- Email: [email protected]
Expression of DCC in differentiating ameloblasts from developing tooth germs in rats
archives of oral biology 54 (2009) 563–569
available at www.sciencedirect.com
journal homepage: www.intl.elsevierhealth.com/journals/arob
Expression of DCC in differentiating ameloblasts from developing tooth germs in rats H.J. Kim b, S.K. Jeon a, J.H. Kang a, M.S. Kim a, H.M. Ko a, J.Y. Jung a, J.T. Koh a, W.J. Kim a, E.J. Lee a, H.P. Lim a, S.H. Kim a,* a
Dental Science Research Institute, 2nd Stage of Brain Korea 21 for School of Dentistry, Chonnam National University, Gwangju 500-757, South Korea b Department of Oral Anatomy, School of Dentistry, Institute of Biotechnology, Wonkwang University, Iksan 570-749, South Korea
article info
abstract
Article history:
Objective: This study examined the expression pattern of the Deleted-in-colorectal-carci-
Accepted 11 March 2009
noma (DCC) gene in developing rat tooth germs. Methods: Rat pups at 4, 7 and 10 d postpartum were used in this study. Reverse transcription-
Keywords:
polymerase chain reaction (RT-PCR) and immunofluorescent localization were used to
DCC
determine the level of DCC expression during tooth development.
Ameloblasts
Results: There was more than 2-fold higher level of DCC mRNA in the rat 2nd maxillary
Differentiation
molar tooth germs on 10 d postpartum, which was the root stage, than in the rat 3rd
Tooth development
maxillary molar tooth germ, which was at the cap/early bell development stage. In addition,
Enamel formation
the levels of DCC mRNA in the 2nd maxillary molar germs at 4, 7 and 10 d postpartum increased gradually according to tooth development. Interestingly, immunoreactivity against DCC was specifically detected in the differentiating ameloblasts. DCC was observed in the lateral and apical sides of the newly differentiating and secretory stage ameloblasts. Afterwards, DCC was localized only in the apical side of the maturation stage ameloblasts, not in the lateral side. Conclusion: DCC is expressed in the differentiating ameloblasts, which suggests that this molecule plays a crucial role in amelogenesis. # 2009 Elsevier Ltd. All rights reserved.
1.
Introduction
The earliest morphogenetic events of tooth development begin as a thickening of the oral epithelium. The oral epithelium invaginates into the ectomesenchyme, resulting in the formation of an epithelial tooth bud that provides the initial signals for condensation of the underlying ectomesenchymal cells.1,2 After the bud stage, the tooth germ develops into the cap and bell stages, at which both epithelial and ectomesenchymal cells participate in the successive steps
of morphodifferentiation and cytodifferentiation for tooth formation by interacting with various molecules.3,4 Morphodifferentiation of the enamel organ from the oral epithelium results in the formation of the outer enamel epithelium, stellate reticulum, stratum intermedium and inner enamel epithelium. This gives rise to ameloblasts undergoing several differentiation processes: the presecretory, secretory and maturation stages.5 In the secretory and maturation stages, ameloblasts are involved in the formation of the enamel matrix. They are characterized by cell–cell adhesion contacts,
* Corresponding author at: Department of Oral Anatomy, School of Dentistry, Chonnam National University, Yongbongdong, Gwangju 500757, South Korea. Tel.: +82 62 530 4822; fax: +82 62 530 4829. E-mail address: [email protected] (S.H. Kim). 0003–9969/$ – see front matter # 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.archoralbio.2009.03.003
564
archives of oral biology 54 (2009) 563–569
and express various molecules related to the cell–cell adhesion apparatus. Cell–cell adhesion during the differentiation of ameloblasts plays important roles in tooth morphogenesis, and there have been many studies on the presence of celladhesion molecules during this process. Cell–cell adhesion is a crucial process in tooth morphogenesis and several molecules that mediate the adhesion are expressed in a spatiotemporal manner during tooth development.6–9 There are two distinct mechanisms of cell–cell adhesion: Ca2+-dependent and Ca2+-independent.10,11 Of the molecules that mediate Ca2+-dependent cell–cell adhesion during tooth morphogenesis, cadherins have been studied the most.12–14 The Ca2+-independent cell-adhesion molecules are Deleted-in-colorectal-carcinoma (DCC) and neural cell-adhesion molecule (N-CAM).15 DCC is a member of the immunoglobulin (Ig) superfamily and is a type I transmembrane receptor that shares the highest similarity to N-CAM.16,17 It contains four immunoglobulin domains, six type III fibronectin repetitions and a cytoplasmic domain consisting of P1, P2 and P3.18,19 In many developing organs including the tooth, NCAM is an important mediator for the regulation of morphogenesis.20–23 However, about the role of DCC in tooth development is unclear. It was reported that DCC functions as an axonal chemoattractant during axon guidance24 and as an antagonistic effector on the lar-tp (leukocyte-common antigen-related tyrosine phosphatase) function25 in the nervous system. Recently, we reported the existence of lar-tp in molar tooth development.26 Therefore, it is possible that DCC may be also involved in tooth development. This study examined the expression patterns of DCC throughout tooth development to determine its involvement in tooth morphogenesis.
2.
Materials and methods
2.1.
Animals
Sprague–Dawley adult rats were purchased from Daehan Biolink (Korea) and mated. The birthday of the pups after mating was designated as 0 day (0 d) postpartum. Rat pups at 4, 7 and 10 d postpartum were used. All experiments were carried out in accordance with the guidelines of Chonnam National University’s Animal Care and Use Committee.
2.2. Preparation of tissue sections and morphological analysis Portions of the maxilla and mandible containing the developing molar and incisor tooth germs were isolated from the rat pups at 4, 7, and 10 d postpartum. The tooth germs were immersion-fixed in a 4% paraformaldehyde solution overnight, followed by decalcification with 20% ethylene diamine tetra-acetic acid (pH 7.4) for 8 weeks. The tooth germs were then dehydrated in a graded series of ethanol and embedded in paraffin. Four microns thick sagittal sections were cut for hematoxylin–eosin and immunofluorescent staining.
2.3.
