- Email: [email protected]
Expression of dysadherin in the human male reproductive tract and in spermatozoa
ANDROLOGY Expression of dysadherin in the human male reproductive tract and in spermatozoa Nieves Marıa Gabrielli, M.Sc.,a Marıa Florencia Veiga, Ph.D.,a Marıa Laura Matos, M.Sc.,a Silvina Quintana, M.Sc.,b Hector Chemes, M.D., Ph.D.,b Gustavo Blanco, M.D., Ph.D.,c and Monica Hebe Vazquez-Levin, Ph.D.a a
Instituto de Biologıa y Medicina Experimental, National Research Council of Argentina, University of Buenos Aires, Buenos Aires, Argentina; b Centro de Investigaciones Endocrinologicas, National Research Council of Argentina, Buenos Aires, Argentina; and c Department of Molecular and Integrative Physiology, University of Kansas Medical Center, Kansas City, Kansas
Objective: To study expression of dysadherin in human testis, epididymis, and spermatozoa. Design: Prospective study. Setting: Basic research laboratory. Patient(s): Testis, epididymis, and testicular spermatozoa from patients under treatment and semen from volunteer donors. Intervention(s): Reverse transcription–polymerase chain reaction, immunohistochemistry, immunocytochemistry, and Western immunoblotting. Main Outcome Measure(s): Dysadherin messenger RNA (mRNA) analysis in testis, epididymis, and ejaculated spermatozoa, immunohistochemistry of both tissues, Western immunoblotting of tissue/cell extracts, and immunocytochemistry of spermatozoa. Result(s): Dysadherin mRNA was found in testis, epididymis, and ejaculated spermatozoa. Whereas testis and spermatozoa exhibited a distinctive 91-kDa protein form, the epididymis showed a 50-kDa moiety, also found in MDA-MB-231 breast cancer cells. Nucleotide sequence analysis revealed >99% homology between testicular and somatic cell mRNA, suggesting differential protein glycosylation. Dysadherin was immunodetected in round spermatids and testicular/ejaculated spermatozoa. It localizes to the acrosomal region and flagellum and colocalized with E-cadherin in the head and with the Naþ,Kþ-ATPase a4 subunit in the flagellum. Conclusion(s): This is the first report on expression of dysadherin in the male gonad and in spermatozoa. Its colocalization with E-cadherin and Naþ,Kþ-ATPase leads us to postulate a role for dysadherin as a modulator of sperm function. (Fertil Steril 2011;96:554–61. 2011 by American Society for Reproductive Medicine.) Key Words: Spermatozoa, dysadherin, epithelial cadherin, Naþ,Kþ-ATPase, a4-subunit
Dysadherin is a transmembrane glycoprotein identified as the target of a monoclonal antibody that reacts with a variety of human cancer cells but with few normal cells. It is composed of 178 amino acids organized in a highly O-glycosylated extracellular domain, a single-transmembrane segment, and a short cytoplasmic tail (1). Presence of dysadherin has been reported in different tumors (2), and its expression causes increased cell motility and reduced cell–cell adReceived January 13, 2011; revised and accepted June 20, 2011; published online July 20, 2011. N.M.G. has nothing to disclose. M.F.V. has nothing to disclose. M.L.M. has nothing to disclose. S.Q. has nothing to disclose. H.C. has nothing to disclose. G.B. has nothing to disclose. M.H.V.-L. has nothing to disclose. N.M.G. and M.F.V. contributed equally to this work. This work was supported by grant nos. PIP 5352 and 2120 from the National Research Council of Argentina and grant no. PICT2004 5-26110 from the National Agency to Promote Science and Technology (M.H.V.-L.). nica Hebe Vazquez-Levin, Ph.D., Instituto de BiolReprint requests: Mo ogıa y Medicina Experimental, CONICET, Vuelta de Obligado 2490, Room B16 and B24, Buenos Aires C1428ADN, Argentina (E-mail: [email protected]).
