- Email: [email protected]
Expression of complement C4 and C9 genes by human astrocytes
Brain Research 809 Ž1998. 31–38
Research report
Expression of complement C4 and C9 genes by human astrocytes Douglas G. Walker a
a, )
, Seung U. Kim b , Patrick L. McGeer
a
Kinsmen Laboratory of Neurological Research, Department of Psychiatry, UniÕersity of British Columbia, VancouÕer, British Columbia, Canada b DiÕision of Neurology, Department of Medicine, UniÕersity of British Columbia, VancouÕer, British Columbia, Canada Accepted 4 August 1998
Abstract Evidence exists that complement activation is involved in the pathogenesis of Alzheimer’s disease ŽAD.. It has been previously demonstrated that central nervous system ŽCNS. resident cells can synthesize complement proteins. Two key proteins in the complement pathway are the complement C4 and C9 proteins. Using reverse transcription–polymerase chain reaction, ELISA, immunocytochemical and immunoblot techniques, we showed that primary human astrocytes constitutively expressed complement C4 mRNA and protein, and that this was increased when cells were treated with interferon-g, but inhibited when cells were treated with interleukin-1b ŽIL-1b .. C4 immunoreactivity could be localized to GFAP-positive astrocytes when protein secretion was inhibited. These results indicated that astrocytes could be a source of complement C4 in the human CNS. In addition it was shown that stimulated astrocytes could also express complement C9 mRNA, though C9 protein was not detectable in culture supernatants. q 1998 Elsevier Science B.V. All rights reserved. Keywords: Tissue culture; ELISA; Inflammation; Alzheimer’s disease; Gene expression
1. Introduction Examination of brains from Alzheimer’s disease ŽAD. cases shows evidence for the deposition of activated complement proteins w5,20x. Senile plaques and neurofibrillary tangles become labeled with proteins that are immunoreactive with antibodies to complement system components C1q, C3d, C4d and C5b-9 w5,20x. The consequences of complement activation in the brain can include the production of proinflammatory peptide fragments, and the formation of the cytolytic membrane attack complex w21x. Several groups have demonstrated the presence of complement mRNAs, including for C1q, C3 and C4, in RNA extracted from human brain tissue of both normal and AD cases, with increased expression being present for a number of these genes in AD cases w16,23,37,40x. These data indicate that complement proteins present in brain could have been synthesized locally, and are not necessarily derived from the circulation. It was initially assumed that microglia Žbrain-resident macrophages. would be the source of complement proteins in the brain; however, astrocytes and neurons have also been shown to express some of the
) Corresponding author. Sun Health Research Institute, 10515 West Santa Fe Drive, Sun City, AZ 85351, USA. Fax: q1-602-876-5698; E-mail: [email protected]
complement proteins w8,23,26,31x. Primary human astrocytes have been reported to express C2, C3, C5, C6, C7 and C8, most of the complement inhibitor proteins w8x and certain complement receptors w7x. The regulation of C4 in brain-derived cells is of interest, as in an earlier study it was demonstrated that this gene was only expressed by human brain microglia that had been stimulated with interferon-g ŽIFN-g . w36x. This feature was also observed for human macrophage-like cells w32x. C4 expression has previously been demonstrated in human astrocytoma cell lines w9,38x; however, as these tumor cells appear to express complement genes in a less regulated manner than untransformed primary astrocytes, verification of the astrocytoma cell findings in primary human astrocytes was warranted. C4 mRNA expression has also been detected in astrocytes derived from neonatal mice brains w11x. Complement C4 is the product of two closely related genes, C4A and C4B, that are located in the class III region of the major histocompatibility complex ŽMHC. w2x. The protein is produced as a single polypeptide of approximately 210 kDa and is cleaved after synthesis into three polypeptide chains, the a , b, and g chains. The three chains are linked by thiolester bonds to make up functional C4 w2x. Although it is believed that the majority of the circulating C4 is synthesized in the liver, studies have shown a number of other cell types are capable of C4
0006-8993r98r$ - see front matter q 1998 Elsevier Science B.V. All rights reserved. PII: S 0 0 0 6 - 8 9 9 3 Ž 9 8 . 0 0 8 1 1 - 7
32
D.G. Walker et al.r Brain Research 809 (1998) 31–38
synthesis. These include monocytesrmacrophages, kidney epithelial cells, pancreatic epithelial cells, fibroblasts and chondrocytes w30,41x. Complement C9, the terminal component of the complement pathway, is an 80 kDa polypeptide. Upon activation of the terminal complement pathway, multiple C9 molecules can become incorporated into the C5b-9 membrane attack complex which becomes inserted into the cell membrane, potentially resulting in cell lysis. The cell types expressing this gene have not been characterized in as much detail as for C4. Although macrophages and transformed monocytic cells have been reported to secrete C9 w8,24x, other reports have not been able to demonstrate C9 expression by monocytesrmacrophages w10,35x or microglia w11,36x. Expression of C9 by primary human or murine astrocytes was not detected w8,11x. In situ hybridization and immunocytochemical studies have detected C9 mRNA and protein in neurons in human brain tissue sections w26,31x. Extracellular C9 deposition, and intracellular C9 was also detected by immunostaining in a subpopulation of hippocampal interneurons in rat brains lesioned by perforant pathway transection w14x. In this study, we report the expression of complement C4 mRNA and secretion of complement C4 by primary human fetal astrocytes under serum-free conditions. Unstimulated astrocytes secreted detectable amounts of C4, and the levels of this increased upon stimulation of cells with interferon-g, a proinflammatory cytokine, while interleukin-1b ŽIL-1b ., another proinflammatory cytokine, inhibited C4 secretion. We also report for the first time that primary human astrocytes can express the complement C9 gene, when appropriately stimulated.
2. Materials and methods 2.1. Reagents Interferon-gamma ŽIFN-g ., IL-1b and interleukin-6 ŽIL6. Žrecombinant. were obtained from Sigma ŽSt. Louis, MO. or Bachem California ŽTorrance, CA.. Cytokines were diluted to 50 ngrml in phosphate-buffered saline ŽPBS. containing 0.1% bovine serum albumin, aliquoted, and stored at y708C. OptiMEM reduced serum culture media and fetal bovine serum ŽFBS. were obtained from Life Technologies ŽGaithersburg, MD.. All other reagents were from Sigma, unless indicated. 2.2. Cell cultures Primary human astrocytes were derived from human embryonic brains Ž12–18 weeks of gestation. from legal and therapeutic abortions and prepared as described previously w22x. Astrocytes isolated from eight independent cases were used in this study. In each case, the astrocytes were used after the third subculture, and following at least
30 days in culture. Under these conditions, microglial or neuronal contamination could not be detected by immunocytochemical methods. Cells were grown in Dulbecco’s modified Eagle’s media-high glucose ŽDMEM. supplemented with 10% FBS and 50 mgrml gentamicin. Cultures were judged ) 98% pure on the basis of immunoreactivity with an antibody to glial fibrillary acidic protein ŽGFAP: DAKO, Carpinteria, CA.. The human hepatoma cell line HepG2 ŽAmerican Type Culture Collection, Rockville, MD. and the LA-N-2 human neuroblastoma cell line ŽDr. R.C. Seeger, Children’s Hospital, Los Angeles, CA. were also used in some experiments. Both cell lines were grown in the same media as the human astrocytes. LA-N-2 cells were differentiated to a neuronal phenotype by treatment for 5 days in 10y5 M retinoic acid before being used in experiments w29x. 2.3. Stimulation protocol Human astrocytes were plated at 2 = 10 5 cells in 60 mm petri dishes in DMEMq 10% FBS and allowed to adhere for 16 h. Cultures were rinsed twice with serum-free OptiMEM and refed with 4 ml of media containing different concentrations of cytokines or cytokine diluent. The media from each culture was harvested after 72 h, except where indicated, and stored at y708C prior to assay. 2.4. C4 ELISA A dual antibody ELISA was employed to measure C4 concentrations in culture media. This utilized a polyclonal antibody to C4 ŽQuidel, San Diego, CA. as capture antibody, and a monoclonal antibody to C4c ŽQuidel. as detection antibody. ELISA plates containing bound antibody were blocked with 1% skimmed milkr1% bovine serum albumin in Tris-buffered saline ŽTBS. Ž50 mM Tris–HCl ŽpH 8.0., 137 mM NaCl, 2.7 mM KCl.. Media from human astrocytes cultures or known amounts of C4 ŽQuidel., diluted in serum-free OptiMEM, were added to wells and incubated for 18 h at 48C. Following washes with TBS containing 0.05% Tween 20, wells were sequentially incubated with monoclonal anti-C4c Ž1 mgrml. for 2 h, alkaline phosphatase-labeled anti-mouse IgG Ž1:1000, Gibco-BRL. for 1 h and alkaline phosphatase substrate Ž1 mgrml p-nitrophenyl phosphate in 0.1 M diethanolaminerHCl ŽpH 9.8., 0.5 mM MgCl 2 .. The concentration of C4 in media was determined based on the optical density at 405 nm of the samples relative to a calibration curve obtained using known amounts of purified C4. The assay had a sensitivity of 100 pgrml and gave a linear response up to 20 ngrml. 2.5. ReÕerse transcription–polymerase chain reaction C4 and C9 mRNA expression was detected using reverse transcription–polymerase chain reaction methodol-
D.G. Walker et al.r Brain Research 809 (1998) 31–38
ogy ŽRT-PCR.. RNA preparation, complementary DNA ŽcDNA. syntheses, and PCR analyses were carried out as previously described w36x. The PCR primers used to detect C4 were sense primer 5X ATGGTTCCTATGCGGCTTGGTTGTC 3X and the antisense primer 5X GCGATGGTCACAAAGGCTGTGAGTG 3X , which produce a cDNA specific fragment of 256 bp w36x. The PCR primers used to detect C9 were sense primer 5X GAATGAGCCCCTGGAGTGAATGGTC 3X and the antisense primer 5X CATTTCCGCAGTCATCCTCAGCATC 3X , which produce a cDNA specific fragment of 180 bp w40x. Each sample was analyzed after at least two different numbers of cycles, to confirm that amplification of product had not reached a plateau. The identity of the C4 PCR product derived from astrocyte cDNA was confirmed by DNA sequencing of a cloned fragment w36x. The identity of the C9 fragment was confirmed by hybridization with an internal probe and by restriction endonuclease mapping w40x. 2.6. Immunocytochemistry The following protocol was used to localize C4 to cultured astrocytes. Cells were plated out onto coverslips in DMEMq 10% FBS, and allowed to adhere for 24 h. The cells were rinsed twice with serum-free OptiMEM and incubated for 48 h in the presence or absence of IFN-g Ž1000 unitsrml. in OptiMEM containing 1 mM monensin Žto reduce C4 secretion.. The cells were then fixed with 4% phosphate-buffered paraformaldehyde, rinsed with phosphate-buffered saline ŽPBS. and pretreated with PBS containing 0.1% saponin and 5% normal goat serum. Saponin Ž0.1%. was included in all subsequent buffers. Cells were incubated in monoclonal antibody to C4c ŽQuidel, 1:1000. for 18 h at room temperature, rinsed and bound antibody was detected by sequential reaction with a
33
biotin-labeled anti-mouse IgG Ž1:1000, Vector Laboratories, Burlingame, CA. and preformed avidin–biotin–peroxidase complex Ž1:2000, Vector Laboratories.. Bound antibody was detected by incubation of cells in diaminobenzidine-HCl Ž0.2 mgrml. in 50 mM Tris–HCl ŽpH 7.6., 0.05 M imidizole and 0.005% hydrogen peroxide. Cultures of untreated and IFN-g treated astrocytes were processed in parallel under the same reaction conditions. 2.7. Immunoblot analysis To confirm the specificity of the immunostaining result, parallel cultures of astrocytes Ž2 = 10 6 cellr60 mm dish. were prepared and processed as described for immunocytochemistry. At the end of the treatment period, cells were harvested by scraping into PBS, collected by centrifugation and frozen at y708C. Equivalent amounts of protein Ž25 mgrlane. were dissolved in SDS-sample buffer, separated through 7.5% polyacrylamide gels and transferred to Immobilon-P membrane ŽMillipore, Bedford, MA. as described previously w39x. Membranes were pretreated with 5% skimmed milk in TBS and incubated with the anti-C4c monoclonal antibody Ž1:1000. for 18 h at 48C. The bound antibody was detected as described previously w39x.
