctenopharyngodon idellus) growth hormone gene. Biochim. Biophys. Acta 1090, 245 – 248. Koren, Y., Sarid, S., Ber, R., Daniel, V., 1989. Carp growth hormone: molecular cloning and sequencing of cDNA. Gene 77, 309 – 315. Li, Y.H., Bai, J.J., Li, X.H., Ye, X., Jian, Q., Luo, J.R., Liang, X.F., 2001. Expression of common carp growth hormone in yeast P. pastoris. Chin. J. Biochem. Mol. Biol. 17, 488 – 491. Ma, J., Bai, J.J., Li, X.H., Luo, J.R., Jian, Q., Zhang, H.J., 1999. Expression of rainbow trout GH cDNA in yeast Saccharomyces cerevisiae. Chin. J. Biotechnol. 15, 219 – 224. Rasmussen, R.S., Ronsholdt, B., Ostenfeld, T.H., McLean, E., Byatt, J.C., 2001. Growth, feed utilization, carcass composition and sensory characteristics of rainbow trout treated with recombinant bovine placental lactogen and growth hormone. Aquaculture 195, 367 – 384. Romanos, M., 1995. Advances in the use of Pichia pastoris for high-level gene expression. Curr. Opin. Biotechnol. 6, 527 – 533. Romanos, M.A., Scorer, C.A., Clare, J.J., 1993. Recent advances in the expression of foreign genes in Pichia pastoris. Biotech 11, 905 – 910. Saito, A., Sekine, S., Komatsu, Y., Sato, M., Hirano, T., Itoh, S., 1988. Molecular cloning of eel growth hormone cDNA and its expression in Escherichia coli. Gene 73, 545 – 551. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sekine, S.T., Mizukami, T., Nishi, Y., Kuwana, A., Saito, M., Sata, S., Kawauchi, H., 1985. Cloning and expression of cDNA for salmon growth hormone in Escherichia coli. Proc. Natl. Acad. Sci. 82, 4306 – 4310. Silverstein, J.T., Wolters, W.R., Shimizu, M., Dickhoff, W.W., 2000. Bovine growth hormone treatment of channel catfish: strain and temperature effects on growth, plasma IGF-I levels, feed intake and efficiency, and body composition. Aquaculture 190, 77 – 88. Tsai, H.J., Lin, K.L., Chen, T.T., 1993. Expression of rainbow trout growth hormone cDNA in yeast. Bull. Inst. Zool. Acad. Sin. 32, 162 – 170. Tsai, H.J., Wei, K.C., Ching, C.C., 1993. Enhancement of tilapia growth by dietary administration of recombinant yeast lysates as a supplement. J. Fish. Soc. Taiwan 20, 339 – 345. Tsai, H.J., Kuo, J.C., Lou, S.W., Chen, T.T., 1994. Growth enhancement of juvenile striped mullet by feeding recombinant yeasts containing fish growth hormone. Prog. Fish-Cult. 56, 7 – 12. Wang, H.T., Xu, Y.L., Zhang, P.J., Li, Y.S., Zuo, S.Y., 2000. Effects of recombinant yeast on the growth and concentration of hormone in the serum of flounder, Paralichthys olivaceus. Oceanol. Limnol. Sin. 31, 135 – 138. Wilson, R.P., Poe, W.E., Nemetz, T.G., MacMilan, J.M., 1988. Effect of recombinant bovine growth hormone administration on growth and body composition of channel catfish. Aquaculture 73, 229 – 236. Zohar, Y., 1989. Endocrinology and fish farming: aspects in reproduction, growth and smoltification. Fish Physiol. Biochem. 7, 395 – 405.
Expression of common carp growth hormone in the yeast Pichia pastoris and growth stimulation of juvenile tilapia (Oreochromis niloticus) Yinghua Li a,b, Junjie Bai a,*, Qing Jian a, Xing Ye a, Haihua Lao a, Xinhui Li a, Jianren Luo a, Xufang Liang b a
Pearl River Fisheries Research Institute, CAFS Key Laboratory of Tropical and Subtropical Fish Breeding and Cultivation, Ministry of Agriculture P.R.C., Guangzhou 510380, PR China b Department of Biotechnology, College of Life Science and Technology, Jinan University, Guangzhou 510632, PR China Received 23 January 2002; received in revised form 20 June 2002; accepted 7 August 2002
Abstract The cDNA encoding mature growth hormone (GH) was cloned from the pituitary of common carp (Cyprinus carpio) by RT-PCR. To construct the expression plasmid, the GH cDNA was inserted into the pUC18 plasmid and subsequently subcloned into vector pPICZaA, which contains the promotor from the alcohol oxidase (AOX1) gene and the a-factor signal peptide sequence. The yeast Pichia pastoris GS115 strain was transformed with the expression plasmid. Transgene expression was observed after screening of the transformants with Zeocink. Results showed that, with methanol induction, recombinant carp GH (rcGH) had been expressed and exported into the culture medium. The production peaked at 72 h of induction and the optimal pH for expression was 6.0. The yield was 300 – 400 mg l 1 in shaking-flask fermentation medium, accounting for 34.61% of the total supernatant secreted proteins. rcGH was separated through anion-exchange chromatography. The growth rate of juvenile tilapia (Oreochromis niloticus) injected with purified rcGH, was found to be 24.5% and 53.1% higher than the control at the dose of 0.10 and 1 Ag g 1 body weight week 1 respectively ( P<0.001), while the chemical composition of muscle was not affected significantly by the rcGH treatment. The available production of a large quantity of purified rcGH from this work will strengthen the functional study of rcGH for both theoretical and practical purposes. D 2003 Published by Elsevier Science B.V. Keywords: Common carp (Cyprinus carpio); GH cDNA; Pichia pastoris; Secreted expression; Purification; Growth; Tilapia
*
Corresponding author. Tel.: +86-20-81616127; fax: +86-20-81616162. E-mail address: [email protected] (J. Bai).