554
hesiveness (1, 3). The dysadherin mechanism of action would involve negative regulation of the cell–cell adhesion protein epithelial cadherin (E-cadherin) (1). In addition to its involvement in cancer, a physiological role for dysadherin was reported in mice; its expression was described in kidney, duodenum, spleen, and lung (4) and was related to regulation of ion transport. Dysadherin was found to interact with the Naþ,KþATPase a-subunit and modulate its properties (4, 5). Sequence analysis revealed an FXYD motif, identified in a protein family that interacts/modulates Naþ,Kþ-ATPase functions (6, 7). Our group has previously reported expression of E-cadherin and Naþ,Kþ-ATPase in the human male reproductive tract and spermatozoa. E-cadherin localized to the acrosomal region of intact ejaculated and capacitated spermatozoa, and evidence was shown of its involvement in sperm–oocyte interaction (8). In addition, studies have identified the a4 subunit of Naþ,Kþ-ATPase specifically expressed in male germ cells (9, 10); this isoform is present in the sperm flagellum, and its activity is important in maintaining cell motility (11–15). At present there is no information regarding detection of dysadherin in the male reproductive tract and spermatozoa. This work describes the expression of dysadherin in testicular and epididymal
Fertility and Sterility Vol. 96, No. 3, September 2011 Copyright ª2011 American Society for Reproductive Medicine, Published by Elsevier Inc.
0015-0282/$36.00 doi:10.1016/j.fertnstert.2011.06.053
FIGURE 1 Immunodetection of dysadherin in human ejaculated spermatozoa. (A) Indirect immunofluorescence of selected motile human spermatozoa recovered from the ejaculate, using NCC-M53 anti-dysadherin antibody (dysadherin: a–c) or mouse IgG (control: g–i). Corresponding brightfield photomicrographs (d–f and j–l, respectively) are also shown. Cells were treated without (a, d, g, j) and with methanol (b, c, e, f, h, i, k, l). Bar ¼ 10 mm in d, e, j, and k, 5 mm in f and l. (B) Sodium dodecyl sulfate–polyacrylamide gel electrophoresis and Western immunoblotting of protein extracts from spermatozoa developed using the NCC-M53 antibody. Protein extracts from HUVEC and MDA-MB-231 somatic cells are included for comparison. The estimated molecular weight of dysadherin forms is indicated.
Gabrielli. Dysadherin in male reproductive tract and sperm. Fertil Steril 2011.
tissues, as well as its presence in noncapacitated, in vitro capacitated, and calcium-ionophore acrosome-reacted human spermatozoa. In addition, a spatial correlation of dysadherin with E-cadherin and Naþ,Kþ-ATPase is reported.
MATERIALS AND METHODS Human samples were obtained with patient and donor written consent, according to procedures approved by the Ethics Board of the Argentine Society of Clinical Investigation, the Instituto de Biologıa y Medicina Experimental, and the Centro de Estudios en Ginecologıa y Reproduccion.
Antibodies Immunodetection of dysadherin was done using monoclonal antibody NCCM53 (16). In addition, specific antibodies to E-cadherin (H-108; Santa Cruz Biotechnology) and the Naþ,Kþ-ATPase a4 subunit (13) were used. Cy3-anti rabbit IgG (Chemicon-Millipore), Cy3-anti mouse IgG (Sigma), and fluorescein isothiocyanate conjugate (FITC)–anti-mouse IgG (Sigma) (immunocytochemistry), horseradish peroxidase–conjugated goat anti-rabbit/antimouse IgGs (Western immunoblotting) were used as secondary antibodies. For immunohistochemical experiments, the streptavidin-peroxidase LSABþ System-HRP (DAKO) was used.
Chemicals
Culture Media
Chemicals were purchased from Sigma Chemical, BioRad, Qiagen, and Invitrogen Life Technologies, unless specified.
Human sperm medium (HSM) (17) was used for sperm handling. The M. D. Anderson metastastic breast 231 (MDA-MB-231) and human umbilical vein
Fertility and Sterility
555
FIGURE 2 Immunodetection of dysadherin after sperm capacitation and acrosomal exocytosis. (A) Indirect immunofluorescence analysis of 18h-Cap spermatozoa (a, b, e, f, i, and j) and of acrosome-reacted cells after calcium ionophore A23187 treatment (c, d, g, h, k, l) using NCC-M53 antidysadherin antibody (a–d). The corresponding FITC-PSA (e–h) and brightfield (i–l) images for each cell are also shown. Bar ¼ 10 mm in i and k and 5 mm in j and l. ‘‘Acrosome-intact’’ and ‘‘acrosome-reacted’’ spermatozoa were classified with the following criteria: presence of a bright staining over the acrosomal cap (‘‘intact’’) and cell labelling in the equatorial segment or showing no label in the acrosome (‘‘acrosomereacted’’). (B) Dysadherin immunostaining pattern in intact and in acrosome-reacted human spermatozoa. Cells were stained with NCC-M53 anti-dysadherin antibody, followed by incubation with FITC-PSA to assess the acrosomal status. A representative image is displayed, showing the signal for dysadherin (left, dysadherin), FITC-PSA (middle, PSA) staining, and the composed image (right, merge). Bar ¼ 7.5 mm. (C) Distribution of dysadherin immunostaining patterns for the sperm acrosomal cap (left) and flagellum (right). Values for populations of noncapacitated (NC), 18h-Cap (C), and acrosome-reacted (AR) spermatozoa. Cells were stained with NCC-M53 anti-dysadherin antibody, followed by incubation with FITC-PSA to assess the acrosomal status on the cells. Results are expressed as mean SD, n ¼ 3. *P< .001 (analysis of variance).