3. Results 3.1. Human astrocytes constitutiÕely express complement C4 mRNA In our earlier studies, we showed that human postmortem adult brain-derived microglia did not constitutively express detectable levels of C4 mRNA, but C4
Fig. 1. Panel A: Representative result of polymerase chain reaction analysis showing constitutive complement C4 mRNA expression by human astrocytes. Comparison was made with cDNA derived from HepG2 hepatoma cells. Lanes 1 Žastrocytes. and 2 ŽHepG2.: amplification for 30 cycles. Lanes 3 Žastrocytes. and 4 ŽHepG2.: amplification for 35 cycles. Panel B: Representative result of polymerase chain reaction analysis showing C4 mRNA expression after cytokine stimulation of human astrocytes. Figure shows an ethidium bromide stained gel demonstrating C4 specific bands from cDNA samples that had been amplified for 32 cycles. Lane 1: Control culture; lane 2: IL-1b treated culture; lane 3: IL-6 treated culture; lane 4: IFN-g treated culture; lane 5: IL-1brIFN-g treated culture.
34
D.G. Walker et al.r Brain Research 809 (1998) 31–38
expression could be induced when these cells were stimulated with IFN-g w36x. As we previously showed that normal human brains expressed C4 mRNA w37x, these data indicated that other types of cells in the brain may express complement C4. Using RT-PCR, we now show that complement C4 mRNA can be readily detected in cultured human astrocytes isolated from fetal brains Žexample; Fig. 1A, lanes 1 and 3.. For comparison, the level of C4 expression was compared with that of HepG2 cells ŽFig. 1A, lanes 2 and 4., a human hepatoma cell line with many of the properties of liver hepatocytes. A consistent increase in C4 mRNA expression was apparent in cultures treated with IL-6, IFN-g, or IL-1brIFN-g ŽFig. 1B, lanes 3–5., compared with control cultures ŽFig. 1B, lane 1., but not in IL-1b-treated cultures ŽFig. 1B, lane 2.. 3.2. Human astrocytes secrete complement C4 An ELISA assay was used to quantify the secretion of C4 by human astrocytes prepared from five different cases, and to study some of the factors regulating its secretion. To prevent the possibility of detecting cross-reacting C4 protein present in FBS, and to model more closely the in vivo situation, experiments were carried out by incubating astrocyte cultures in serum-free media. In serum-free Opti-
MEM, the astrocytes developed heterogeneous morphology, with cells having either a process-bearing or flat profile Žexample Fig. 3A.. The effects of stimulation with IFN-g, IL-1b, or a combination of both, on secretion of C4 are shown in Fig. 2. As there was variability in basal levels of C4 expression between cases, which might be expected considering the genetically diverse human material used to prepare the astrocyte cultures, results are expressed as the percentage increase or decrease relative to unstimulated cultures. Basal levels of C4 secretion ranged from 19 ngr10 6 cells to 114 ngr10 6 cells after 72 h incubation, while after treatment with 100 unitsrml of IFN-g, concentrations of secreted C4 ranged from 121 to 470 ngr10 6 cells after 72 h. Treatment with IFN-g Ž100 unitsrml. had a significant stimulatory effect on C4 secretion Ž p s 0.0342, n s 5: Student paired t-test.. Stimulation with this cytokine increased C4 secretion from 2.5 fold to 10.2 fold compared with their corresponding control cultures. When using serum-free culture conditions, there was no significant change in total cellular protein in the cultures treated with IFN-g compared to control cultures. The inhibition of C4 secretion by IL-1b was significant, though the effect of IL-1b on increasing C4 secretion by IFN-g treated cultures did not reach statistical significance.
Fig. 2. Cytokine modulation of C4 secretion by human astrocytes measured by ELISA of culture supernatants. Results show percent changes in C4 secretion by cells treated with IL-1b ŽIL1–unitsrml. Žshowing inhibition., and IFN-g Žunitsrml. Žshowing stimulation. relative to unstimulated cells. Results represent mean " S.E.M. of five independent cultures. Combination of IL-1b and IFN-g Žmean " S.E.M. of four independent cultures. appeared to show a further increase in C4 secretion, but the difference compared with cultures stimulated with IFN-g alone did not reach statistical significance.
D.G. Walker et al.r Brain Research 809 (1998) 31–38
3.3. Colocalization of C4 immunoreactiÕity in astrocytes To confirm that C4 was being produced by human astrocytes, localization of C4 in GFAP immunoreactive astrocytes was demonstrated. To reduce the amount of C4 protein secreted by the cells, and to allow it to accumulate within cells, astrocyte cultures were treated with 1 mM monensin, which causes the protein to accumulate in the Golgi complex. In earlier experiments we failed to demonstrate C4 immunoreactivity within cells when secretion of the protein was not inhibited. This would indicate that the C4 protein is rapidly secreted after synthesis. The results show that GFAP immunoreactivity can be identified in all of the cells in the culture ŽFig. 3A.. Matched cultures to these, but treated with 1 mM monensin ŽFig. 3B. and cultures treated with 1 mM monensin and IFN-g ŽFig. 3C. showed intracellular immunoreactivity with an antibody to C4c. Considerably increased immunoreactivity for C4 is apparent in the IFN-g treated culture ŽFig. 3C.. Treatment
35
of cultures with 1 mM monensin caused a noticeable change in morphology, possibly due to its sodium ionophore properties. Prolonged incubation of cultures Žmore than 60 h. in media containing 1 mM monensin caused observable amounts of cell death. To confirm these immunocytochemical observations by immunoblot analysis, parallel cultures of unstimulated, IFN-g and IL-1brIFN-g stimulated astrocyte cultures were treated for 48 h with 1 mM monensin, to cause an intracellular accumulation of C4. The reduction of C4 secretion was confirmed by ELISA analysis of some of the culture supernatants Ždata not shown.. Immunoblot analysis of extracts of the cells showed that bands corresponding to unprocessed prepro-C4 Župper band. and cleaved C4 Žlower band corresponds to the 75 kDa C4b chain. could be readily detectable in the IFN-g stimulated cultures ŽFig. 3D, lanes 2 and 4.. These data confirmed that C4 protein could be detected in enriched astrocyte cultures. In the unstimulated cultures, faint but detectable bands corre-
Fig. 3. Localization of C4 in human astrocytes. Representative result showing that C4 immunoreactivity Žpanels B and C. can be detected in GFAP-immunoreactive astrocytes Žpanel A.. Increased C4 immunoreactivity can be observed in the culture treated with IFN-g Ž1000 unitsrml. Žpanel C.. Panel D. Immunoblot analysis for the detection of C4 protein in human astrocytes. Two different sets of cultures were treated with 1 mM monensin to reduce the amount of C4 protein secretion. Lane 1: unstimulated Žset 1.; lane 2: IFN-g stimulated Ž1000 unitsrml.Žset 1.; lane 3: unstimulated Žset 2.; lane 4: IFN-g stimulated Ž1000 unitsrml.Žset 2.; lane 5: IL-1brIFN-g stimulated Ž200r1000 unitsrml.Žset 2.. Arrows on right indicate position of molecular weight markers.