0044-8486/03/$ - see front matter D 2003 Published by Elsevier Science B.V. PII: S 0 0 4 4 - 8 4 8 6 ( 0 2 ) 0 0 4 0 6 - 4
330
Y. Li et al. / Aquaculture 216 (2003) 329–341
1. Introduction Fish growth hormone (GH) is a polypeptide hormone produced by the anterior pituitary cells which is involved in the regulation of growth, development, metabolism, appetite, and osmoregulation in fish (Donaldson et al., 1979; Gill et al., 1985; Agellon et al., 1988; Zohar, 1989; Tsai et al., 1993a,b; Farmanfarmaian and Sun, 1999; Silverstein et al., 2000). It has been widely used to study fish endocrinology, feed intake and efficiency, nutritional composition, and growth. However, the amount of native GH is extremely low and its availability is limited, so it is difficult to establish some useful methods, such as radioimmunoassay (RIA), radio receptor assay (RRA) and enzyme-linked immunosorbent assay (ELISA) to investigate fish growth physiology. Recombinant fish GH, which has been demonstrated to have the same function as native GH, can be employed instead of the native GH to study fish physiology. Previously, a number of cDNAs of fish GH have been cloned and expressed in Escherichia coli (Sekine et al., 1985; Agellon and Chen, 1986; Saito et al., 1988; Ho et al., 1991; Tsai et al., 1993a,b; Bai et al., 1999; Ayson et al., 2000). Recombinant GH expressed in E. coli has played an important role in basic research of fish physiology and in its applications in aquaculture. However, E. coli is a prokaryote and its intrinsic characteristics differ from those of eukaryotes, such as protein processing, protein folding, and posttranslational modification. The low capacity of post-translation process in E. coli resulted in less active recombinant proteins and formation of insoluble inclusion bodies (De Bernardez Clark, 1998). With the development of eukaryotic expression systems, several fish GHs have been expressed in the yeast Saccharomyces cerevisiae (Hayami, 1989; Tsai et al., 1993a,b, 1994; Bai et al., 1999; Ma et al., 1999; Wang et al., 2000) and the yeast Pichia pastoris (Chen et al., 1998). The P. pastoris expression system offers advantages over S. cerevisiae in its high productivity, efficient secreted expression and stable genetics, so it has been an attractive candidate for production of foreign proteins (Romanos et al., 1993; Romanos, 1995; Geoffry and James, 1975). We have investigated the intracellular expression of carp GH in P. pastoris. The engineered P. pastoris strain used as food supplement showed significant growth-promoting effects on tilapia (Li et al., 2001), but the production of rcGH was low (1– 2% of the total cell proteins), making the downstream purification of rcGH difficult. P. pastoris has a higher secretory capacity and low levels of endogenous proteins than other yeasts, and the secreted recombinant protein comprises the majority of the total protein in the medium, which facilitates the downstream purification of the interested protein (Barr et al., 1992). Hence, we constructed an engineered strain of P. pastoris, which expresses and secretes carp GH. The purified rcGH was found able to significantly promote body weight growth of tilapia (Oreochromis niloticus).