Isolation of RNA from the molar tooth germs
The rat pups at 4, 7, and 10 d postpartum were sacrificed, and the gingivae and alveolar bone were removed carefully to expose the 2nd and 3rd molar tooth germs. The molar tooth germs together with their follicular tissues were extracted from the tooth crypts. The total RNA was isolated from the tooth germs using TRIzol (Molecular Research Center Inc., OH, USA) and quantified using a spectrophotometer.
2.4.
RT-PCR
The expression of DCC, ameloblastin, amelogenin and enamelin was assessed by RT-PCR. cDNA synthesis for the reverse transcription was conducted at 42 8C using AccPower1 RT PreMix (Bioneer, Daejeon, Korea). The PCR reaction was carried out on a GeneAmp PCR system 2400 (Applied Biosystems/PerkinElmer, CA, USA) using AccPower1 PCR PreMix (Bioneer, Daejeon, Korea). Table 1 lists the primer sequences and expected product sizes. The PCR products were visualized with ethidium bromide and sequenced for confirmation. The product size was checked using a 100 bp marker (Takara, Shiga, Japan). The images were quantified by densitometric scanning and analysed using Scion image (Scion, MD, USA).
2.5.
Immunofluorescent staining
Immunofluorescent staining was carried out using a TSATM kit (Invitrogen, CA, USA). Briefly, after blocking the endogenous
Table 1 – Sequences of oligonucleotide primers for RT-PCR. Primer sequences 0
0
Amplicon Size (bp)
Temp
GenBank accession no.
DCC
F: 5 TTCCGCCATGGTTTTTAAATC 3 R: 50 CACTATCTGAAAATAATCACT 30
153
58 8C
NM_012841.1
Ameloblastin
F: 50 TACCAATAATGGATTTTGCC 30 R: 50 AGTAAAGTCTCCTCCCTTGG 30
299
50 8C
NM_012900
Amelogenin
F: 50 CAGCCGTATCCTTCCTATGG 30 R: 50 CTTCTTCCCGCTTGGTCTTG 30
442
55 8C
U01245
Enamelin
F: 50 CACACACAGTGAAGTCCAAG 30 R: 50 GTCCTGTTGACTGGTGTCTT 30
298
62 8C
XM001073517
GAPDH
F: 50 CCATGGAGAAGGCTGGGG 30 R: 50 CAAAGTTGTCATGGATGACC 30
195
65 8C
AF_106860
archives of oral biology 54 (2009) 563–569
peroxidase with 1% H2O2, the deparaffinized sections were reacted overnight with goat polyclonal anti-DCC (Santa Cruz Biotechnology, Delaware, CA, USA), and then with the HRPconjugated secondary antibody. The sections were then incubated in a Tyramide working solution. The reactants were imaged using a LSM confocal microscope (Carl Zeiss, Germany). The primary antibodies were substituted with normal serum for the negative control.
565
3.
Results
d postpartum, the maxillary 2nd molar tooth germs were at the crown stage showing the formation of enamel matrix. At this stage, the ameloblasts in the cuspal regions progressed to the maturation stage, whereas the ameloblasts in the future fossa areas were newly differentiated in the secretory stage (Fig. 1C). In contrast to the 3rd molar tooth germs at 10 d postpartum, the maxillary 2nd molar tooth germs were at the root stage, which was characterized by the epithelial diaphragm for root formation. The ameloblasts at the cuspal regions showed less enamel epithelia after the completion of enamel formation (Fig. 1D).
3.1.
Histological findings of molar tooth germs
3.2.
The maxillary 3rd molar tooth germs at 10 d postpartum were in the cap stage (Fig. 1A). The tooth germs consisted of 3 parts: the enamel organ, dental papilla and dental sac. The enamel organ consisted of the outer enamel epithelium, stellate reticulum and inner enamel epithelium. Mesenchymal cells were closely aggregated to form the dental papilla, which extended around the rim of the enamel organ to form the dental sac. At 4 d postpartum, the maxillary 2nd molar tooth germs were at the late bell stage showing the differentiation of ameloblasts for cusp formation. In the future cusp tips, the ameloblasts were observed at the secretory stage (Fig. 1B). At 7
DCC mRNA expression
DCC mRNA expression was examined by RT-PCR to determine if it was expressed from the 2nd and the 3rd molar tooth germs at 10 d postpartum. As shown in Fig. 2A, there was a significant increase in the level of mRNA expression of ameloblastin, enamelin and amelogenin, the enamel matrix proteins, as well as DCC from the cap stage to the root stage. The expression level of DCC mRNA was examined from the early bell stage to the root stage to confirm the expression pattern of DCC mRNA. Interestingly, the level of DCC mRNA expression increased gradually in a similar expression pattern to the other enamel proteins (Fig. 2B).
Fig. 1 – Histological analyses in the molar tooth germ at 4, 7 and 10 d postpartum. (A) The maxillary 3rd molar germ at 10 d postpartum is at the cap stage, which is composed by the stellate reticulum (SR), the dental papilla (DP), the dental sac (DS), the outer enamel epithelium (OEE), the inner enamel epithelium (IEE) (arrows). (B) The maxillary 2nd molar germ at 4 d postpartum is at the late bell stage, which is characterized by the beginning of ameloblasts differentiation (arrow heads). (C) The maxillary 2nd molar germ at 7 d postpartum is at the crown stage, which is characterized by the formation of the enamel (E) by ameloblasts (Am). (D) The maxillary 2nd molar germ at 10 d postpartum is at the root stage. Scale bars: 100 mm (A–C) and 20 mm (D).
566
archives of oral biology 54 (2009) 563–569
3.3. tooth
Immunofluorescent findings in the developing molar
Immunofluorescent staining was carried out using specific DCC immunoglobulin to identify the cellular localization of the DCC protein in the developing molar tooth germs. Interestingly, the localization of the DCC protein was stagespecific during ameloblast differentiation. At the cap stage (the 3rd molar at 10 d postpartum), DCC was not detected in either of the epithelial and dental papilla (Fig. 3B). However, at the root stage (the 2nd molar at 10 d postpartum), strong immunoreactivity against DCC was observed in the secretory stage ameloblasts facing the enamel matrix formation sites. In particular, early intense expression was observed in the lateral and apical regions of the tall columnar ameloblasts involved in the formation of the future cusp tips (Fig. 3C). At the crown stage (the 2nd molar at 7 d postpartum), DCC was observed only on the apical side of the low columnar ameloblasts during the maturation stage after completion of the cusp tips and developing enamel matrix (Fig. 3D). Furthermore, DCC was newly detected in the lateral and apical parts of the secretory stage ameloblasts in the future fossa region, where ameloblast differentiation was initiated.