36
D.G. Walker et al.r Brain Research 809 (1998) 31–38
Fig. 4. Expression of complement C9 mRNA detected by polymerase chain reaction analysis. Figure shows ethidium bromide stained gel demonstrating C9 specific bands from cDNA samples that had been amplified for 40 cycles. Lane 1 and 2. cDNA from differentiated LA-N-2 neuroblastoma cell that were unstimulated or stimulated with IFN-g Ž1000 unitsrml.. Lanes 3–12: cDNA from different preparations of human astrocytes. All cultures were maintained in serum-free media except in lane 9. Lane 3: unstimulated human astrocytes Žset 1.. Lanes 4–9: unstimulated and stimulated human astrocytes Žset 2.. Lane 4: unstimulated; lane 5: IL-6 Ž200 unitsrml.; lane 6: IFN-g Ž1000 unitsrml.; lane 7: IL-1b Ž200 unitsrml.; lane 8: IFN-grIL-1b, Ž1000r200 unitsrml.; lane 9: unstimulated astrocytes maintained in serum-containing media; lane 10: unstimulated Žset 3.; lane 11: IFN-g Ž1000 unitsrml. set 3; lane 12: unstimulated Žset 4..
sponding to the prepro-C4 polypeptide could also be detected. In the cultures stimulated with IL-1brIFN-g, the C4b polypeptide appeared to be cleaved further to a band with a molecular weight of approximately 68 kDa ŽFig. 3D, lane 5..
prove possible to detect C9 protein in supernatants from a number of different astrocyte cultures. This was carried out using a sensitive immunodot method combined with chemiluminescent detection, which was able to detect 50 pg of purified C9 under the same conditions Ždata not shown..
3.4. ActiÕated human astrocytes express C9 mRNA To determine whether astrocytes, as opposed to astrocytoma cells w8,38x, have the potential to express the C9 gene, and thus could be contributing to the C9 mRNA and protein that can be detected in central nervous system ŽCNS. tissue, cDNA samples derived from several different sets of astrocyte cultures were analyzed by RT-PCR. It had been reported that human or mouse astrocytes did not express C9 mRNA w8,11x. Our results showed that human astrocytes could be stimulated by IL-1b, IFN-g or IL-6 to express C9 mRNA Žrepresentative results Fig. 4.. Under serum-free conditions, basal expression of C9 mRNA could not be detected ŽFig. 4., lanes 3, 4, 10 and 12. For comparison, the expression of C9 by unstimulated and stimulated differentiated neuroblastoma cells was studied. C9 mRNA could also be detected in differentiated LA-N-2 neuroblastoma cells stimulated with IFN-g ŽFig. 4, lane 2.. Other cytokines were not tested on these cells. Recent data have shown the expression of C9 mRNA and protein in neurons in human brains w26,31x. Interestingly, unstimulated astrocytes grown in media containing 10% FBS did express detectable amounts of C9 mRNA ŽFig. 4, lane 9.. Overall, the levels of C9 mRNA in all these cells appeared low, as it required 40 amplification cycles in order to readily detect the formation of the 180 bp bands. Only the most intense band ŽFig. 4, lane 6. was detectable in these same samples after 35 cycles of amplification. This may be the reason for the previously reported negative results in astrocyte samples of human and mouse w8,11x. It did not
4. Discussion A number of antibodies for complement proteins have been shown to identify neurodegeneration associated structures in brain tissue from individuals affected by diseases such as AD. These proteins include C3d, C4d and C5b-9 w20,33,40x. The presence of C4 activation fragments is indicative of activation of the classical complement pathway, while the presence of C3d and C5b-9 can arise following activation of either the classical or alternative pathways. Immunohistochemical staining of brain sections for C1q have confirmed that complement activation appears to be mediated by an antibody-independent initiation of the classical pathway w21,25x. It has been shown in in vitro studies that complement activation can occur by the binding of C1q to Ab peptide w13,25,34x. Evidence exists that complement proteins can be produced in the brain by CNS resident cells. Messenger RNA for all classical complement pathway components have been detected in RNA extracted from brain tissue w33,37,40x and by in situ hybridization on brain tissue sections w6,15,16,26x. Although the in situ hybridization studies have surprisingly shown that neurons can express mRNA for various complement proteins, expression of complement mRNA by glial cells cannot be ruled out w15x. In this study, C4 mRNA was localized to both neurons and glial cells w15x. Cultured microglia have been shown to express C1q, C2, C3 and C4 w11,36x and human astrocytes or astrocytoma cells can also express a range of complement
D.G. Walker et al.r Brain Research 809 (1998) 31–38
proteins w8,9,18x. A difference in patterns of expression of various complement genes between human astrocytes and astrocytoma cells is apparent w8x. Although expression of C4 by astrocytoma cells has been shown w9,38x, results for C4 expression have not been published. In the results obtained in this study by non-transformed human astrocytes, it was shown that C4 secretion was increased by IFN-g treatment, consistent with reports for other cell types; however, in this study it was also observed that IL-1b could inhibit secretion of C4. Increased numbers of IL-1b immunoreactive microglia, localized to AD-type pathology, have been observed in affected brain tissue w3,27,28x. IL-1b has been reported to convert flat astrocytes into process-bearing astrocytes and that this effect was more pronounced in the absence of serum w19x. This was the predominant morphology of the cultures in this study, once they were switched from serum containing to serum-free media. There appeared to be a noticeably different effect on C4 expression when cultures were treated with IL-1b and IFN-g combined, compared with either cytokine alone. Similar to the observations of others w17x, we observed in preliminary experiments that astrocyte cultures treated with both cytokines produced relatively large amounts of nitric oxide Ždata not shown.. This induction appeared to be associated with an observable toxic effect on the astrocytes that were incubated in serum-free media. Treatment of cultures with either of these cytokines alone did not induce nitric oxide production or any observable toxic effect. The mechanism of this cytokine interaction is not understood. The increased amounts of C4 protein in the media of cultures treated with IL-1brIFN-g may be related to this interaction; however, it is possible that the increased release of C4 may be due to a toxic effect of the nitric oxide causing greater release of C4 from the cells. There was no evidence of increased C4 mRNA in such cultures, and also the difference in the molecular weight of the C4b polypeptide band shown on the immunoblot ŽFig. 3D, lane 5. would suggest nonspecific proteolysis. There have been few studies describing the cell types that express C9 and produce this protein. It was assumed that C9 is primarily derived from liver hepatocytes w4,35x though other cell types have been implicated w26x. Induction of C9 mRNA in human astrocytes was observed after stimulation by the proinflammatory cytokines IL-1b, IL-6 and IFN-g. IL-1 and IL-6 immunoreactivities have been localized in AD-affected brains w3,12x, and may be contributing to the induction of C9 expression that occurs in such tissue w26,31,40x. As human astrocytes have been shown to express all of the other complement proteins except C1q w8,9x, it would be surprising if this cell type could not express C9. Expression of this gene has previously been detected in astrocytoma cells w9,38x. It is clear from the mRNA results, the levels of C9 expression in the cytokine stimulated astrocytes are relatively low. Interestingly, C9 mRNA could also be induced in neuronal-like
37
cells, differentiated from neuroblastoma cells, that had been stimulated with IFN-g, but not in unstimulated cultures. Neuronal expression of C9 has been observed in vivo in both human and lesioned rat brains w14,26,31x. The membrane attack complex, which consists mainly of polymerized C9 molecules, has been demonstrated on membranous AD pathological structures w20,40x. Expression of C9 mRNA was detectable in synovial membranes from patients with rheumatoid and osteoarthritis, both diseases having a strong inflammatory nature w10x, though the cell typeŽs. producing the mRNA were not identified. C9 deposition has also been detected as a consequence of experimental insults to rat brains w1,14x. Further studies will be required to assess whether the failure to detect secreted C9 by human astrocytes was due to the use of an insufficiently sensitive detection technique, or whether the C9 mRNA is not effectively translated into protein. Due to the potential significance of brain-produced complement proteins to AD pathogenesis, further studies on the expression and regulation of complement production by brain-derived cells appear warranted. Inhibiting the synthesis of these key proteins, along with preventing their activation, has become a valid therapeutic strategy for diseases such as AD where complement activation can be detected in affected tissue.
Acknowledgements This work was supported by grants from the Alzheimer Society of British Columbia and the Jack Brown and Family AD research fund.
References w1x B.M. Bellander, H. von Holst, P. Fredman, M. Svensson, Activation of the complement cascade and increase of clusterin in the brain following a cortical contusion in the adult rat, J. Neurosurg. 85 Ž1996. 468–475. w2x R.B. Campbell, S.K.A. Law, K.B.M. Reid, R.B. Sim, Structure, organization and regulation of the complement genes, Annu. Rev. Immunol. 6 Ž1988. 161–195. w3x D.W. Dickson, S.C. Lee, L.A. Mattiace, S.H. Yen, C. Brosnan, Microglia and cytokines in neurological disease, with special reference to AIDS and Alzheimer’s disease, Glia 7 Ž1993. 75–83. w4x R.G. DiScipio, M.R. Gehring, E.R. Podack, C.C. Kan, T.E. Hugli, G.H. Fey, Nucleotide sequence of cDNA and derived amino acid sequence of human complement component C9, Proc. Natl. Acad. Sci. USA 81 Ž1984. 7298–7302. w5x P. Eikelenboom, C.E. Hack, J.M. Rozemuller, F.C. Stam, Complement activation in amyloid plaques in Alzheimer’s dementia, Virchows Arch. B 56 Ž1989. 259–262. w6x B. Fischer, H. Schmoll, P. Riederer, J. Bauer, D. Platt, A. PopaWagner, Complement C1q and C3 mRNA expression in the frontal cortex of Alzheimer’s patients, J. Mol. Med. 73 Ž1995. 465–471. w7x P. Gasque, P. Chan, M. Fontaine, A. Ischenko, M. Lamacz, O. Gotze, B.P. Morgan, Identification and characterization of the complement C5a anaphylatoxin receptor on human astrocytes, J. Immunol. 155 Ž1995. 4882–4889.