2. Materials and methods 2.1. Preparation of total RNA and RT-PCR Common carp (Cyprinus carpio) was chosen from the farm of the Pearl River Fisheries Research Institute (PRFRI). Carp pituitary was dissected and immediately
Y. Li et al. / Aquaculture 216 (2003) 329–341
331
homogenized in the medium provided by the RNA isolation kit used. Total RNA was extracted using High Pure RNA Isolation Kit (Boehringer Mannheim), and used for RTPCR according to the Titank One Tube RT-PCR System (Boehringer Mannheim). A forward primer (FP1: 5V CGGAATTCGACAACCAGCGGCTGT 3V) and a reverse primer (RP1: 5V CGCGGATCCTTACTACAGGGTGCAGTTG 3V) were designed to synthesize the cDNA encoding the mature region of the carp GH, based on sequence reported by Koren et al. (1989). The cDNA obtained from RT-PCR was modified by introducing an EcoRI site at the 5Vend, a BamHI site and a TAA stop codon at the 3V end. PCR was performed with 35 cycles as follows: 30 s of denaturation at 94 jC, 30 s of annealing at 50 jC, and 45 s of extension at 68 jC, and then further incubation for 7 min at 72 jC. 2.2. Construction of plasmid pUC18/cGH The PCR products were electrophoresed through a 0.8% agarose gel, purified with the Wizard PCR DNA Purification System (Promega), and digested with both EcoRI and BamHI. The digested cDNA was inserted into pUC18, that was digested with the same restriction enzymes. E. coli DH5a was transformed with the ligation product according to Hanahan (1985). Luria-Bertani (LB) agar plates (1% tryptone, 0.5% yeast extract, 1% NaCl, pH 7.0) containing 100 Ag/ml ampicillin was used to screen the recombinant colonies. Plasmids from recombinant colonies were prepared using the Plasmid Minipreps Kit (Sangon, Shanghai). Insertion of the PCR product was verified by restriction enzyme digestion, agarose gel electrophoresis and sequencing. The cDNA sequence and deduced amino acid sequence were compared with the carp GH in the GenBank database. 2.3. Construction of expression plasmid pPICZaA/cGH A second reverse primer (RP2: 5VCGGAATTCTTACTACAGAGTGCAGT 3V) was designed, which was highly similar to RP1 except for the EcoRI site to replace the BamHI site, to subclone the cGH cDNA into the EcoRI site of pPICZaA, which provided a Zeocink-resistant gene for both selection in E. coli and in P. pastoris. Upon PCR using primers FP1 and RP2, the cDNA fragment was modified from pUC18/cGH to introduce two EcoRI sites at both ends. PCR program was as follows: 35 cycles; 30 s of denaturation at 94 jC, 30 s of annealing at 50 jC, and 45 s of extension at 72 jC, and finally incubation for 7 min at 72 jC. The products were electrophoresed through a 0.8% low melting point agarose gel. After extraction from the gel with the Agarose Gel DNA Extraction kit (Boehringer Mannheim) and digestion with EcoRI, the PCR product was ligated to the P. pastoris shuttle expression vector pPICZaA, which was also digested with EcoRI and then dephosphorylated by calf intestinal alkaline phosphatase (CIP). E. coli Top 10 (Invitrogen) strain was transformed, and low salt LB medium plates (same as LB except for a concentration of 0.5% NaCl instead of 1% NaCl) containing 25 Ag ml 1 Zeocink (Invitrogen) were used to screen transformants. The plasmids with the cGH fragment were selected by EcoRI digestion. The inserted fragment was oriented by PCR with 5V AOX1 Pichia Primer (Invitrogen) and RP2 primer. With a-factor Pichia Primer (Invi-
332
Y. Li et al. / Aquaculture 216 (2003) 329–341
trogen), the sequencing result confirmed that the cGH cDNA had been cloned in frame with the a-factor signal peptide sequence. 2.4. Transformation of P. pastoris and screening for Mut+ phenotype The recombinant plasmid pPICZaA/cGH and pPICZaA parent plasmid were digested with DraI, the restriction site for which is located within the 5VAOX1 region of pPICZaA. The competent P. pastoris strain GS115 was transformed with 2– 5 Ag linear plasmid by electroporation as described by Cregg et al. (1985). Pulse of the mixture of competent cells and linear plasmid was according to the parameters for yeast (1.0 kv, 25 AF, and 200 V) suggested by the manufacturer of the electroporator (GenPulser, BioRad). Transformants were selected for Zeocink resistance onto YPD (1% yeast extract, 2% peptone, 2% dextrose) agar plates containing 100 Ag/ml Zeocink. Transformants were streaked onto both YPM (same as YPD medium but containing 0.5% methanol instead of dextrose) and YPD agar medium to screen for methanol utilization plus (Mut+) and methanol utilization slow (Muts) phenotypes. 2.5. Secreted expression of rcGH in P. pastoris 2.5.1. Selection of high expression yeast clone To select the most productive clone, 16 Mut+ yeast clones were inoculated in 25 ml of buffered liquid BMGY medium (1% yeast extract; 2% peptone; 100 mM potassium phosphate, pH 6.0; 1.34% yeast nitrogen base; 410 5% biotin; 1% glycerol) and grown at 30 jC in a shaking incubator until the culture’s OD600 reached 8 –10 (about 28– 32 h). Cells were harvested by centrifugation at 5000 rpm for 5 min at room temperature and gently resuspended in 25 ml of buffered liquid BMMY medium (same as BMMY but containing 0.5% methanol instead of 1% glycerol) to induce the AOX1 promoter. Absolute methanol was added every 24 h to a final concentration of 0.5% (V/V) to maintain induction for 72 h. The supernatant was analyzed by SDS-PAGE. Western blotting was performed using rabbit anti-carp GH antiserum as described by Sambrook et al. (1989). 2.5.2. Effect of pH and induction duration on expression GS115 (pPICZaA/cGH) was cultured to mid-log-phase in 25 ml liquid BMGY media, then centrifuged and the cell pellet resuspended in liquid BMMY media, which were already adjusted to pH 4.5, 5.5, 6.0 and 6.5 with phosphoric acid or KOH. Expression of the transgene in the culture was induced as described previously. The culture was sampled at 72-h post-induction and then analyzed with SDS-PAGE. A time course study of expression also was performed in order to determine the time point when the production of recombinant protein was highest. The culture was sampled at 24-, 48-, 72- and 96-h postinduction and analyzed with SDS-PAGE. The strongest density protein lane was scanned with Tiger Gel Image Analysis System (Chongqing University, Chongqing, China) to calculate the percentage of rcGH in the total supernatant proteins. Production of rcGH was visually estimated with band intensity against the standard Low Molecular Weight Protein Marker.