3.4. tooth
Immunofluorescent findings in the developing incisor
The erupting mandibular incisor of the rats at 10 d postpartum progressively showed presecretory ameloblasts in the proximal region, mature and postmaturation-stage ameloblasts in the distal region, and secretory ameloblasts between presecretory and mature ameloblasts. To determine the existence of the DCC protein, immunofluorescent staining was performed with anti-DCC in the rat incisor at 10 d postpartum. Interestingly, the DCC protein also showed stage-specific expression patterns during ameloblast differentiation (Fig. 4).
4.
Fig. 2 – DCC expression analyses through RT-PCR. (A) mRNAs of DCC, ameloblastin, amelogenin and enamelin were significantly up-regulated from the cap stage to the root stage. (B) mRNAs of DCC, ameloblastin, amelogenin and enamelin were gradually up-regulated from the 2nd tooth germs at sequential development stages. The relative expression of the genes was measured by normalization using GAPDH as a reference. Data were
Discussion
This study for the first time demonstrated the spatiotemporal expression patterns of DCC in the developing rat maxillary molar teeth. The results showed that the DCC mRNA level was up-regulated gradually during molar tooth development. In addition, the expression of DCC on the molar tooth germs was detected in the lateral and apical surfaces of the secretory stage. This suggests that the expression of DCC may play biologically important roles in amelogenesis, enamel matrix secretion. It was hypothesized that DCC during tooth development might show similar expression patterns to N-CAM due to its homology to the N-CAM gene sequence. As previously reported, N-CAM at the cap stage is distinctly expressed in the dental papilla. However, there were no signals of the DCC polypeptide in the 3rd molar tooth germ at 10 d postpartum, which corresponds to the cap stage (Fig. 3B). Moreover, the negative expression of DCC in the epithelium during early presented as mean W SD values derived from three independent experiments.
archives of oral biology 54 (2009) 563–569
567
Fig. 3 – Confocal images of the maxillary molar from the cap stage to the crown stage after double staining with PI and antiDCC antibody. Nuclei were visualized with PI (red), whereas DCC was visualized in green. (A) No signal was found when the tissue section was reacted with the normal serum instead of the primary antibody. (B–D) Localization of DCC. (B) At the cap stage, DCC immunoreactivities did not exhibit in any areas. (C) At the late bell stage, DCC immunoreactivities were intensively detected in the lateral and apical sides of secretory ameloblasts. (D) At the crown stage, DCC immunoreactivities were localized in the apical side of maturation stage ameloblasts as well as newly detected in the lateral and apical sides of secretary stage ameloblasts. The ameloblasts (Am), the dental papilla (DP), the dental sac (DS), the enamel organ (E), the ondontoblasts (O), the stellate reticulum (SR), the pulp (P). Scale bars: 100 mm (A–D). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of the article)
molar tooth development contrasted with the expression of DCC in the ectoderm-derived epithelia, including the skin, hair and mammary glands. Hence, DCC at the cap stage of tooth development may not participate in the early inductive or reciprocal processes related to epithelial–mesenchymal interactions. On the other hand, at the late bell stage, DCC was localized in the lateral and apical sides of the secretory stage ameloblasts in the prospective cusp-forming areas, and was restricted to the apical side of the maturation stage ameloblasts. Recently, there has been increasing interest in the structural proteins related to cell–cell adhesion during tooth development. For example, from the bud stage to the late bell stage, three classical cadherins, E-, P-, and N-cadherin, are expressed spatiotemporally in various sites of the enamel organ prior to amelogenesis. b-catenin and N-CAM are also expressed ubiquitously in the developing tooth germ except at the late stage of amelogenesis.27–29 The signals for amelogenin and enamelin were similarly detected in pre-ameloblasts, with the maximum levels being observed in the secretory stage ameloblasts.30,9,31 In addition, the ameloblastin peptide
was also detected in differentiating ameloblasts.32,33 The present study showed that DCC is expressed stage-specifically during tooth development. This finding is significant because the DCC expression pattern is locally unique and specific in its localization. Interestingly, DCC was recently identified as an important candidate gene that might be involved in the initiation of an ameloblastoma during human tooth development.34 Together with this study, DCC might be a significant regulator of amelogenesis. In conclusion, the expression pattern of DCC in the developing tooth of the rat was demonstrated, and DCC showed a close relationship with amelogenesis. However, the essential functional roles of DCC in tooth development are still unknown. Further functional and structural studies related to the cleavage mechanism of the DCC protein will be needed because DCC with a transmembrane domain might be secreted to the extracellular region. Moreover, the specific proteins that might interact with DCC in the developing tooth germ need to be investigated. Funding: This paper was supported by Wonkwang university in 2009.
568
archives of oral biology 54 (2009) 563–569
Fig. 4 – Confocal images of the developing incisor at P10. Nuclei were visualized with PI (red), whereas DCC was visualized in green. DCC immunoreactivities was also localized in the lateral and apical sides of secretary stage ameloblasts (insert: a, arrows) as well as detected in the apical side of the maturation stage ameloblasts (insert: b). Scale bars: 200 mm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of the article)
Competing interest: Nothing to declare regarding the conflict of interests. Ethical approval: The experimental design for this research was approved by the Chonnam National University Institutional Animal Care and Use Committee, 2008-1-35.
Acknowledgement This paper was supported by Wonkwang university in 2009.
references
1. Kollar EJ, Mina M. Role of the early epithelium in the patterning of the teeth and Meckel’s cartilage. J Craniofac Genet Dev Biol 1991;11:223–8. 2. Slavkin HC. Molecular determinants during dental morphogenesis and cytodifferentiation: a review. J Craniofac Gen Dev Biol 1991;11:338–49. 3. Thesleff I. Epithelial–mesenchymal signaling regulating tooth morphogenesis. J Cell Sci 2003;116:1647–8. 4. Pispa J, Thesleff I. Mechanism of ectodermal organogenesis. Dev Biol 2003;262:195–205. 5. Fincham AG, Moradian-oldak J, Simmer JP. The structural biology of the developing dental enamel metrix. J Struct Biol 1999;126:270–99. 6. Ruch JV. Tooth crown morphogenesis and cytodifferentiation: candid questions and critical comments. Connect Tissue Res 1995;32:1–8.