38
D.G. Walker et al.r Brain Research 809 (1998) 31–38
w8x P. Gasque, M. Fontaine, B.P. Morgan, Complement expression in human brain. Biosynthesis of terminal pathway components and regulators in human glial cells and cell lines, J. Immunol. 154 Ž1995. 4726–4733. w9x P. Gasque, A. Ischenko, J. Legoedec, C. Mauger, M.T. Schouft, M. Fontaine, Expression of the complement classical pathway by human glioma in culture. A model for complement expression by nerve cells, J. Biol. Chem. 268 Ž1993. 25068–25074. w10x D. Guc, P. Gulati, C. Lemercier, D. Lappin, G.D. Birnie, K. Whaley, Expression of the components and regulatory proteins of the alternative complement pathway and the membrane attack complex in normal and diseased synovium, Rheumatol. Int. 13 Ž1993. 139–146. w11x S. Haga, T. Aizawa, T. Ishii, K. Ikeda, Complement gene expression in mouse microglia and astrocytes in culture: comparisons with mouse peritoneal macrophages, Neurosci. Lett. 216 Ž1996. 191–194. w12x M. Hull, B.L. Fiebich, K. Lieb, S. Strauss, M. Berger, B. Volk, J. Bauer, Interleukin-6-associated inflammatory processes in Alzheimer’s Disease: new therapeutic options, Neurobiol. Aging 17 Ž1996. 795–800. w13x H. Jiang, D. Burdick, C.G. Glabe, C.W. Cotman, A.J. Tenner, Beta-Amyloid activates complement by binding to a specific region of the collagen-like domain of the C1q A chain, J. Immunol. 152 Ž1994. 5050–5059. w14x S.A. Johnson, C.S. Young-Chan, N.J. Laping, C.E. Finch, Perforant path transection induces complement C9 deposition in hippocampus, Exp. Neurol. 138 Ž1996. 198–205. w15x S.A. Johnson, M. Lampert-Etchells, G.M. Pasinetti, I. Rozovsky, C.E. Finch, Complement mRNA in the mammalian brain: responses to Alzheimer’s disease and experimental brain lesioning, Neurobiol. Aging 13 Ž1992. 641–648. w16x M. Lampert-Etchells, G.M. Pasinetti, C.E. Finch, S.A. Johnson, Regional localization of cells containing complement C1q and C4 mRNAs in the frontal cortex during Alzheimer’s disease, Neurodegeneration 2 Ž1993. 111–121. w17x S.C. Lee, D.W. Dickson, W. Liu, C.F. Brosnan, Induction of nitric oxide synthase activity in human astrocytes by interleukin-1 beta and interferon-gamma, J. Neuroimmunol. 1–2 Ž1993. 19–24. w18x M. Levi-Strauss, M. Mallat, Primary cultures of murine astrocytes produce C3 and factor B, two components of the alternative pathway of complement activation, J. Immunol. 139 Ž1987. 2361–2366. w19x W. Liu, B. Shafit-Zagardo, D.A. Aquino, M.L. Zhao, D.W. Dickson, C.F. Brosnan, S.C. Lee, Cytoskeletal alterations in human fetal astrocytes induced by interleukin-1 beta, J. Neurochem. 63 Ž1994. 1625–1634. w20x P.L. McGeer, H. Akiyama, S. Itagaki, E.G. McGeer, Activation of the classical complement pathway in brain tissue of Alzheimer patients, Neurosci. Lett. 107 Ž1989. 341–346. w21x P.L. McGeer, E.G. McGeer, The inflammatory response system of brain: implications for therapy of Alzheimer and other neurodegenerative diseases, Brain Res. Rev. 21 Ž1995. 195–218. w22x G. Moretto, R.Y. Xu, D.G. Walker, S.U. Kim, Coexpression of mRNA for neurotrophic factors in human neurons and glial cells in cultures, J. Neuropathol. Exp. Neurol. 53 Ž1994. 78–85. w23x G.M. Pasinetti, S.A. Johnson, I. Rozovsky, M. Lampert-Etchells, D.G. Morgan, M.N. Gordon, T.E. Morgan, D. Willoughby, C.E. Finch, Complement C1qB and C4 mRNAs responses to lesioning in rat brain, Exp. Neurol. 118 Ž1992. 117–125. w24x H.B. Pettersen, E. Johnson, T.E. Mollnes, P. Garred, Synthesis of soluble C3 and C9 neoepitopes by human alveolar macrophages in vitro, Scand. J. Immunol. 28 Ž1988. 431–434.
w25x J. Rogers, N.R. Cooper, S. Webster, J. Schultz, P.L. McGeer, S.D. Styren, W.H. Civin, L. Brachova, B. Bradt, P. Ward, I. Lieberburg, Complement activation by beta-amyloid in Alzheimer disease, Proc. Natl. Acad. Sci. USA 89 Ž1992. 10016–10020. w26x Y. Shen, R. Li, E.G. McGeer, P.L. McGeer, Neuronal expression of mRNAs for complement proteins of the classical pathway in Alzheimer brain, Brain Res. 769 Ž1997. 391–395. w27x J.G. Sheng, K. Ito, R.D. Skinner, R.E. Mrak, C.R. Rovnaghi, L.J. Van Eldik, W.S. Griffin, In vivo and in vitro evidence supporting a role for the inflammatory cytokine interleukin-1 as a driving force in Alzheimer pathogenesis, Neurobiol. Aging 17 Ž1996. 761–766. w28x J.G. Sheng, R.E. Mrak, W.S. Griffin, Microglial interleukin-1 alpha expression in brain regions in Alzheimer’s disease: correlation with neuritic plaque distribution, Neuropathol. Appl. Neurobiol. 21 Ž1995. 290–301. w29x I.N. Singh, G. Sorrentino, D.G. McCartney, R. Massarelli, J.N. Kanfer, Enzymatic activities during differentiation of the human neuroblastoma cells, LA-N-1 and LA-N-2, J. Neurosci. Res. 25 Ž1990. 476–485. w30x K. Sumiyoshi, A. Andoh, Y. Fujiyama, H. Sakumoto, T. Bamba, Biosynthesis and secretion of MHC class III gene products Žcomplement C4 and factor B. in the exocrine pancreas, J. Gastroenterol. 32 Ž1997. 367–373. w31x K. Terai, D.G. Walker, E.G. McGeer, P.L. McGeer, Neurons express proteins of the classical complement pathway in Alzheimer disease, Brain Res. 769 Ž1997. 385–390. w32x H. Tsukamoto, K. Nagasawa, Y. Ueda, T. Mayumi, I. Furugo, T. Tsuru, Y. Niho, Effects of cell differentiation on the synthesis of the third and fourth component of complement ŽC3, C4. by the human monocytic cell line U937, Immunology 77 Ž1992. 621–623. w33x R. Veerhuis, I. Janssen, C.E. Hack, P. Eikelenboom, Early complement components in Alzheimer’s disease brains, Acta Neuropathologica 91 Ž1996. 53–60. w34x P. Velazquez, D.H. Cribbs, T.L. Poulos, A.J. Tenner, Aspartate residue 7 in amyloid beta-protein is critical for classical complement pathway activation: implications for Alzheimer’s disease pathogenesis, Nature ŽMed.. 3 Ž1997. 77–79. w35x F. Vincent, H. de la Salle, A. Bohbot, J.P. Bergerat, G. Hauptmann, F. Oberling, Synthesis and regulation of complement components by human monocytesrmacrophages and by acute monocytic leukemia, DNA and Cell Biol. 12 Ž1993. 415–423. w36x D.G. Walker, S.U. Kim, P.L. McGeer, Complement and cytokine gene expression in cultured microglia derived from postmortem human brains, J. Neurosci. Res. 40 Ž1995. 478–493. w37x D.G. Walker, P.L. McGeer, Complement gene expression in human brains: comparison between normal and Alzheimer Disease cases, Mol. Brain Res. 14 Ž1992. 109–116. w38x D.G. Walker, P.L. McGeer, Complement gene expression in neuroblastoma and astrocytoma cell lines of human origin, Neurosci. Lett. 157 Ž1993. 99–102. w39x D.G. Walker, O. Yasuhara, P.A. Patston, E.G. McGeer, P.L. McGeer, Complement C1 inhibitor is produced by brain tissue and is cleaved in Alzheimer disease, Brain Res. 675 Ž1995. 75–82. w40x S. Webster, L.-F. Lue, L. Brachova, A.J. Tenner, P.L. McGeer, K. Terai, D.G. Walker, B. Bradt, N.R. Cooper, J. Rogers, Molecular and cellular characterization of the membrane attack complex, C5b-9, in Alzheimer’s disease, Neurobiol. Aging 18 Ž1997. 415–421. w41x D.P. Witte, T.R. Welch, L.S. Beischel, Detection and cellular localization of human C4 gene expression in the renal tubular epithelial cells and other extrahepatic epithelial sources, Am. J. Pathol. 139 Ž1991. 717–724.