Gabrielli. Dysadherin in male reproductive tract and sperm. Fertil Steril 2011.
556
Gabrielli et al.
Dysadherin in male reproductive tract and sperm
Vol. 96, No. 3, September 2011
FIGURE 3 Expression of dysadherin in human male reproductive tissues. (A) Reverse transcription–polymerase chain reaction analysis of dysadherin RNA of human testis, caput, corpus, and cauda epididymis. MDA-MB-231 cells were used as a positive control. Negative controls for RT and PCR procedures were included. Experiments were repeated three times with similar results; a representative experiment is shown. (B) Sodium dodecyl sulfate–polyacrylamide gel electrophoresis and Western immunoblot analysis of dysadherin in protein extracts of spermatozoa, testis, epididymis, and HUVEC cells using NCC-M53 anti-dysadherin antibody. The estimated molecular weight of dysadherin forms is indicated. (C) Immunohistochemical localization of dysadherin in human testis (a, b) and epididymis (d, e) using NCC-M53 anti-dysadherin antibody. (c, f) Controls. Bar ¼ 10 mm in a and c, 25 mm in b, 50 mm in d–f. (D) Immunofluorescence analysis of testicular spermatozoa using NCC-M53 anti-dysadherin antibody (dysadherin) or mouse IgG (control). The corresponding brightfield photomicrograph (brightfield) for each cell is shown at right. Bar ¼ 5 mm. (E) Reverse transcription–polymerase chain reaction analysis of dysadherin RNA in human ejaculated spermatozoa. Negative controls for RT and PCR procedures are also shown. Experiments were repeated three times with similar results. An image of the agarose gel from a typical experiment is shown.
Gabrielli. Dysadherin in male reproductive tract and sperm. Fertil Steril 2011.
Fertility and Sterility
557
FIGURE 4 Co-immunolocalization analysis of dysadherin with E-cadherin and Naþ,Kþ-ATPase. (A) Immunolocalization analysis of dysadherin (NCCM53 anti-dysadherin antibody, left) and E-cadherin (H-108 anti-E-cadherin antibody, middle) on motile human spermatozoa recovered from the ejaculate. Merge images (right) revealed an overlapped signal for both proteins in the proximal acrosomal region (yellow). Bar ¼ 10 mm for upper panel, 5 mm for lower panels. The secondary antibody used for the images shown in Figure 1A, b and Figure 4 are different: whereas a Cy3-anti mouse IgG was used in Figure 1A, b, a FITC-anti-mouse IgG was used in Figure 4, for the colocalization studies. Cy3 (indocarbocyanine) is a brighter, more photostable fluorophore that gives a stronger signal and less background than most other fluorophores, such as FITC. (B) Immunolocalization analysis of dysadherin (NCC-M53 anti-dysadherin antibody, left) and Naþ,Kþ-ATPase (anti-Naþ,KþATPase a4 subunit, middle) on motile human spermatozoa recovered from the ejaculate. Merge images (right) show an overlapped signal for both proteins in the flagellum (yellow). Bar ¼ 5 mm.
Gabrielli. Dysadherin in male reproductive tract and sperm. Fertil Steril 2011.
endothelial cells (HUVEC) were grown in Dulbecco’s modified Eagle’s medium–F12 medium with 10% fetal bovine serum, 2 ng/mL b-fibroblast growth factor, 10 ng/mL vascular endothelial growth factor, and 50 mg/mL gentamicin (18).
90% live, 75% progressively motile, and more than 14% morphologically normal spermatozoa were included. MDA-MB-231 (21) and HUVEC (22) cells were used for dysadherin controls in messenger RNA (mRNA)/protein studies.