7. Thesleff I, Nieminen P. Tooth morphogenesis and cell differentiation. Curr Opin Cell Biol 1996;8:844–50. 8. Thesleff I, Vaahtokari A, Vainio S, Jowett A. Molecular mechanisms of cell and tissue interactions during early tooth development. Anat Rec 1996;245:151–61. 9. Zeichner-David M, Diekwisch T, Fincham A, Lau E, MacDougall M, Moradian-Oldak J, et al. Control of ameloblast differentiation. Int Dev Biol 1995;39:69–92. 10. Edelman GM. Morphoregulatory molecules. Biochemistry 1988;27:3533–43. 11. Takeichi M. The cadherins: cell–cell adhesion molecules controlling animal morphogenesis. Development 1998;102:639–55. 12. Palacios J, Benito N, Berpaquero R, Pizarro A, Cano A, Gamallo C. Differential spatiotemporal expression of E- and P-cadherin during mouse tooth development. Int J Dev Biol 1995;39:663–6. 13. Obara N, Suzuki Y, Nagai Y, Takeda M. Expression of E- and P-cadherin during tooth morphogenesis and cytodifferentiation of ameloblasts. Anat Embryol 1998;197:469–75. 14. Heymann R, About I, Lendahl U, Franquin JC, Obrink B, Mitsiadis TA. E- and N-cadherin distribution in developing and functional human teeth under normal and pathological conditions. Am J Pathol 2002;160:2123–33. 15. Crossin KL, Krushel LA. Cellular signaling by neural cell adhesion molecules of the immunoglobulin superfamily. Dev Dyn 2000;218:260–79. 16. Cho KR, Fearon ER. DCC: linking tumor suppressor genes and altered cell surface interactions in cancer? Eur J Cancer 1995;31A:1055–60. 17. Keino-Masu K, Masu M, Hinck L, Leonardo ED, Chan SS, Culotti JG, et al. Deleted in cololrectal cancer (DCC) encodes a netrin receptor. Cell 1996;87:175–85. 18. Hong K, Hinck L, Nishiyama M, Poo MM, Tessier-Lavigne M, Stein E. A ligand-gated association between cytoplasmic domains of UNC5 and DCC family receptors converts netrininduced growth cone attraction to repulsion. Cell 1999;97:927–41. 19. Kolodziej PA, Timpe LC, Mitchell KJ, Fried SR, Goodman CS, Jan LY, et al. Frazzled encodes a Drosophila member of the DCC immunoglobulin subfamily and is required for CNS and motor axon guidance. Cell 1996;87:197–204. 20. Obara N, Takeda M. Expression of neural cell adhesion molecule (NCAM) during the first molar development in the mouse. Anat Embryol 1993;187:209–19. 21. Obara N, Takeda M. Expression of the neural cell adhesion molecule (NCAM) during second- and third-molar development in the mouse. Anat Embryol 1993;188:13–20. 22. Obara N, Takeda M. Distribution of the neural cell adhesion molecule (NCAM) during pre- and postnatal developmenet of mouse incisors. Anat Embryol 1997;195:193–202. 23. Obara N, Suzuki Y, Nagai Y, Nishiyama H, Mizoguchi I, Takeda M. Expression of neural cell-adhesion molecule mRNA during mouse molar tooth development. Arch Oral Biol 2002;47:805–13. 24. Astic L, Pellier-Monnin V, Saucier D, Charrier C, Mehlen P. Expression of netrin-1 and netrin-1 receptor, DCC, in the rat olfactory nerve pathway during development and axonal regeneration. Neuroscience 2002;109:643–56. 25. Chang C, Yu TW, Bargmann CI, Tessier-Lavigne M. Inhibition of netrin-mediated axon attraction by a receptor protein tyrosine phosphatase. Science 2004;305:103–6. 26. Kim HJ, Kim OS, Kim SC, Kang JH, Jung JY, Kim MS, et al. Differential expression of LAR tyrosine phosphatase in the rat developing molar tooth germ. Arch Oral Biol 2008;53:943– 53. 27. Fausser JL, Schlepp O, Aberdam D, Meneguzzi G, Ruch JV, Lesot H. Localization of antigens associated with adherens
archives of oral biology 54 (2009) 563–569
28.
29.
30.
31.
junctions, desmosomes, and hemidesmosomes during murine molar morphogenesis. Differentiation 1998;63:1–11. Obara N, Suzuki Y, Nagai Y, Takeda M. Gene expression of bcatenin is up-regulated in inner dental epithelium and enamel knots during molar tooth morphogenesis in the mouse. Cell Tissue Res 2006;325:197–201. Sorkin BC, Wang MY, Dobck JM, Albergo KL, Skobe Z. The cadherin–catenin complex is expressed alternately with the adenomatous polyposis coli protein during rat incisor amelogenesis. J Histochem Cytochem 2000;48:397–406. Inage T, Shimokawa H, Wakao K, Sasaki S. Gene expression and localization of amelogenin in the rat incisor. Adv Dent Res 1996;10:201–7. Hu CC, Hart TC, Dupont BR, Chen JJ, Sun X, Qian Q, et al. Cloning human enamelin cDNA, chromosomal localization,
569
and analysis of expression during tooth development. J Dent Res 2000;79:912–9. 32. Begue-Kirn C, Krebsbach PH, Bartlett JD, Butler WT. Dentin sialoprotein, dentin phosphoprotein, enamelysin and ameloblastin: tooth-specfic molecules that are distinctively expressed during murine dental differentiation. Eur J Oral Sci 1998;106:963–70. 33. Krebsbach PH, Lee SK, Matsuki Y, Kozak CA, Yamada KM, Yamada Y. Full-length sequence, localization, and chromosomal mapping of ameloblastin. A novel toothspecific gene. J Biol Chem 1996;27:4431–5. 34. Heikinheimo K, Jee KJ, Niini T, Aalto Y, Happonen RP, Leivo I, et al. Gene expression profiling of ameloblastoma and human tooth germ by means of a cDNA microarray. J Dent Res 2002;81:525–30.