Research report
Expression of complement C4 and C9 genes by human astrocytes Douglas G. Walker a
a, )
, Seung U. Kim b , Patrick L. McGeer
a
Kinsmen Laboratory of Neurological Research, Department of Psychiatry, UniÕersity of British Columbia, VancouÕer, British Columbia, Canada b DiÕision of Neurology, Department of Medicine, UniÕersity of British Columbia, VancouÕer, British Columbia, Canada Accepted 4 August 1998
Abstract Evidence exists that complement activation is involved in the pathogenesis of Alzheimer’s disease ŽAD.. It has been previously demonstrated that central nervous system ŽCNS. resident cells can synthesize complement proteins. Two key proteins in the complement pathway are the complement C4 and C9 proteins. Using reverse transcription–polymerase chain reaction, ELISA, immunocytochemical and immunoblot techniques, we showed that primary human astrocytes constitutively expressed complement C4 mRNA and protein, and that this was increased when cells were treated with interferon-g, but inhibited when cells were treated with interleukin-1b ŽIL-1b .. C4 immunoreactivity could be localized to GFAP-positive astrocytes when protein secretion was inhibited. These results indicated that astrocytes could be a source of complement C4 in the human CNS. In addition it was shown that stimulated astrocytes could also express complement C9 mRNA, though C9 protein was not detectable in culture supernatants. q 1998 Elsevier Science B.V. All rights reserved. Keywords: Tissue culture; ELISA; Inflammation; Alzheimer’s disease; Gene expression
1. Introduction Examination of brains from Alzheimer’s disease ŽAD. cases shows evidence for the deposition of activated complement proteins w5,20x. Senile plaques and neurofibrillary tangles become labeled with proteins that are immunoreactive with antibodies to complement system components C1q, C3d, C4d and C5b-9 w5,20x. The consequences of complement activation in the brain can include the production of proinflammatory peptide fragments, and the formation of the cytolytic membrane attack complex w21x. Several groups have demonstrated the presence of complement mRNAs, including for C1q, C3 and C4, in RNA extracted from human brain tissue of both normal and AD cases, with increased expression being present for a number of these genes in AD cases w16,23,37,40x. These data indicate that complement proteins present in brain could have been synthesized locally, and are not necessarily derived from the circulation. It was initially assumed that microglia Žbrain-resident macrophages. would be the source of complement proteins in the brain; however, astrocytes and neurons have also been shown to express some of the
) Corresponding author. Sun Health Research Institute, 10515 West Santa Fe Drive, Sun City, AZ 85351, USA. Fax: q1-602-876-5698; E-mail: [email protected]
complement proteins w8,23,26,31x. Primary human astrocytes have been reported to express C2, C3, C5, C6, C7 and C8, most of the complement inhibitor proteins w8x and certain complement receptors w7x. The regulation of C4 in brain-derived cells is of interest, as in an earlier study it was demonstrated that this gene was only expressed by human brain microglia that had been stimulated with interferon-g ŽIFN-g . w36x. This feature was also observed for human macrophage-like cells w32x. C4 expression has previously been demonstrated in human astrocytoma cell lines w9,38x; however, as these tumor cells appear to express complement genes in a less regulated manner than untransformed primary astrocytes, verification of the astrocytoma cell findings in primary human astrocytes was warranted. C4 mRNA expression has also been detected in astrocytes derived from neonatal mice brains w11x. Complement C4 is the product of two closely related genes, C4A and C4B, that are located in the class III region of the major histocompatibility complex ŽMHC. w2x. The protein is produced as a single polypeptide of approximately 210 kDa and is cleaved after synthesis into three polypeptide chains, the a , b, and g chains. The three chains are linked by thiolester bonds to make up functional C4 w2x. Although it is believed that the majority of the circulating C4 is synthesized in the liver, studies have shown a number of other cell types are capable of C4
0006-8993r98r$ - see front matter q 1998 Elsevier Science B.V. All rights reserved. PII: S 0 0 0 6 - 8 9 9 3 Ž 9 8 . 0 0 8 1 1 - 7
32
D.G. Walker et al.r Brain Research 809 (1998) 31–38
synthesis. These include monocytesrmacrophages, kidney epithelial cells, pancreatic epithelial cells, fibroblasts and chondrocytes w30,41x. Complement C9, the terminal component of the complement pathway, is an 80 kDa polypeptide. Upon activation of the terminal complement pathway, multiple C9 molecules can become incorporated into the C5b-9 membrane attack complex which becomes inserted into the cell membrane, potentially resulting in cell lysis. The cell types expressing this gene have not been characterized in as much detail as for C4. Although macrophages and transformed monocytic cells have been reported to secrete C9 w8,24x, other reports have not been able to demonstrate C9 expression by monocytesrmacrophages w10,35x or microglia w11,36x. Expression of C9 by primary human or murine astrocytes was not detected w8,11x. In situ hybridization and immunocytochemical studies have detected C9 mRNA and protein in neurons in human brain tissue sections w26,31x. Extracellular C9 deposition, and intracellular C9 was also detected by immunostaining in a subpopulation of hippocampal interneurons in rat brains lesioned by perforant pathway transection w14x. In this study, we report the expression of complement C4 mRNA and secretion of complement C4 by primary human fetal astrocytes under serum-free conditions. Unstimulated astrocytes secreted detectable amounts of C4, and the levels of this increased upon stimulation of cells with interferon-g, a proinflammatory cytokine, while interleukin-1b ŽIL-1b ., another proinflammatory cytokine, inhibited C4 secretion. We also report for the first time that primary human astrocytes can express the complement C9 gene, when appropriately stimulated.
2. Materials and methods 2.1. Reagents Interferon-gamma ŽIFN-g ., IL-1b and interleukin-6 ŽIL6. Žrecombinant. were obtained from Sigma ŽSt. Louis, MO. or Bachem California ŽTorrance, CA.. Cytokines were diluted to 50 ngrml in phosphate-buffered saline ŽPBS. containing 0.1% bovine serum albumin, aliquoted, and stored at y708C. OptiMEM reduced serum culture media and fetal bovine serum ŽFBS. were obtained from Life Technologies ŽGaithersburg, MD.. All other reagents were from Sigma, unless indicated. 2.2. Cell cultures Primary human astrocytes were derived from human embryonic brains Ž12–18 weeks of gestation. from legal and therapeutic abortions and prepared as described previously w22x. Astrocytes isolated from eight independent cases were used in this study. In each case, the astrocytes were used after the third subculture, and following at least
30 days in culture. Under these conditions, microglial or neuronal contamination could not be detected by immunocytochemical methods. Cells were grown in Dulbecco’s modified Eagle’s media-high glucose ŽDMEM. supplemented with 10% FBS and 50 mgrml gentamicin. Cultures were judged ) 98% pure on the basis of immunoreactivity with an antibody to glial fibrillary acidic protein ŽGFAP: DAKO, Carpinteria, CA.. The human hepatoma cell line HepG2 ŽAmerican Type Culture Collection, Rockville, MD. and the LA-N-2 human neuroblastoma cell line ŽDr. R.C. Seeger, Children’s Hospital, Los Angeles, CA. were also used in some experiments. Both cell lines were grown in the same media as the human astrocytes. LA-N-2 cells were differentiated to a neuronal phenotype by treatment for 5 days in 10y5 M retinoic acid before being used in experiments w29x. 2.3. Stimulation protocol Human astrocytes were plated at 2 = 10 5 cells in 60 mm petri dishes in DMEMq 10% FBS and allowed to adhere for 16 h. Cultures were rinsed twice with serum-free OptiMEM and refed with 4 ml of media containing different concentrations of cytokines or cytokine diluent. The media from each culture was harvested after 72 h, except where indicated, and stored at y708C prior to assay. 2.4. C4 ELISA A dual antibody ELISA was employed to measure C4 concentrations in culture media. This utilized a polyclonal antibody to C4 ŽQuidel, San Diego, CA. as capture antibody, and a monoclonal antibody to C4c ŽQuidel. as detection antibody. ELISA plates containing bound antibody were blocked with 1% skimmed milkr1% bovine serum albumin in Tris-buffered saline ŽTBS. Ž50 mM Tris–HCl ŽpH 8.0., 137 mM NaCl, 2.7 mM KCl.. Media from human astrocytes cultures or known amounts of C4 ŽQuidel., diluted in serum-free OptiMEM, were added to wells and incubated for 18 h at 48C. Following washes with TBS containing 0.05% Tween 20, wells were sequentially incubated with monoclonal anti-C4c Ž1 mgrml. for 2 h, alkaline phosphatase-labeled anti-mouse IgG Ž1:1000, Gibco-BRL. for 1 h and alkaline phosphatase substrate Ž1 mgrml p-nitrophenyl phosphate in 0.1 M diethanolaminerHCl ŽpH 9.8., 0.5 mM MgCl 2 .. The concentration of C4 in media was determined based on the optical density at 405 nm of the samples relative to a calibration curve obtained using known amounts of purified C4. The assay had a sensitivity of 100 pgrml and gave a linear response up to 20 ngrml. 2.5. ReÕerse transcription–polymerase chain reaction C4 and C9 mRNA expression was detected using reverse transcription–polymerase chain reaction methodol-
D.G. Walker et al.r Brain Research 809 (1998) 31–38
ogy ŽRT-PCR.. RNA preparation, complementary DNA ŽcDNA. syntheses, and PCR analyses were carried out as previously described w36x. The PCR primers used to detect C4 were sense primer 5X ATGGTTCCTATGCGGCTTGGTTGTC 3X and the antisense primer 5X GCGATGGTCACAAAGGCTGTGAGTG 3X , which produce a cDNA specific fragment of 256 bp w36x. The PCR primers used to detect C9 were sense primer 5X GAATGAGCCCCTGGAGTGAATGGTC 3X and the antisense primer 5X CATTTCCGCAGTCATCCTCAGCATC 3X , which produce a cDNA specific fragment of 180 bp w40x. Each sample was analyzed after at least two different numbers of cycles, to confirm that amplification of product had not reached a plateau. The identity of the C4 PCR product derived from astrocyte cDNA was confirmed by DNA sequencing of a cloned fragment w36x. The identity of the C9 fragment was confirmed by hybridization with an internal probe and by restriction endonuclease mapping w40x. 2.6. Immunocytochemistry The following protocol was used to localize C4 to cultured astrocytes. Cells were plated out onto coverslips in DMEMq 10% FBS, and allowed to adhere for 24 h. The cells were rinsed twice with serum-free OptiMEM and incubated for 48 h in the presence or absence of IFN-g Ž1000 unitsrml. in OptiMEM containing 1 mM monensin Žto reduce C4 secretion.. The cells were then fixed with 4% phosphate-buffered paraformaldehyde, rinsed with phosphate-buffered saline ŽPBS. and pretreated with PBS containing 0.1% saponin and 5% normal goat serum. Saponin Ž0.1%. was included in all subsequent buffers. Cells were incubated in monoclonal antibody to C4c ŽQuidel, 1:1000. for 18 h at room temperature, rinsed and bound antibody was detected by sequential reaction with a
33
biotin-labeled anti-mouse IgG Ž1:1000, Vector Laboratories, Burlingame, CA. and preformed avidin–biotin–peroxidase complex Ž1:2000, Vector Laboratories.. Bound antibody was detected by incubation of cells in diaminobenzidine-HCl Ž0.2 mgrml. in 50 mM Tris–HCl ŽpH 7.6., 0.05 M imidizole and 0.005% hydrogen peroxide. Cultures of untreated and IFN-g treated astrocytes were processed in parallel under the same reaction conditions. 2.7. Immunoblot analysis To confirm the specificity of the immunostaining result, parallel cultures of astrocytes Ž2 = 10 6 cellr60 mm dish. were prepared and processed as described for immunocytochemistry. At the end of the treatment period, cells were harvested by scraping into PBS, collected by centrifugation and frozen at y708C. Equivalent amounts of protein Ž25 mgrlane. were dissolved in SDS-sample buffer, separated through 7.5% polyacrylamide gels and transferred to Immobilon-P membrane ŽMillipore, Bedford, MA. as described previously w39x. Membranes were pretreated with 5% skimmed milk in TBS and incubated with the anti-C4c monoclonal antibody Ž1:1000. for 18 h at 48C. The bound antibody was detected as described previously w39x.