Human Tissues and Cells
Human Sperm Selection, Capacitation, and Acrosome Reaction
Testicular and epididymal tissues were obtained from adult men undergoing orchiectomy as treatment for prostatic carcinoma and not receiving any hormonal presurgical treatment. Testicular spermatozoa were obtained from patients undergoing testicular biopsy recovered for assisted reproductive technology and processed as previously reported (19). Semen samples were provided by normozoospermic donors according to World Health Organization standards (20); only samples with more than
Liquified semen samples were diluted in HSM supplemented with 0.3% globulin-fatty acid-free bovine serum albumin and subjected to the swimup procedure to select motile spermatozoa (20). Sperm concentration was adjusted to 1.5 106 cells/mL in capacitating medium (HSM with 2.6% bovine serum albumin), and 2-mL aliquots were incubated for 4 hours (4h-Cap) or 18 hours (18h-Cap) at 37 C under capacitating conditions (23). In some cases, 18h-Cap spermatozoa were exposed to 10 mM calcium-ionophore
558
Gabrielli et al.
Dysadherin in male reproductive tract and sperm
Vol. 96, No. 3, September 2011
A23187 for 45 minutes to induce acrosomal exocitosis. At the end of the incubation, spermatozoa were washed, fixed, and processed for cell staining.
RNA Expression Analysis in Tissues and Spermatoza Total RNA from motile spermatozoa, somatic cells (MDA-MB-231), testes, and caput/corpus/cauda epididymides was isolated using the RNeasy kit (Qiagen). RNA expression was determined by reverse transcription; complementary DNA was synthesized using a reaction mixture containing total RNA, oligodT, and SuperScript II reverse transcriptase (Invitrogen Life Technologies). Negative controls omitting the RNA or the reverse transcriptase were included. Complementary DNA from cells/tissues were subjected to PCR procedures followed by electrophoresis in agarose gels to detect dysadherin mRNA. Protocols were carried out with primers to amplify a fragment and whole-dysadherin mRNA. Glyceraldehyde-3-phosphate dehydrogenase was used as housekeeping gene. Negative controls for complementary DNA synthesis and PCR procedures were included (primers are listed in Supplemental Table 1). Polymerase chain reaction products were purified and subjected to nucleotide sequence analysis at the Core Research Center from the University of Chicago. Nucleotide sequences were compared using the BLAST program (24). Protein sequences were obtained using the Translate program (ExPASy Proteomics Server) (25).
Tissue and Sperm Protein Extracts, SDS-PAGE, and Western Immunoblotting Protein extracts from human testis, epididymides, spermatozoa, and MDAMB-231 cells were prepared (8, 26) and processed for SDS-PAGE and Western immunoblotting as reported elsewhere (27, 28). Protein extracts from human testis and epididymides were obtained as part of the procedure designed to isolate total RNA with the Trizol reagent (Invitrogen Life Technologies). Tissue and MDA-MB-231 standard cell lysates were sonicated three times at maximal power (Sonifier Cell Disruptor, model W 140; Heat Systems Ultrasonics) for 30 seconds or until the solution was no longer viscous and were stored at 70 C until used. Total sperm protein extracts were prepared by washing ejaculated sperm suspensions twice with phosphate-buffered saline (PBS, pH 7.4) supplemented with a cocktail of protease inhibitors, followed by centrifugation at 400 g for 10 minutes; cell pellets were resuspended in Laemmli sample buffer (26) and further processed for SDS-PAGE and Western immunoblotting as previously reported (27, 28).