available at www.sciencedirect.com
journal homepage: www.intl.elsevierhealth.com/journals/arob
Expression of DCC in differentiating ameloblasts from developing tooth germs in rats H.J. Kim b, S.K. Jeon a, J.H. Kang a, M.S. Kim a, H.M. Ko a, J.Y. Jung a, J.T. Koh a, W.J. Kim a, E.J. Lee a, H.P. Lim a, S.H. Kim a,* a
Dental Science Research Institute, 2nd Stage of Brain Korea 21 for School of Dentistry, Chonnam National University, Gwangju 500-757, South Korea b Department of Oral Anatomy, School of Dentistry, Institute of Biotechnology, Wonkwang University, Iksan 570-749, South Korea
article info
abstract
Article history:
Objective: This study examined the expression pattern of the Deleted-in-colorectal-carci-
Accepted 11 March 2009
noma (DCC) gene in developing rat tooth germs. Methods: Rat pups at 4, 7 and 10 d postpartum were used in this study. Reverse transcription-
Keywords:
polymerase chain reaction (RT-PCR) and immunofluorescent localization were used to
DCC
determine the level of DCC expression during tooth development.
Ameloblasts
Results: There was more than 2-fold higher level of DCC mRNA in the rat 2nd maxillary
Differentiation
molar tooth germs on 10 d postpartum, which was the root stage, than in the rat 3rd
Tooth development
maxillary molar tooth germ, which was at the cap/early bell development stage. In addition,
Enamel formation
the levels of DCC mRNA in the 2nd maxillary molar germs at 4, 7 and 10 d postpartum increased gradually according to tooth development. Interestingly, immunoreactivity against DCC was specifically detected in the differentiating ameloblasts. DCC was observed in the lateral and apical sides of the newly differentiating and secretory stage ameloblasts. Afterwards, DCC was localized only in the apical side of the maturation stage ameloblasts, not in the lateral side. Conclusion: DCC is expressed in the differentiating ameloblasts, which suggests that this molecule plays a crucial role in amelogenesis. # 2009 Elsevier Ltd. All rights reserved.
1.
Introduction
The earliest morphogenetic events of tooth development begin as a thickening of the oral epithelium. The oral epithelium invaginates into the ectomesenchyme, resulting in the formation of an epithelial tooth bud that provides the initial signals for condensation of the underlying ectomesenchymal cells.1,2 After the bud stage, the tooth germ develops into the cap and bell stages, at which both epithelial and ectomesenchymal cells participate in the successive steps
of morphodifferentiation and cytodifferentiation for tooth formation by interacting with various molecules.3,4 Morphodifferentiation of the enamel organ from the oral epithelium results in the formation of the outer enamel epithelium, stellate reticulum, stratum intermedium and inner enamel epithelium. This gives rise to ameloblasts undergoing several differentiation processes: the presecretory, secretory and maturation stages.5 In the secretory and maturation stages, ameloblasts are involved in the formation of the enamel matrix. They are characterized by cell–cell adhesion contacts,
* Corresponding author at: Department of Oral Anatomy, School of Dentistry, Chonnam National University, Yongbongdong, Gwangju 500757, South Korea. Tel.: +82 62 530 4822; fax: +82 62 530 4829. E-mail address: [email protected] (S.H. Kim). 0003–9969/$ – see front matter # 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.archoralbio.2009.03.003
564
archives of oral biology 54 (2009) 563–569
and express various molecules related to the cell–cell adhesion apparatus. Cell–cell adhesion during the differentiation of ameloblasts plays important roles in tooth morphogenesis, and there have been many studies on the presence of celladhesion molecules during this process. Cell–cell adhesion is a crucial process in tooth morphogenesis and several molecules that mediate the adhesion are expressed in a spatiotemporal manner during tooth development.6–9 There are two distinct mechanisms of cell–cell adhesion: Ca2+-dependent and Ca2+-independent.10,11 Of the molecules that mediate Ca2+-dependent cell–cell adhesion during tooth morphogenesis, cadherins have been studied the most.12–14 The Ca2+-independent cell-adhesion molecules are Deleted-in-colorectal-carcinoma (DCC) and neural cell-adhesion molecule (N-CAM).15 DCC is a member of the immunoglobulin (Ig) superfamily and is a type I transmembrane receptor that shares the highest similarity to N-CAM.16,17 It contains four immunoglobulin domains, six type III fibronectin repetitions and a cytoplasmic domain consisting of P1, P2 and P3.18,19 In many developing organs including the tooth, NCAM is an important mediator for the regulation of morphogenesis.20–23 However, about the role of DCC in tooth development is unclear. It was reported that DCC functions as an axonal chemoattractant during axon guidance24 and as an antagonistic effector on the lar-tp (leukocyte-common antigen-related tyrosine phosphatase) function25 in the nervous system. Recently, we reported the existence of lar-tp in molar tooth development.26 Therefore, it is possible that DCC may be also involved in tooth development. This study examined the expression patterns of DCC throughout tooth development to determine its involvement in tooth morphogenesis.
2.
Materials and methods
2.1.
Animals
Sprague–Dawley adult rats were purchased from Daehan Biolink (Korea) and mated. The birthday of the pups after mating was designated as 0 day (0 d) postpartum. Rat pups at 4, 7 and 10 d postpartum were used. All experiments were carried out in accordance with the guidelines of Chonnam National University’s Animal Care and Use Committee.
2.2. Preparation of tissue sections and morphological analysis Portions of the maxilla and mandible containing the developing molar and incisor tooth germs were isolated from the rat pups at 4, 7, and 10 d postpartum. The tooth germs were immersion-fixed in a 4% paraformaldehyde solution overnight, followed by decalcification with 20% ethylene diamine tetra-acetic acid (pH 7.4) for 8 weeks. The tooth germs were then dehydrated in a graded series of ethanol and embedded in paraffin. Four microns thick sagittal sections were cut for hematoxylin–eosin and immunofluorescent staining.
2.3.
Isolation of RNA from the molar tooth germs
The rat pups at 4, 7, and 10 d postpartum were sacrificed, and the gingivae and alveolar bone were removed carefully to expose the 2nd and 3rd molar tooth germs. The molar tooth germs together with their follicular tissues were extracted from the tooth crypts. The total RNA was isolated from the tooth germs using TRIzol (Molecular Research Center Inc., OH, USA) and quantified using a spectrophotometer.