3. Results 3.1. Human astrocytes constitutiÕely express complement C4 mRNA In our earlier studies, we showed that human postmortem adult brain-derived microglia did not constitutively express detectable levels of C4 mRNA, but C4
Fig. 1. Panel A: Representative result of polymerase chain reaction analysis showing constitutive complement C4 mRNA expression by human astrocytes. Comparison was made with cDNA derived from HepG2 hepatoma cells. Lanes 1 Žastrocytes. and 2 ŽHepG2.: amplification for 30 cycles. Lanes 3 Žastrocytes. and 4 ŽHepG2.: amplification for 35 cycles. Panel B: Representative result of polymerase chain reaction analysis showing C4 mRNA expression after cytokine stimulation of human astrocytes. Figure shows an ethidium bromide stained gel demonstrating C4 specific bands from cDNA samples that had been amplified for 32 cycles. Lane 1: Control culture; lane 2: IL-1b treated culture; lane 3: IL-6 treated culture; lane 4: IFN-g treated culture; lane 5: IL-1brIFN-g treated culture.
34
D.G. Walker et al.r Brain Research 809 (1998) 31–38
expression could be induced when these cells were stimulated with IFN-g w36x. As we previously showed that normal human brains expressed C4 mRNA w37x, these data indicated that other types of cells in the brain may express complement C4. Using RT-PCR, we now show that complement C4 mRNA can be readily detected in cultured human astrocytes isolated from fetal brains Žexample; Fig. 1A, lanes 1 and 3.. For comparison, the level of C4 expression was compared with that of HepG2 cells ŽFig. 1A, lanes 2 and 4., a human hepatoma cell line with many of the properties of liver hepatocytes. A consistent increase in C4 mRNA expression was apparent in cultures treated with IL-6, IFN-g, or IL-1brIFN-g ŽFig. 1B, lanes 3–5., compared with control cultures ŽFig. 1B, lane 1., but not in IL-1b-treated cultures ŽFig. 1B, lane 2.. 3.2. Human astrocytes secrete complement C4 An ELISA assay was used to quantify the secretion of C4 by human astrocytes prepared from five different cases, and to study some of the factors regulating its secretion. To prevent the possibility of detecting cross-reacting C4 protein present in FBS, and to model more closely the in vivo situation, experiments were carried out by incubating astrocyte cultures in serum-free media. In serum-free Opti-
MEM, the astrocytes developed heterogeneous morphology, with cells having either a process-bearing or flat profile Žexample Fig. 3A.. The effects of stimulation with IFN-g, IL-1b, or a combination of both, on secretion of C4 are shown in Fig. 2. As there was variability in basal levels of C4 expression between cases, which might be expected considering the genetically diverse human material used to prepare the astrocyte cultures, results are expressed as the percentage increase or decrease relative to unstimulated cultures. Basal levels of C4 secretion ranged from 19 ngr10 6 cells to 114 ngr10 6 cells after 72 h incubation, while after treatment with 100 unitsrml of IFN-g, concentrations of secreted C4 ranged from 121 to 470 ngr10 6 cells after 72 h. Treatment with IFN-g Ž100 unitsrml. had a significant stimulatory effect on C4 secretion Ž p s 0.0342, n s 5: Student paired t-test.. Stimulation with this cytokine increased C4 secretion from 2.5 fold to 10.2 fold compared with their corresponding control cultures. When using serum-free culture conditions, there was no significant change in total cellular protein in the cultures treated with IFN-g compared to control cultures. The inhibition of C4 secretion by IL-1b was significant, though the effect of IL-1b on increasing C4 secretion by IFN-g treated cultures did not reach statistical significance.
Fig. 2. Cytokine modulation of C4 secretion by human astrocytes measured by ELISA of culture supernatants. Results show percent changes in C4 secretion by cells treated with IL-1b ŽIL1–unitsrml. Žshowing inhibition., and IFN-g Žunitsrml. Žshowing stimulation. relative to unstimulated cells. Results represent mean " S.E.M. of five independent cultures. Combination of IL-1b and IFN-g Žmean " S.E.M. of four independent cultures. appeared to show a further increase in C4 secretion, but the difference compared with cultures stimulated with IFN-g alone did not reach statistical significance.
D.G. Walker et al.r Brain Research 809 (1998) 31–38
3.3. Colocalization of C4 immunoreactiÕity in astrocytes To confirm that C4 was being produced by human astrocytes, localization of C4 in GFAP immunoreactive astrocytes was demonstrated. To reduce the amount of C4 protein secreted by the cells, and to allow it to accumulate within cells, astrocyte cultures were treated with 1 mM monensin, which causes the protein to accumulate in the Golgi complex. In earlier experiments we failed to demonstrate C4 immunoreactivity within cells when secretion of the protein was not inhibited. This would indicate that the C4 protein is rapidly secreted after synthesis. The results show that GFAP immunoreactivity can be identified in all of the cells in the culture ŽFig. 3A.. Matched cultures to these, but treated with 1 mM monensin ŽFig. 3B. and cultures treated with 1 mM monensin and IFN-g ŽFig. 3C. showed intracellular immunoreactivity with an antibody to C4c. Considerably increased immunoreactivity for C4 is apparent in the IFN-g treated culture ŽFig. 3C.. Treatment
35
of cultures with 1 mM monensin caused a noticeable change in morphology, possibly due to its sodium ionophore properties. Prolonged incubation of cultures Žmore than 60 h. in media containing 1 mM monensin caused observable amounts of cell death. To confirm these immunocytochemical observations by immunoblot analysis, parallel cultures of unstimulated, IFN-g and IL-1brIFN-g stimulated astrocyte cultures were treated for 48 h with 1 mM monensin, to cause an intracellular accumulation of C4. The reduction of C4 secretion was confirmed by ELISA analysis of some of the culture supernatants Ždata not shown.. Immunoblot analysis of extracts of the cells showed that bands corresponding to unprocessed prepro-C4 Župper band. and cleaved C4 Žlower band corresponds to the 75 kDa C4b chain. could be readily detectable in the IFN-g stimulated cultures ŽFig. 3D, lanes 2 and 4.. These data confirmed that C4 protein could be detected in enriched astrocyte cultures. In the unstimulated cultures, faint but detectable bands corre-
Fig. 3. Localization of C4 in human astrocytes. Representative result showing that C4 immunoreactivity Žpanels B and C. can be detected in GFAP-immunoreactive astrocytes Žpanel A.. Increased C4 immunoreactivity can be observed in the culture treated with IFN-g Ž1000 unitsrml. Žpanel C.. Panel D. Immunoblot analysis for the detection of C4 protein in human astrocytes. Two different sets of cultures were treated with 1 mM monensin to reduce the amount of C4 protein secretion. Lane 1: unstimulated Žset 1.; lane 2: IFN-g stimulated Ž1000 unitsrml.Žset 1.; lane 3: unstimulated Žset 2.; lane 4: IFN-g stimulated Ž1000 unitsrml.Žset 2.; lane 5: IL-1brIFN-g stimulated Ž200r1000 unitsrml.Žset 2.. Arrows on right indicate position of molecular weight markers.