Y. Li et al. / Aquaculture 216 (2003) 329–341
333
2.5.3. Protein purification Secreted rcGH from P. pichia was purified through anion-exchange chromatography on a preparative column Q-Sephrose (AKTA prime system, Amersham Pharmacia). After centrifugation, the culture supernatant was equilibrated to adjust both its ionic strength and pH and then was loaded on the column balanced with buffer A (50 mmol l 1 Tris – Cl, pH 9.0). Unbound proteins were eluted with buffer A from the loaded column, followed by stepwise elution with buffer A and buffer B (buffer A+1 mol l 1 NaCl). The elution fraction was collected and examined on SDS-PAGE. The purified rcGH was lyophilized and then stored at 4 jC. 2.6. Assay the biological activity of rcGH 2.6.1. Growth-promoting effect Sixty tilapia (O. niloticus) fingerlings (17.13F0.56 g, 8.08F0.12 cm BL) were selected from the PRFRI farm and then randomly distributed into three tanks (806050-cm tanks, n=20/tank) supplied with continuous flowing water. The fish were fed to satiation with eel feed once daily, and acclimated for 1 week before hormone treatment. Purified rcGH powder was dissolved in 0.7% sterile saline (pH 9.5). The hormone was delivered weekly by intraperitoneal (i.p.) injection in a volume of 0.1 ml at the dose of 0.1 Ag g 1 body weight week 1 for one test group and 1 Ag g 1 body weight week 1 for the other. The dosage was selected based on the data provided by previous research (Agellon et al., 1988; Silverstein et al., 2000). The control group was injected with sterile saline only. Body weight of each fish was measured weekly. T-test was performed to determine the significance of any difference between means of test and control groups. 2.6.2. Compositional analysis in muscle Muscle compositional analysis was slightly modified from that of Rasmussen et al. (2001) and Silverstein et al. (2000). At the end of the test, four fish (29.21F0.43 g, 10.19F0.21 cm) from group 2 and from the control group were chosen, anaesthetized with 0.005% benzocaine (Sigma), and then individually weighted. Each fish was skinned and gutted. The fillet of each fish carcass from the same group was mixed and homogenized. A 5-g fillet from each sample was used for protein and moisture analysis and 30 g for ash and lipid analyses. Moisture, ash and protein (Kjeldahl-N) content were determined according to AOAC (1984). Lipid extraction and quantification were carried out using the chloroform methanol extraction method (Blign and Dyer, 1959). The determinations were made in duplicate and then averaged.