2.4.
RT-PCR
The expression of DCC, ameloblastin, amelogenin and enamelin was assessed by RT-PCR. cDNA synthesis for the reverse transcription was conducted at 42 8C using AccPower1 RT PreMix (Bioneer, Daejeon, Korea). The PCR reaction was carried out on a GeneAmp PCR system 2400 (Applied Biosystems/PerkinElmer, CA, USA) using AccPower1 PCR PreMix (Bioneer, Daejeon, Korea). Table 1 lists the primer sequences and expected product sizes. The PCR products were visualized with ethidium bromide and sequenced for confirmation. The product size was checked using a 100 bp marker (Takara, Shiga, Japan). The images were quantified by densitometric scanning and analysed using Scion image (Scion, MD, USA).
2.5.
Immunofluorescent staining
Immunofluorescent staining was carried out using a TSATM kit (Invitrogen, CA, USA). Briefly, after blocking the endogenous
Table 1 – Sequences of oligonucleotide primers for RT-PCR. Primer sequences 0
0
Amplicon Size (bp)
Temp
GenBank accession no.
DCC
F: 5 TTCCGCCATGGTTTTTAAATC 3 R: 50 CACTATCTGAAAATAATCACT 30
153
58 8C
NM_012841.1
Ameloblastin
F: 50 TACCAATAATGGATTTTGCC 30 R: 50 AGTAAAGTCTCCTCCCTTGG 30
299
50 8C
NM_012900
Amelogenin
F: 50 CAGCCGTATCCTTCCTATGG 30 R: 50 CTTCTTCCCGCTTGGTCTTG 30
442
55 8C
U01245
Enamelin
F: 50 CACACACAGTGAAGTCCAAG 30 R: 50 GTCCTGTTGACTGGTGTCTT 30
298
62 8C
XM001073517
GAPDH
F: 50 CCATGGAGAAGGCTGGGG 30 R: 50 CAAAGTTGTCATGGATGACC 30
195
65 8C
AF_106860
archives of oral biology 54 (2009) 563–569
peroxidase with 1% H2O2, the deparaffinized sections were reacted overnight with goat polyclonal anti-DCC (Santa Cruz Biotechnology, Delaware, CA, USA), and then with the HRPconjugated secondary antibody. The sections were then incubated in a Tyramide working solution. The reactants were imaged using a LSM confocal microscope (Carl Zeiss, Germany). The primary antibodies were substituted with normal serum for the negative control.
565
3.
Results
d postpartum, the maxillary 2nd molar tooth germs were at the crown stage showing the formation of enamel matrix. At this stage, the ameloblasts in the cuspal regions progressed to the maturation stage, whereas the ameloblasts in the future fossa areas were newly differentiated in the secretory stage (Fig. 1C). In contrast to the 3rd molar tooth germs at 10 d postpartum, the maxillary 2nd molar tooth germs were at the root stage, which was characterized by the epithelial diaphragm for root formation. The ameloblasts at the cuspal regions showed less enamel epithelia after the completion of enamel formation (Fig. 1D).
3.1.
Histological findings of molar tooth germs
3.2.
The maxillary 3rd molar tooth germs at 10 d postpartum were in the cap stage (Fig. 1A). The tooth germs consisted of 3 parts: the enamel organ, dental papilla and dental sac. The enamel organ consisted of the outer enamel epithelium, stellate reticulum and inner enamel epithelium. Mesenchymal cells were closely aggregated to form the dental papilla, which extended around the rim of the enamel organ to form the dental sac. At 4 d postpartum, the maxillary 2nd molar tooth germs were at the late bell stage showing the differentiation of ameloblasts for cusp formation. In the future cusp tips, the ameloblasts were observed at the secretory stage (Fig. 1B). At 7
DCC mRNA expression
DCC mRNA expression was examined by RT-PCR to determine if it was expressed from the 2nd and the 3rd molar tooth germs at 10 d postpartum. As shown in Fig. 2A, there was a significant increase in the level of mRNA expression of ameloblastin, enamelin and amelogenin, the enamel matrix proteins, as well as DCC from the cap stage to the root stage. The expression level of DCC mRNA was examined from the early bell stage to the root stage to confirm the expression pattern of DCC mRNA. Interestingly, the level of DCC mRNA expression increased gradually in a similar expression pattern to the other enamel proteins (Fig. 2B).
Fig. 1 – Histological analyses in the molar tooth germ at 4, 7 and 10 d postpartum. (A) The maxillary 3rd molar germ at 10 d postpartum is at the cap stage, which is composed by the stellate reticulum (SR), the dental papilla (DP), the dental sac (DS), the outer enamel epithelium (OEE), the inner enamel epithelium (IEE) (arrows). (B) The maxillary 2nd molar germ at 4 d postpartum is at the late bell stage, which is characterized by the beginning of ameloblasts differentiation (arrow heads). (C) The maxillary 2nd molar germ at 7 d postpartum is at the crown stage, which is characterized by the formation of the enamel (E) by ameloblasts (Am). (D) The maxillary 2nd molar germ at 10 d postpartum is at the root stage. Scale bars: 100 mm (A–C) and 20 mm (D).
566
archives of oral biology 54 (2009) 563–569
3.3. tooth
Immunofluorescent findings in the developing molar
Immunofluorescent staining was carried out using specific DCC immunoglobulin to identify the cellular localization of the DCC protein in the developing molar tooth germs. Interestingly, the localization of the DCC protein was stagespecific during ameloblast differentiation. At the cap stage (the 3rd molar at 10 d postpartum), DCC was not detected in either of the epithelial and dental papilla (Fig. 3B). However, at the root stage (the 2nd molar at 10 d postpartum), strong immunoreactivity against DCC was observed in the secretory stage ameloblasts facing the enamel matrix formation sites. In particular, early intense expression was observed in the lateral and apical regions of the tall columnar ameloblasts involved in the formation of the future cusp tips (Fig. 3C). At the crown stage (the 2nd molar at 7 d postpartum), DCC was observed only on the apical side of the low columnar ameloblasts during the maturation stage after completion of the cusp tips and developing enamel matrix (Fig. 3D). Furthermore, DCC was newly detected in the lateral and apical parts of the secretory stage ameloblasts in the future fossa region, where ameloblast differentiation was initiated.