36
D.G. Walker et al.r Brain Research 809 (1998) 31–38
Fig. 4. Expression of complement C9 mRNA detected by polymerase chain reaction analysis. Figure shows ethidium bromide stained gel demonstrating C9 specific bands from cDNA samples that had been amplified for 40 cycles. Lane 1 and 2. cDNA from differentiated LA-N-2 neuroblastoma cell that were unstimulated or stimulated with IFN-g Ž1000 unitsrml.. Lanes 3–12: cDNA from different preparations of human astrocytes. All cultures were maintained in serum-free media except in lane 9. Lane 3: unstimulated human astrocytes Žset 1.. Lanes 4–9: unstimulated and stimulated human astrocytes Žset 2.. Lane 4: unstimulated; lane 5: IL-6 Ž200 unitsrml.; lane 6: IFN-g Ž1000 unitsrml.; lane 7: IL-1b Ž200 unitsrml.; lane 8: IFN-grIL-1b, Ž1000r200 unitsrml.; lane 9: unstimulated astrocytes maintained in serum-containing media; lane 10: unstimulated Žset 3.; lane 11: IFN-g Ž1000 unitsrml. set 3; lane 12: unstimulated Žset 4..
sponding to the prepro-C4 polypeptide could also be detected. In the cultures stimulated with IL-1brIFN-g, the C4b polypeptide appeared to be cleaved further to a band with a molecular weight of approximately 68 kDa ŽFig. 3D, lane 5..
prove possible to detect C9 protein in supernatants from a number of different astrocyte cultures. This was carried out using a sensitive immunodot method combined with chemiluminescent detection, which was able to detect 50 pg of purified C9 under the same conditions Ždata not shown..
3.4. ActiÕated human astrocytes express C9 mRNA To determine whether astrocytes, as opposed to astrocytoma cells w8,38x, have the potential to express the C9 gene, and thus could be contributing to the C9 mRNA and protein that can be detected in central nervous system ŽCNS. tissue, cDNA samples derived from several different sets of astrocyte cultures were analyzed by RT-PCR. It had been reported that human or mouse astrocytes did not express C9 mRNA w8,11x. Our results showed that human astrocytes could be stimulated by IL-1b, IFN-g or IL-6 to express C9 mRNA Žrepresentative results Fig. 4.. Under serum-free conditions, basal expression of C9 mRNA could not be detected ŽFig. 4., lanes 3, 4, 10 and 12. For comparison, the expression of C9 by unstimulated and stimulated differentiated neuroblastoma cells was studied. C9 mRNA could also be detected in differentiated LA-N-2 neuroblastoma cells stimulated with IFN-g ŽFig. 4, lane 2.. Other cytokines were not tested on these cells. Recent data have shown the expression of C9 mRNA and protein in neurons in human brains w26,31x. Interestingly, unstimulated astrocytes grown in media containing 10% FBS did express detectable amounts of C9 mRNA ŽFig. 4, lane 9.. Overall, the levels of C9 mRNA in all these cells appeared low, as it required 40 amplification cycles in order to readily detect the formation of the 180 bp bands. Only the most intense band ŽFig. 4, lane 6. was detectable in these same samples after 35 cycles of amplification. This may be the reason for the previously reported negative results in astrocyte samples of human and mouse w8,11x. It did not
4. Discussion A number of antibodies for complement proteins have been shown to identify neurodegeneration associated structures in brain tissue from individuals affected by diseases such as AD. These proteins include C3d, C4d and C5b-9 w20,33,40x. The presence of C4 activation fragments is indicative of activation of the classical complement pathway, while the presence of C3d and C5b-9 can arise following activation of either the classical or alternative pathways. Immunohistochemical staining of brain sections for C1q have confirmed that complement activation appears to be mediated by an antibody-independent initiation of the classical pathway w21,25x. It has been shown in in vitro studies that complement activation can occur by the binding of C1q to Ab peptide w13,25,34x. Evidence exists that complement proteins can be produced in the brain by CNS resident cells. Messenger RNA for all classical complement pathway components have been detected in RNA extracted from brain tissue w33,37,40x and by in situ hybridization on brain tissue sections w6,15,16,26x. Although the in situ hybridization studies have surprisingly shown that neurons can express mRNA for various complement proteins, expression of complement mRNA by glial cells cannot be ruled out w15x. In this study, C4 mRNA was localized to both neurons and glial cells w15x. Cultured microglia have been shown to express C1q, C2, C3 and C4 w11,36x and human astrocytes or astrocytoma cells can also express a range of complement
D.G. Walker et al.r Brain Research 809 (1998) 31–38
proteins w8,9,18x. A difference in patterns of expression of various complement genes between human astrocytes and astrocytoma cells is apparent w8x. Although expression of C4 by astrocytoma cells has been shown w9,38x, results for C4 expression have not been published. In the results obtained in this study by non-transformed human astrocytes, it was shown that C4 secretion was increased by IFN-g treatment, consistent with reports for other cell types; however, in this study it was also observed that IL-1b could inhibit secretion of C4. Increased numbers of IL-1b immunoreactive microglia, localized to AD-type pathology, have been observed in affected brain tissue w3,27,28x. IL-1b has been reported to convert flat astrocytes into process-bearing astrocytes and that this effect was more pronounced in the absence of serum w19x. This was the predominant morphology of the cultures in this study, once they were switched from serum containing to serum-free media. There appeared to be a noticeably different effect on C4 expression when cultures were treated with IL-1b and IFN-g combined, compared with either cytokine alone. Similar to the observations of others w17x, we observed in preliminary experiments that astrocyte cultures treated with both cytokines produced relatively large amounts of nitric oxide Ždata not shown.. This induction appeared to be associated with an observable toxic effect on the astrocytes that were incubated in serum-free media. Treatment of cultures with either of these cytokines alone did not induce nitric oxide production or any observable toxic effect. The mechanism of this cytokine interaction is not understood. The increased amounts of C4 protein in the media of cultures treated with IL-1brIFN-g may be related to this interaction; however, it is possible that the increased release of C4 may be due to a toxic effect of the nitric oxide causing greater release of C4 from the cells. There was no evidence of increased C4 mRNA in such cultures, and also the difference in the molecular weight of the C4b polypeptide band shown on the immunoblot ŽFig. 3D, lane 5. would suggest nonspecific proteolysis. There have been few studies describing the cell types that express C9 and produce this protein. It was assumed that C9 is primarily derived from liver hepatocytes w4,35x though other cell types have been implicated w26x. Induction of C9 mRNA in human astrocytes was observed after stimulation by the proinflammatory cytokines IL-1b, IL-6 and IFN-g. IL-1 and IL-6 immunoreactivities have been localized in AD-affected brains w3,12x, and may be contributing to the induction of C9 expression that occurs in such tissue w26,31,40x. As human astrocytes have been shown to express all of the other complement proteins except C1q w8,9x, it would be surprising if this cell type could not express C9. Expression of this gene has previously been detected in astrocytoma cells w9,38x. It is clear from the mRNA results, the levels of C9 expression in the cytokine stimulated astrocytes are relatively low. Interestingly, C9 mRNA could also be induced in neuronal-like
37
cells, differentiated from neuroblastoma cells, that had been stimulated with IFN-g, but not in unstimulated cultures. Neuronal expression of C9 has been observed in vivo in both human and lesioned rat brains w14,26,31x. The membrane attack complex, which consists mainly of polymerized C9 molecules, has been demonstrated on membranous AD pathological structures w20,40x. Expression of C9 mRNA was detectable in synovial membranes from patients with rheumatoid and osteoarthritis, both diseases having a strong inflammatory nature w10x, though the cell typeŽs. producing the mRNA were not identified. C9 deposition has also been detected as a consequence of experimental insults to rat brains w1,14x. Further studies will be required to assess whether the failure to detect secreted C9 by human astrocytes was due to the use of an insufficiently sensitive detection technique, or whether the C9 mRNA is not effectively translated into protein. Due to the potential significance of brain-produced complement proteins to AD pathogenesis, further studies on the expression and regulation of complement production by brain-derived cells appear warranted. Inhibiting the synthesis of these key proteins, along with preventing their activation, has become a valid therapeutic strategy for diseases such as AD where complement activation can be detected in affected tissue.
Acknowledgements This work was supported by grants from the Alzheimer Society of British Columbia and the Jack Brown and Family AD research fund.
References w1x B.M. Bellander, H. von Holst, P. Fredman, M. Svensson, Activation of the complement cascade and increase of clusterin in the brain following a cortical contusion in the adult rat, J. Neurosurg. 85 Ž1996. 468–475. w2x R.B. Campbell, S.K.A. Law, K.B.M. Reid, R.B. Sim, Structure, organization and regulation of the complement genes, Annu. Rev. Immunol. 6 Ž1988. 161–195. w3x D.W. Dickson, S.C. Lee, L.A. Mattiace, S.H. Yen, C. Brosnan, Microglia and cytokines in neurological disease, with special reference to AIDS and Alzheimer’s disease, Glia 7 Ž1993. 75–83. w4x R.G. DiScipio, M.R. Gehring, E.R. Podack, C.C. Kan, T.E. Hugli, G.H. Fey, Nucleotide sequence of cDNA and derived amino acid sequence of human complement component C9, Proc. Natl. Acad. Sci. USA 81 Ž1984. 7298–7302. w5x P. Eikelenboom, C.E. Hack, J.M. Rozemuller, F.C. Stam, Complement activation in amyloid plaques in Alzheimer’s dementia, Virchows Arch. B 56 Ž1989. 259–262. w6x B. Fischer, H. Schmoll, P. Riederer, J. Bauer, D. Platt, A. PopaWagner, Complement C1q and C3 mRNA expression in the frontal cortex of Alzheimer’s patients, J. Mol. Med. 73 Ž1995. 465–471. w7x P. Gasque, P. Chan, M. Fontaine, A. Ischenko, M. Lamacz, O. Gotze, B.P. Morgan, Identification and characterization of the complement C5a anaphylatoxin receptor on human astrocytes, J. Immunol. 155 Ž1995. 4882–4889.