3. Results 3.1. Cloning of cDNA for cGH mature peptide and construction of pUC18/cGH PCR products were electrophrosed on the agarose gel and the targeted DNA fragment, approximately 580 bp, was excised from the gel and cloned into pUC18 to construct pUC18/cGH. The recombinant plasmid was confirmed by releasing 580 bp DNA fragment
334
Y. Li et al. / Aquaculture 216 (2003) 329–341
after EcoRI and BamHI digestion. Sequencing the pUC18/cGH showed that the cloned cDNA is almost identical to the previous report except for two nucleotides, but the predicted amino acid sequence from cDNA is exactly the same as the previous report (Koren et al., 1989). The sequence we cloned in this paper had been submitted to GenBank; the accession number is AF 332594. 3.2. Construction of expression plasmid pPICZaA/cGH The PCR products amplified with FP1 and RP2 were approximately 580 bp (Fig. 1, lane 3). After EcoRI digestion, purification and ligation to pPICZaA, the construct was used to transform the E. coli Top 10. The plasmid extracted from Zeocink-resistant transformants was digested with EcoRI and a 580 bp fragment was obtained as expected (Fig. 1, lane 2). The approximately 930 bp PCR products (Fig. 1, lane 4) amplified with the 5VAOX1 Primer and RP2 primer, including 580 bp GH cDNA and 353 bp nucleotides from the native vector, indicted that the insertion direction was correct. This expression plasmid was designated pPICZaA/cGH. Sequencing showed that the open reading frame of cGH cDNA was completely in frame with that of the a-factor signal peptide (data not shown). 3.3. Transformation of P. pastoris and Mut+ phenotype selection After transformation, about 100 Zeocink-resistant colonies appeared. Fifty colonies were picked to verify the Mut+ phenotype. Forty-eight colonies were Mut+ because they
Fig. 1. PCR products and construction of expression plasmid M1, M2: DNA marker. Lane 1: Restriction digestion of vector pPICZaA with EcoRI. Lane 2: Restriction digestion of plasmid pPICZaA/cGH with EcoRI. Lane 3: PCR products amplified with forward primer 1 and reverse primer 2. Lane 4: PCR products amplified with 5V AOX1 primer and reverse primer 2.
Y. Li et al. / Aquaculture 216 (2003) 329–341
335
grew well on both YPM and YPD agar plates, indicating that they can produce alcohol oxidase to metabolize methanol so that they are able to grow on medium with methanol as the sole carbon source. The other two colonies are Muts because they grew well on YPD plate, but slowly on YPM plate. Mut+ clones were chosen for the subsequent expression study. 3.4. Selection of high expression strain and western blotting Upon induction by methanol, 13 of the 16 clones secreted a specific 22-kDa protein with the same size as the standard carp GH. This protein band was absent in the other three clones and in the control transformant with the parent vector (data not shown). The productivity varied among the 13 clones. The clone showing the highest production of rcGH was named GS115 (pPICZaA/cGH) and selected for further analysis. Western blotting analysis showed that the 22-kDa protein band of GS115 (pPICZaA/GH) reacted specifically with the rabbit anti-carp GH antiserum (Fig. 2). The growth curve of GS115 (pPICZaA/GH) in 52-h culture period was drawn to choose the right time point to initiate induction. The cells grew very slowly within first 8 h and then the growth rate sped up to log-phase growth. At 32 h, the growth reached the stationary phase, with the OD600 as high as 11. After 40 h, growth rate began to decrease slowly. 3.5. Effects of pH and induction course on rcGH productivity GS115 (pPICZaA/cGH) was used to analyse expression levels of rcGH at pH 4.5, 5.5, 6.0 and 6.5. Upon induction with 0.5% methanol for 3 days, the culture supernatant at each pH was analyzed by SDS-PAGE. Results are shown in Fig. 3, which indicated that pH significantly affected the production of rcGH. At pH 4.5, almost no rcGH could be
Fig. 2. Western Blotting with the rabbit anti-common carp GH antiserum as probe. Lane 1: Supernatant sample from control yeast strain Gs115 (pPICZaA). Lane 2: Supernatant sample from engineered yeast strain Gs115 (pPICZaA/cGH).
336
Y. Li et al. / Aquaculture 216 (2003) 329–341
Fig. 3. Expression of rcGH in P. pastoris at pH 4.5, 5.5, 6.0 and 6.5 M: Low Molecular Weight Protein Marker. (1) Standard cGH. (2) GS115 (pPICZaA). (3 – 6) Expression at pH 6.5, 6.0, 5.5, and 4.5, respectively.
detected, and the optimal pH for rcGh expression was 6.0. The expression levels at 24, 48, 72 and 96 h of induction were quantified to choose the most suitable time to harvest the cells. SDS-PAGE (Fig. 4) showed that rcGH had been expressed after 24-h induction, peaked at 72 h, and followed by a weak decrease at 96 h. The scanning result showed that the secreted rcGH protein band (in lane 4 of Fig. 4) accounted for 34.61% of the total supernatant proteins (data not shown). By comparison with the standard protein markers, the estimated product of rcGH was 300– 400 mg l 1.
Fig. 4. Expressions of rcGH at 24-, 48-, 72-, 96-h post induction M: Low Molecular Weight Protein Marker. (1) Standard cGH. (2) GS115 (pPICZaA). (3 – 6) rcGH expressed at 96-, 72-, 48-, 24-h post-induction. (7) Purified rcGH.
Y. Li et al. / Aquaculture 216 (2003) 329–341
337
Fig. 5. Elution curve of anion exchange chromatography, the rcGH was eluted at the third peak, where the concentration of NaCl was 0.25 M.