3.4. tooth
Immunofluorescent findings in the developing incisor
The erupting mandibular incisor of the rats at 10 d postpartum progressively showed presecretory ameloblasts in the proximal region, mature and postmaturation-stage ameloblasts in the distal region, and secretory ameloblasts between presecretory and mature ameloblasts. To determine the existence of the DCC protein, immunofluorescent staining was performed with anti-DCC in the rat incisor at 10 d postpartum. Interestingly, the DCC protein also showed stage-specific expression patterns during ameloblast differentiation (Fig. 4).
4.
Fig. 2 – DCC expression analyses through RT-PCR. (A) mRNAs of DCC, ameloblastin, amelogenin and enamelin were significantly up-regulated from the cap stage to the root stage. (B) mRNAs of DCC, ameloblastin, amelogenin and enamelin were gradually up-regulated from the 2nd tooth germs at sequential development stages. The relative expression of the genes was measured by normalization using GAPDH as a reference. Data were
Discussion
This study for the first time demonstrated the spatiotemporal expression patterns of DCC in the developing rat maxillary molar teeth. The results showed that the DCC mRNA level was up-regulated gradually during molar tooth development. In addition, the expression of DCC on the molar tooth germs was detected in the lateral and apical surfaces of the secretory stage. This suggests that the expression of DCC may play biologically important roles in amelogenesis, enamel matrix secretion. It was hypothesized that DCC during tooth development might show similar expression patterns to N-CAM due to its homology to the N-CAM gene sequence. As previously reported, N-CAM at the cap stage is distinctly expressed in the dental papilla. However, there were no signals of the DCC polypeptide in the 3rd molar tooth germ at 10 d postpartum, which corresponds to the cap stage (Fig. 3B). Moreover, the negative expression of DCC in the epithelium during early presented as mean W SD values derived from three independent experiments.
archives of oral biology 54 (2009) 563–569
567
Fig. 3 – Confocal images of the maxillary molar from the cap stage to the crown stage after double staining with PI and antiDCC antibody. Nuclei were visualized with PI (red), whereas DCC was visualized in green. (A) No signal was found when the tissue section was reacted with the normal serum instead of the primary antibody. (B–D) Localization of DCC. (B) At the cap stage, DCC immunoreactivities did not exhibit in any areas. (C) At the late bell stage, DCC immunoreactivities were intensively detected in the lateral and apical sides of secretory ameloblasts. (D) At the crown stage, DCC immunoreactivities were localized in the apical side of maturation stage ameloblasts as well as newly detected in the lateral and apical sides of secretary stage ameloblasts. The ameloblasts (Am), the dental papilla (DP), the dental sac (DS), the enamel organ (E), the ondontoblasts (O), the stellate reticulum (SR), the pulp (P). Scale bars: 100 mm (A–D). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of the article)
molar tooth development contrasted with the expression of DCC in the ectoderm-derived epithelia, including the skin, hair and mammary glands. Hence, DCC at the cap stage of tooth development may not participate in the early inductive or reciprocal processes related to epithelial–mesenchymal interactions. On the other hand, at the late bell stage, DCC was localized in the lateral and apical sides of the secretory stage ameloblasts in the prospective cusp-forming areas, and was restricted to the apical side of the maturation stage ameloblasts. Recently, there has been increasing interest in the structural proteins related to cell–cell adhesion during tooth development. For example, from the bud stage to the late bell stage, three classical cadherins, E-, P-, and N-cadherin, are expressed spatiotemporally in various sites of the enamel organ prior to amelogenesis. b-catenin and N-CAM are also expressed ubiquitously in the developing tooth germ except at the late stage of amelogenesis.27–29 The signals for amelogenin and enamelin were similarly detected in pre-ameloblasts, with the maximum levels being observed in the secretory stage ameloblasts.30,9,31 In addition, the ameloblastin peptide
was also detected in differentiating ameloblasts.32,33 The present study showed that DCC is expressed stage-specifically during tooth development. This finding is significant because the DCC expression pattern is locally unique and specific in its localization. Interestingly, DCC was recently identified as an important candidate gene that might be involved in the initiation of an ameloblastoma during human tooth development.34 Together with this study, DCC might be a significant regulator of amelogenesis. In conclusion, the expression pattern of DCC in the developing tooth of the rat was demonstrated, and DCC showed a close relationship with amelogenesis. However, the essential functional roles of DCC in tooth development are still unknown. Further functional and structural studies related to the cleavage mechanism of the DCC protein will be needed because DCC with a transmembrane domain might be secreted to the extracellular region. Moreover, the specific proteins that might interact with DCC in the developing tooth germ need to be investigated. Funding: This paper was supported by Wonkwang university in 2009.
568
archives of oral biology 54 (2009) 563–569
Fig. 4 – Confocal images of the developing incisor at P10. Nuclei were visualized with PI (red), whereas DCC was visualized in green. DCC immunoreactivities was also localized in the lateral and apical sides of secretary stage ameloblasts (insert: a, arrows) as well as detected in the apical side of the maturation stage ameloblasts (insert: b). Scale bars: 200 mm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of the article)
Competing interest: Nothing to declare regarding the conflict of interests. Ethical approval: The experimental design for this research was approved by the Chonnam National University Institutional Animal Care and Use Committee, 2008-1-35.
Acknowledgement This paper was supported by Wonkwang university in 2009.
references
1. Kollar EJ, Mina M. Role of the early epithelium in the patterning of the teeth and Meckel’s cartilage. J Craniofac Genet Dev Biol 1991;11:223–8. 2. Slavkin HC. Molecular determinants during dental morphogenesis and cytodifferentiation: a review. J Craniofac Gen Dev Biol 1991;11:338–49. 3. Thesleff I. Epithelial–mesenchymal signaling regulating tooth morphogenesis. J Cell Sci 2003;116:1647–8. 4. Pispa J, Thesleff I. Mechanism of ectodermal organogenesis. Dev Biol 2003;262:195–205. 5. Fincham AG, Moradian-oldak J, Simmer JP. The structural biology of the developing dental enamel metrix. J Struct Biol 1999;126:270–99. 6. Ruch JV. Tooth crown morphogenesis and cytodifferentiation: candid questions and critical comments. Connect Tissue Res 1995;32:1–8.