38
D.G. Walker et al.r Brain Research 809 (1998) 31–38
w8x P. Gasque, M. Fontaine, B.P. Morgan, Complement expression in human brain. Biosynthesis of terminal pathway components and regulators in human glial cells and cell lines, J. Immunol. 154 Ž1995. 4726–4733. w9x P. Gasque, A. Ischenko, J. Legoedec, C. Mauger, M.T. Schouft, M. Fontaine, Expression of the complement classical pathway by human glioma in culture. A model for complement expression by nerve cells, J. Biol. Chem. 268 Ž1993. 25068–25074. w10x D. Guc, P. Gulati, C. Lemercier, D. Lappin, G.D. Birnie, K. Whaley, Expression of the components and regulatory proteins of the alternative complement pathway and the membrane attack complex in normal and diseased synovium, Rheumatol. Int. 13 Ž1993. 139–146. w11x S. Haga, T. Aizawa, T. Ishii, K. Ikeda, Complement gene expression in mouse microglia and astrocytes in culture: comparisons with mouse peritoneal macrophages, Neurosci. Lett. 216 Ž1996. 191–194. w12x M. Hull, B.L. Fiebich, K. Lieb, S. Strauss, M. Berger, B. Volk, J. Bauer, Interleukin-6-associated inflammatory processes in Alzheimer’s Disease: new therapeutic options, Neurobiol. Aging 17 Ž1996. 795–800. w13x H. Jiang, D. Burdick, C.G. Glabe, C.W. Cotman, A.J. Tenner, Beta-Amyloid activates complement by binding to a specific region of the collagen-like domain of the C1q A chain, J. Immunol. 152 Ž1994. 5050–5059. w14x S.A. Johnson, C.S. Young-Chan, N.J. Laping, C.E. Finch, Perforant path transection induces complement C9 deposition in hippocampus, Exp. Neurol. 138 Ž1996. 198–205. w15x S.A. Johnson, M. Lampert-Etchells, G.M. Pasinetti, I. Rozovsky, C.E. Finch, Complement mRNA in the mammalian brain: responses to Alzheimer’s disease and experimental brain lesioning, Neurobiol. Aging 13 Ž1992. 641–648. w16x M. Lampert-Etchells, G.M. Pasinetti, C.E. Finch, S.A. Johnson, Regional localization of cells containing complement C1q and C4 mRNAs in the frontal cortex during Alzheimer’s disease, Neurodegeneration 2 Ž1993. 111–121. w17x S.C. Lee, D.W. Dickson, W. Liu, C.F. Brosnan, Induction of nitric oxide synthase activity in human astrocytes by interleukin-1 beta and interferon-gamma, J. Neuroimmunol. 1–2 Ž1993. 19–24. w18x M. Levi-Strauss, M. Mallat, Primary cultures of murine astrocytes produce C3 and factor B, two components of the alternative pathway of complement activation, J. Immunol. 139 Ž1987. 2361–2366. w19x W. Liu, B. Shafit-Zagardo, D.A. Aquino, M.L. Zhao, D.W. Dickson, C.F. Brosnan, S.C. Lee, Cytoskeletal alterations in human fetal astrocytes induced by interleukin-1 beta, J. Neurochem. 63 Ž1994. 1625–1634. w20x P.L. McGeer, H. Akiyama, S. Itagaki, E.G. McGeer, Activation of the classical complement pathway in brain tissue of Alzheimer patients, Neurosci. Lett. 107 Ž1989. 341–346. w21x P.L. McGeer, E.G. McGeer, The inflammatory response system of brain: implications for therapy of Alzheimer and other neurodegenerative diseases, Brain Res. Rev. 21 Ž1995. 195–218. w22x G. Moretto, R.Y. Xu, D.G. Walker, S.U. Kim, Coexpression of mRNA for neurotrophic factors in human neurons and glial cells in cultures, J. Neuropathol. Exp. Neurol. 53 Ž1994. 78–85. w23x G.M. Pasinetti, S.A. Johnson, I. Rozovsky, M. Lampert-Etchells, D.G. Morgan, M.N. Gordon, T.E. Morgan, D. Willoughby, C.E. Finch, Complement C1qB and C4 mRNAs responses to lesioning in rat brain, Exp. Neurol. 118 Ž1992. 117–125. w24x H.B. Pettersen, E. Johnson, T.E. Mollnes, P. Garred, Synthesis of soluble C3 and C9 neoepitopes by human alveolar macrophages in vitro, Scand. J. Immunol. 28 Ž1988. 431–434.
w25x J. Rogers, N.R. Cooper, S. Webster, J. Schultz, P.L. McGeer, S.D. Styren, W.H. Civin, L. Brachova, B. Bradt, P. Ward, I. Lieberburg, Complement activation by beta-amyloid in Alzheimer disease, Proc. Natl. Acad. Sci. USA 89 Ž1992. 10016–10020. w26x Y. Shen, R. Li, E.G. McGeer, P.L. McGeer, Neuronal expression of mRNAs for complement proteins of the classical pathway in Alzheimer brain, Brain Res. 769 Ž1997. 391–395. w27x J.G. Sheng, K. Ito, R.D. Skinner, R.E. Mrak, C.R. Rovnaghi, L.J. Van Eldik, W.S. Griffin, In vivo and in vitro evidence supporting a role for the inflammatory cytokine interleukin-1 as a driving force in Alzheimer pathogenesis, Neurobiol. Aging 17 Ž1996. 761–766. w28x J.G. Sheng, R.E. Mrak, W.S. Griffin, Microglial interleukin-1 alpha expression in brain regions in Alzheimer’s disease: correlation with neuritic plaque distribution, Neuropathol. Appl. Neurobiol. 21 Ž1995. 290–301. w29x I.N. Singh, G. Sorrentino, D.G. McCartney, R. Massarelli, J.N. Kanfer, Enzymatic activities during differentiation of the human neuroblastoma cells, LA-N-1 and LA-N-2, J. Neurosci. Res. 25 Ž1990. 476–485. w30x K. Sumiyoshi, A. Andoh, Y. Fujiyama, H. Sakumoto, T. Bamba, Biosynthesis and secretion of MHC class III gene products Žcomplement C4 and factor B. in the exocrine pancreas, J. Gastroenterol. 32 Ž1997. 367–373. w31x K. Terai, D.G. Walker, E.G. McGeer, P.L. McGeer, Neurons express proteins of the classical complement pathway in Alzheimer disease, Brain Res. 769 Ž1997. 385–390. w32x H. Tsukamoto, K. Nagasawa, Y. Ueda, T. Mayumi, I. Furugo, T. Tsuru, Y. Niho, Effects of cell differentiation on the synthesis of the third and fourth component of complement ŽC3, C4. by the human monocytic cell line U937, Immunology 77 Ž1992. 621–623. w33x R. Veerhuis, I. Janssen, C.E. Hack, P. Eikelenboom, Early complement components in Alzheimer’s disease brains, Acta Neuropathologica 91 Ž1996. 53–60. w34x P. Velazquez, D.H. Cribbs, T.L. Poulos, A.J. Tenner, Aspartate residue 7 in amyloid beta-protein is critical for classical complement pathway activation: implications for Alzheimer’s disease pathogenesis, Nature ŽMed.. 3 Ž1997. 77–79. w35x F. Vincent, H. de la Salle, A. Bohbot, J.P. Bergerat, G. Hauptmann, F. Oberling, Synthesis and regulation of complement components by human monocytesrmacrophages and by acute monocytic leukemia, DNA and Cell Biol. 12 Ž1993. 415–423. w36x D.G. Walker, S.U. Kim, P.L. McGeer, Complement and cytokine gene expression in cultured microglia derived from postmortem human brains, J. Neurosci. Res. 40 Ž1995. 478–493. w37x D.G. Walker, P.L. McGeer, Complement gene expression in human brains: comparison between normal and Alzheimer Disease cases, Mol. Brain Res. 14 Ž1992. 109–116. w38x D.G. Walker, P.L. McGeer, Complement gene expression in neuroblastoma and astrocytoma cell lines of human origin, Neurosci. Lett. 157 Ž1993. 99–102. w39x D.G. Walker, O. Yasuhara, P.A. Patston, E.G. McGeer, P.L. McGeer, Complement C1 inhibitor is produced by brain tissue and is cleaved in Alzheimer disease, Brain Res. 675 Ž1995. 75–82. w40x S. Webster, L.-F. Lue, L. Brachova, A.J. Tenner, P.L. McGeer, K. Terai, D.G. Walker, B. Bradt, N.R. Cooper, J. Rogers, Molecular and cellular characterization of the membrane attack complex, C5b-9, in Alzheimer’s disease, Neurobiol. Aging 18 Ž1997. 415–421. w41x D.P. Witte, T.R. Welch, L.S. Beischel, Detection and cellular localization of human C4 gene expression in the renal tubular epithelial cells and other extrahepatic epithelial sources, Am. J. Pathol. 139 Ž1991. 717–724.