3.6. Purification of rcGH By stepwise elution with NaCl and SDS-PAGE detection, the rcGH was eluted at the third peak (Fig. 5), where the concentration of NaCl was 0.25 M. This elution condition
Fig. 6. The growth-promoting effect of rcGH injection on tilapia, the weights of rcGH-treated and control fish are shown in meanFS.E. Ctrl, Group 1, Group 2. *Indicate p<0.05, **Indicate p<0.01.
338
Y. Li et al. / Aquaculture 216 (2003) 329–341
Table 1 Chemical composition of muscle in control and GH-treated fish Composition
PercentFS.E. (n=4) Control
GH-treated
Protein Moisture Lipid Ash
21.27F0.9 75.65F1.2 0.99F0.2 1.24F0.5
21.37F0.7 75.58F0.9 1.12F0.3 1.17F0.3
was similar to the previous rcGH purification reported by Fine et al. (1993). In the target fraction, rcGH accounted for 90% of all protein by means of gel image scanning. 3.7. Growth-promoting activity The growth of fish in one control and two GH-injected groups is shown in Fig. 6. Each point represents the average weight of individual fish (meanFS.E.). After 5-week treatment, the growth rates of groups 1 and 2 were 24.5% and 53.1% higher than the salinetreated control group, respectively. Additionally, the effect of GH treatment was significant ( P<0.05) for group 2 by week 2 and for group 1 by week 3 compared to that of control group. The significant difference lasted throughout the experiment. A dose of 0.1 Ag g 1 body weight week 1 was sufficient to stimulate a significant increase of tilapia in weight, but the effect was less powerful than the dose of 1 Ag g 1 body weight week 1. These results revealed that a biologically active rcGH was expressed and secreted in P. pastoris, which showed a significant growth-promoting effect on tilapia. 3.8. Chemical composition analysis The results of muscle composition analysis are listed in Table 1. No significant difference in chemical composition was observed between muscle obtained from treatment fish and that of control. Though not significant ( P>0.05), the content of protein and lipid were slightly higher in group 2, compared with the control group, but the content of moisture and ash trended to decrease. However, it should be mentioned that the small sample sizes might have limited the experimental power of the analysis.
4. Discussion This experiment developed an easy expression system capable of providing biologically active rcGH in large quantity. Production of the rcGH under the control of the alcohol oxidase (AOX1) promotor and its purification were described here. Highly purified rcGH was obtained through anion-exchange chromatography and showed a significant effect on the growth of tilapia body weight. pPICZaA, a recently developed expression vector, provided direct and efficient screening for the recombinant transformants with the Zeocink-resistance gene as a dominant selective marker. Because 100% of the Zeocink-resistant transformants contained the target
Y. Li et al. / Aquaculture 216 (2003) 329–341
339
gene (P. pastoris Expression Manual, Invitrogen), it was unnecessary to detect the integration of target gene, while other P. pastoris vectors using a yeast HIS4 gene as a selectable marker require detection of integration by PCR, and the positive rate is only 15 – 60%. In this study, 13 out of 16 colonies selected directly from the Zeocink-containing plates expressed rcGH. The percentage of the positive transformants was sufficient for selection of a high expression strain. rcGH was present in the culture supernatant with the same molecular weight as the standard carp GH, indicating that the a-factor signal peptide was recognized and processed correctly. The secreted rcGH accounted for 34.6% of all the protein in the culture supernatant by gel scanning of the protein band, which could minimize time-consuming and laborious downstream purification. The amount of rcGH (300 – 400 mg l 1) produced by P. pastoris (pPICZaA/cGH) was higher than that of intracellular expression carp GH in P. pichia in our previous study (200 mg l 1) and that of Lateolabrox japonicus GH by Chen et al. (1998) (100 mg l 1), though it was not as high as that of other recombinant proteins produced in P. pastoris. Expression levels of foreign protein depend not only on the native sequence of cDNA, such as codon bias, but also on other factors, such as copy number, temperature, pH, induction duration, and concentration of inducer (D’Anjou and Daugulis, 2000). In the present study, the induction duration and pH had already been optimized. The expression of rcGH in P. pastoris was time-dependent and the optimal induction duration was between 72 and 96 h. The recombinant expression of rcGH was affected by pH. Optimum production of rcGH in the medium occurred at pH 6.0. The above study was limited to shaking-flask culture, and production could be expected to be about 10 fold higher by high-density fermentation, because P. pastoris is a yeast well suited for fermentation (Cregg et al., 1993). It is evident that future work is necessary to investigate the optimal conditions for rcGH production in large-scale fermentation. Our results demonstrated that weekly injections of rcGH could significantly accelerate the growth of tilapia. The growth stimulation effect was similar to those observed by Tsai et al. (1994) and Wang et al. (2000). In our small samples, the rcGH-treated fish revealed no significant changes of content of protein, lipid, moisture, and ash in muscle. This is in agreement with Agellon et al.’s (1988) study, in which rainbow trout injected with recombinant GH showed no significant changes in muscle composition. Effects of GH treatment, either exogenous (administered) or endogenous (transgenic) on body composition are contentious, especially on lipid (Cook et al., 2000; Silverstein et al., 2000). In our study, the GH-treated tilapia showed a slightly higher percentage of lipid that was undesirable in aquaculture applications. In other researcher’s work (Adelman, 1978; Wilson et al., 1988), fatter fish were also obtained after GH treatment. Further investigation should elucidate the molecular mechanism of GH on muscle composition. The available production of a large quantity of purified rcGH from this work will strengthen the functional study of rcGH for both theoretical and practical purposes.