7. Thesleff I, Nieminen P. Tooth morphogenesis and cell differentiation. Curr Opin Cell Biol 1996;8:844–50. 8. Thesleff I, Vaahtokari A, Vainio S, Jowett A. Molecular mechanisms of cell and tissue interactions during early tooth development. Anat Rec 1996;245:151–61. 9. Zeichner-David M, Diekwisch T, Fincham A, Lau E, MacDougall M, Moradian-Oldak J, et al. Control of ameloblast differentiation. Int Dev Biol 1995;39:69–92. 10. Edelman GM. Morphoregulatory molecules. Biochemistry 1988;27:3533–43. 11. Takeichi M. The cadherins: cell–cell adhesion molecules controlling animal morphogenesis. Development 1998;102:639–55. 12. Palacios J, Benito N, Berpaquero R, Pizarro A, Cano A, Gamallo C. Differential spatiotemporal expression of E- and P-cadherin during mouse tooth development. Int J Dev Biol 1995;39:663–6. 13. Obara N, Suzuki Y, Nagai Y, Takeda M. Expression of E- and P-cadherin during tooth morphogenesis and cytodifferentiation of ameloblasts. Anat Embryol 1998;197:469–75. 14. Heymann R, About I, Lendahl U, Franquin JC, Obrink B, Mitsiadis TA. E- and N-cadherin distribution in developing and functional human teeth under normal and pathological conditions. Am J Pathol 2002;160:2123–33. 15. Crossin KL, Krushel LA. Cellular signaling by neural cell adhesion molecules of the immunoglobulin superfamily. Dev Dyn 2000;218:260–79. 16. Cho KR, Fearon ER. DCC: linking tumor suppressor genes and altered cell surface interactions in cancer? Eur J Cancer 1995;31A:1055–60. 17. Keino-Masu K, Masu M, Hinck L, Leonardo ED, Chan SS, Culotti JG, et al. Deleted in cololrectal cancer (DCC) encodes a netrin receptor. Cell 1996;87:175–85. 18. Hong K, Hinck L, Nishiyama M, Poo MM, Tessier-Lavigne M, Stein E. A ligand-gated association between cytoplasmic domains of UNC5 and DCC family receptors converts netrininduced growth cone attraction to repulsion. Cell 1999;97:927–41. 19. Kolodziej PA, Timpe LC, Mitchell KJ, Fried SR, Goodman CS, Jan LY, et al. Frazzled encodes a Drosophila member of the DCC immunoglobulin subfamily and is required for CNS and motor axon guidance. Cell 1996;87:197–204. 20. Obara N, Takeda M. Expression of neural cell adhesion molecule (NCAM) during the first molar development in the mouse. Anat Embryol 1993;187:209–19. 21. Obara N, Takeda M. Expression of the neural cell adhesion molecule (NCAM) during second- and third-molar development in the mouse. Anat Embryol 1993;188:13–20. 22. Obara N, Takeda M. Distribution of the neural cell adhesion molecule (NCAM) during pre- and postnatal developmenet of mouse incisors. Anat Embryol 1997;195:193–202. 23. Obara N, Suzuki Y, Nagai Y, Nishiyama H, Mizoguchi I, Takeda M. Expression of neural cell-adhesion molecule mRNA during mouse molar tooth development. Arch Oral Biol 2002;47:805–13. 24. Astic L, Pellier-Monnin V, Saucier D, Charrier C, Mehlen P. Expression of netrin-1 and netrin-1 receptor, DCC, in the rat olfactory nerve pathway during development and axonal regeneration. Neuroscience 2002;109:643–56. 25. Chang C, Yu TW, Bargmann CI, Tessier-Lavigne M. Inhibition of netrin-mediated axon attraction by a receptor protein tyrosine phosphatase. Science 2004;305:103–6. 26. Kim HJ, Kim OS, Kim SC, Kang JH, Jung JY, Kim MS, et al. Differential expression of LAR tyrosine phosphatase in the rat developing molar tooth germ. Arch Oral Biol 2008;53:943– 53. 27. Fausser JL, Schlepp O, Aberdam D, Meneguzzi G, Ruch JV, Lesot H. Localization of antigens associated with adherens
archives of oral biology 54 (2009) 563–569
28.
29.
30.
31.
junctions, desmosomes, and hemidesmosomes during murine molar morphogenesis. Differentiation 1998;63:1–11. Obara N, Suzuki Y, Nagai Y, Takeda M. Gene expression of bcatenin is up-regulated in inner dental epithelium and enamel knots during molar tooth morphogenesis in the mouse. Cell Tissue Res 2006;325:197–201. Sorkin BC, Wang MY, Dobck JM, Albergo KL, Skobe Z. The cadherin–catenin complex is expressed alternately with the adenomatous polyposis coli protein during rat incisor amelogenesis. J Histochem Cytochem 2000;48:397–406. Inage T, Shimokawa H, Wakao K, Sasaki S. Gene expression and localization of amelogenin in the rat incisor. Adv Dent Res 1996;10:201–7. Hu CC, Hart TC, Dupont BR, Chen JJ, Sun X, Qian Q, et al. Cloning human enamelin cDNA, chromosomal localization,
569
and analysis of expression during tooth development. J Dent Res 2000;79:912–9. 32. Begue-Kirn C, Krebsbach PH, Bartlett JD, Butler WT. Dentin sialoprotein, dentin phosphoprotein, enamelysin and ameloblastin: tooth-specfic molecules that are distinctively expressed during murine dental differentiation. Eur J Oral Sci 1998;106:963–70. 33. Krebsbach PH, Lee SK, Matsuki Y, Kozak CA, Yamada KM, Yamada Y. Full-length sequence, localization, and chromosomal mapping of ameloblastin. A novel toothspecific gene. J Biol Chem 1996;27:4431–5. 34. Heikinheimo K, Jee KJ, Niini T, Aalto Y, Happonen RP, Leivo I, et al. Gene expression profiling of ameloblastoma and human tooth germ by means of a cDNA microarray. J Dent Res 2002;81:525–30.