Acknowledgements The authors are very grateful to Dr. Jeffrey T. Silverstein for his critical review of the manuscript, and to Dr. Yue Zhang for his help during the study. This project was supported
340
Y. Li et al. / Aquaculture 216 (2003) 329–341
by Fishery Science and Technology Ninth Five-Year Key Project of Chinese Ministry of Agriculture (No. 95-B-96-02-02-04) and Chinese Academy of Fishery Sciences Key Project Fund (No. 99-08-02).
References Adelmen, L.R., 1978. Influences of temperature on growth promotion and body composition of carp (Cyprinus carpio) due to bovine growth hormone. Trans. Am. Fish. Soc. 107, 747 – 750. Agellon, L.B., Chen, T.T., 1986. Rainbow trout growth hormone: molecular cloning of cDNA and expression in Escherichia coli. DNA 5, 463 – 471. Agellon, L.B., Emery, C.J., Jones, J.M., Davies, S.L., Dingle, A.D., Chen, T.T., 1988. Promotion of rapid growth of rainbow trout (Salmo gairdneri) by a recombinant fish growth hormone. Can. J. Fish. Aquat. Sci. 45, 146 – 151. AOAC, 1984. Official Methods of Analysis of the Association of Official Analytical Chemists, 14th ed. Association of Official Analytical Chemists, Arlington, VA, 1141 pp. Ayson, F.G., de Jesus, E.G., Amemiya, Y., Moriyama, S., Hirana, T., Kawauchi, H., 2000. Isolation, cDNA cloning and growth promoting activity of rabbitfish (Siganus guttatus) growth hormone. Gen. Comp. Endocrinol. 117, 251 – 259. Bai, J.J., Ma, J., Jian, Q., Li, X.H., Luo, J.R., 1999. Clone of cDNA for common carp GH and its expression in prokaryocyte. Chin. J. Biochem. Mol. Biol. 15, 409 – 412. Barr, K.A., Hopkins, S.A., Sreekrishna, K., 1992. Protocol for efficient secretion of HAS developed from P. pastoris. Pharm. Eng. 12, 48 – 51. Bligh, E.G., Dyer, W.J., 1959. A rapid method of total lipid extraction and purification. Can. J. Biochem. Physiol. 37, 911 – 917. Chen, D., Yang, F., Wang, W., Xu, X., 1998. Intracellular expression of Lateolabrox japonicus growth hormone in methyltrophic yeast, Pichia pastoris. Prog. Biochem. Biophys. 25, 140 – 143. Cook, J.T., McNiven, M.A., Richardson, G.F., Sutterlin, A.M., 2000. Growth rate, body composition and feed digestibility conversion of growth-enhanced transgenic Atlantic salmon (Salmo salar). Aquaculture 188, 15 – 32. Cregg, J.M., Barringer, K.J., Hessler, A.Y., 1985. Pichia pastoris as a host system for transformations. Mol. Cell. Biol. 5, 3376 – 3385. Cregg, J.M., Vedvick, T.S., Raschke, W.C., 1993. Recent advances in the expression of foreign genes in Pichia pastoris. Bio/Technology 11, 905 – 910. D’Anjou, M.C., Daugulis, A.J., 2000. A rational approach to improving productivity in recombinant Pichia pastoris fermentation. Biotechnol. Bioeng. 72, 1 – 11. De Bernardez Clark, E., 1998. Refolding of recombinant proteins. Curr. Opin. Biotechnol. 9, 157 – 163. Donaldson, E.M., Fagerlund, U.H., Higgs, D.A., McBride, J.R., 1979. Hormonal enhancement of growth. Fish Physiol. 8, 455 – 597. Farmanfarmaian, A., Sun, L.Z., 1999. Growth hormone effects on essential amino acid absorption, muscle amino acid profile, N-retention and nutritional requirement of striped bass hybrids. Genet. Anal.: Biomol. Eng. 15, 107 – 113. Fine, M., Sakal, E., Vashdi, D., Daniel, V., Levanon, A., Lipshitz, O., Gertler, A., 1993. Recombinant carp (Cyprinus carpio) growth hormone: expression, purification, and determination of biology activity in vitro and in vivo. Gen. Comp. Endocrinol. 89, 51 – 61. Geoffry, P.C., James, M.C., 1975. Applications of yeast in biotechnology: protein production and genetic analysis. Curr. Opin. Biotechnol. 10, 422 – 427. Gill, J.A., Sumter, E.M., Donaldson, H.M., Dye, H.M., Souza, L.M., Berg, T., Wypych, J., Langley, K., 1985. Recombinant chicken and bovine growth hormone accelerate growth in aquacultured juvenile Pacific Salmon (Oncorhynchus kisutch). Bio/Technology 3, 643 – 646. Hanahan, D., 1985. Techniques for transformation of E. coli. DNA Cloning. IRL Press, Oxford, UK, pp. 109 – 135. Hayami, T., 1989. Production of recombinant tuna growth hormone by a yeast, Saccharomyces cerevisiae. Agric. Biol. Chem. 53, 2917 – 2922.
Y. Li et al. / Aquaculture 216 (2003) 329–341
341
Ho, W.K., Wong, M.W., Chan, A.P., 1991. Cloning and sequencing of the grass carp (Ctenopharyngodon idellus) growth hormone gene. Biochim. Biophys. Acta 1090, 245 – 248. Koren, Y., Sarid, S., Ber, R., Daniel, V., 1989. Carp growth hormone: molecular cloning and sequencing of cDNA. Gene 77, 309 – 315. Li, Y.H., Bai, J.J., Li, X.H., Ye, X., Jian, Q., Luo, J.R., Liang, X.F., 2001. Expression of common carp growth hormone in yeast P. pastoris. Chin. J. Biochem. Mol. Biol. 17, 488 – 491. Ma, J., Bai, J.J., Li, X.H., Luo, J.R., Jian, Q., Zhang, H.J., 1999. Expression of rainbow trout GH cDNA in yeast Saccharomyces cerevisiae. Chin. J. Biotechnol. 15, 219 – 224. Rasmussen, R.S., Ronsholdt, B., Ostenfeld, T.H., McLean, E., Byatt, J.C., 2001. Growth, feed utilization, carcass composition and sensory characteristics of rainbow trout treated with recombinant bovine placental lactogen and growth hormone. Aquaculture 195, 367 – 384. Romanos, M., 1995. Advances in the use of Pichia pastoris for high-level gene expression. Curr. Opin. Biotechnol. 6, 527 – 533. Romanos, M.A., Scorer, C.A., Clare, J.J., 1993. Recent advances in the expression of foreign genes in Pichia pastoris. Biotech 11, 905 – 910. Saito, A., Sekine, S., Komatsu, Y., Sato, M., Hirano, T., Itoh, S., 1988. Molecular cloning of eel growth hormone cDNA and its expression in Escherichia coli. Gene 73, 545 – 551. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sekine, S.T., Mizukami, T., Nishi, Y., Kuwana, A., Saito, M., Sata, S., Kawauchi, H., 1985. Cloning and expression of cDNA for salmon growth hormone in Escherichia coli. Proc. Natl. Acad. Sci. 82, 4306 – 4310. Silverstein, J.T., Wolters, W.R., Shimizu, M., Dickhoff, W.W., 2000. Bovine growth hormone treatment of channel catfish: strain and temperature effects on growth, plasma IGF-I levels, feed intake and efficiency, and body composition. Aquaculture 190, 77 – 88. Tsai, H.J., Lin, K.L., Chen, T.T., 1993. Expression of rainbow trout growth hormone cDNA in yeast. Bull. Inst. Zool. Acad. Sin. 32, 162 – 170. Tsai, H.J., Wei, K.C., Ching, C.C., 1993. Enhancement of tilapia growth by dietary administration of recombinant yeast lysates as a supplement. J. Fish. Soc. Taiwan 20, 339 – 345. Tsai, H.J., Kuo, J.C., Lou, S.W., Chen, T.T., 1994. Growth enhancement of juvenile striped mullet by feeding recombinant yeasts containing fish growth hormone. Prog. Fish-Cult. 56, 7 – 12. Wang, H.T., Xu, Y.L., Zhang, P.J., Li, Y.S., Zuo, S.Y., 2000. Effects of recombinant yeast on the growth and concentration of hormone in the serum of flounder, Paralichthys olivaceus. Oceanol. Limnol. Sin. 31, 135 – 138. Wilson, R.P., Poe, W.E., Nemetz, T.G., MacMilan, J.M., 1988. Effect of recombinant bovine growth hormone administration on growth and body composition of channel catfish. Aquaculture 73, 229 – 236. Zohar, Y., 1989. Endocrinology and fish farming: aspects in reproduction, growth and smoltification. Fish Physiol. Biochem. 7, 395 – 405.