Immunocytochemical Analysis Spermatozoa were subjected to immunocytochemistry as previously described (8). Briefly, fixed cells were incubated in a wet chamber with the first antibody (anti-dysadherin: 2.5 mg/mL; anti-a4 subunit of Naþ,Kþ-ATPase: 1 mg/mL; anti–E-cadherin: 2.5 mg/mL; control: same concentration of purified IgG from the same species of the first antibody). The secondary antibody (Cy3 or FITC-labeled anti-mouse or anti-rabbit IgG antibodies, as specifically indicated) was diluted in PBS and placed with the sperm samples for 1 hour at room temperature in darkness. Slides were washed with PBS, mounted with Vectashield (Vector Laboratories) antifade solution, and evaluated in a Nikon fluorescence microscope (Nikon Instruments) coupled to an image analyzer (IPLab Scientific Imaging Software for Windows). When specified, spermatozoa were observed with a confocal microscope (Nikon C1; excitation lines: 488 nm and 544 nm; emission filters: 515–530 nm and 570-LP nm). Images were acquired using a 60/1.40 oil objective and analyzed using standard procedures for fluorescent imaging. In some cases sperm fixation with paraformaldehyde was followed by a 4-minute incubation with methanol 100% at 4 C. The immunostaining procedure was performed on selected post–swim-up (noncapacitated) spermatozoa, as well as in spermatozoa incubated for 4 hours (4h-Cap) and 18 hours (18h-Cap) under conditions that promote capacitation, and in 18h-Cap spermatozoa incubated with calcium ionophore A23187. In most cases, protocols for dysadherin immunodetection were coupled to a staining procedure with Pisum sativum agglutinin labeled with FITC (FITC-PSA) to determine the acrosomal status of each sperm cell; in these protocols, at the end of the immunostaining procedure cells were incubated for 1 hour with 25 mg/mL
Fertility and Sterility
FITC-PSA in PBS for 1 hour, washed, and mounted as previously described. Acrosome-intact and acrosome-reacted spermatozoa were classified with the following criteria: presence of a bright staining over the acrosomal cap for an ‘‘intact’’ spermatozoon, and cell labelling in the equatorial segment or showing no label in the acrosome for ‘‘acrosome reacted’’ sperm cells. In double immunostaining procedures, additional controls were carried out. These included samples stained with a single color, to check for bleed-through into the other channels, and samples with the first antibody developed in mouse and the secondary antibody raised in rabbit, or vice versa, to rule out cross-reactions.
Immunohistochemical Analysis Small tissue fragments (testis and epididymides) were fixed for 24 hours at 4 C in methanol/acetic acid (95:5), embedded in paraffin, mounted on positive-charged slides (Genex Diagnostics Company), and processed as previously described (8).
Data Analysis Data were expressed as mean SD. When indicated, data were compared by analysis of variance followed by Bonferroni analysis. All statistical analyses were done using the GraphPad InStat program. A P value of < .05 was considered statistically significant.
RESULTS Presence and Localization of Dysadherin in Noncapacitated Human Spermatozoa Immunolocalization analysis of dysadherin was performed by fluorescence microscopy of noncapacitated motile human spermatozoa using the specific NCC-M53 monoclonal antibody; in all cases, costaining was performed with FITC-PSA to assign the sperm acrosome status. These studies showed a strong signal for dysadherin in the flagellum (Fig. 1A, a–c) in more than 95% of intact spermatozoa (Fig. 2C). In some cases a faint signal in the acrosomal region was found, which varied between donors and samples from the same donor. In methanol-treated spermatozoa, label in the acrosome region (Fig. 1A, b, c) was consistent in 84% 7% of the cells (Fig. 2C). The signal observed was absent in control samples (Fig. 1A, g–i). Western immunoblotting of protein extracts from motile noncapacitated spermatozoa showed a specific signal for a 91-kDa dysadherin form; the molecular weight was higher than those estimated for dysadherin in HUVEC (50 kDa) and MDA-MB-231 (55 kDa) cells lines (Fig. 1B).
Fate of Dysadherin During Capacitation and Acrosomal Exocytosis Localization of dysadherin was evaluated in spermatozoa after in vitro capacitation and A23187-calcium-ionophore–induced acrosome reaction, to assess changes in its localization during these events, as shown for other sperm components (29, 30). The 4hCap and 18h-Cap spermatozoa showed the same dysadherin localization as noncapacitated cells (Fig. 2A, a, b); more than 80% of spermatozoa exhibited this dysadherin localization (shown in the 18h-Cap condition; Fig. 2C). In contrast, spermatozoa that underwent acrosomal exocytosis (identified by colocalization with FITC-PSA) lost the dysadherin signal in the acrosomal region but retained the immunoreactivity in the flagellum (Fig. 2A, c, d and Fig. 2C). Confocal microscopy images (anti-dysadherin/FITCPSA) are shown in Figure 2B; merging images localized dysadherin in the apical region of the acrosomal cap.
559
Expression of Dysadherin in Male Reproductive Tract Expression of dysadherin mRNA was detected in testicular and epididymal tissues (Fig. 3A). Protein analysis revealed a 50-kDa epididymal dysadherin that comigrated with the form detected in HUVEC cells; in contrast, a 91-kDa dysadherin isoform was found in the testis that comigrated with the moiety detected in spermatozoa (Fig. 3B). Immunohistochemical analysis of testis sections showed a specific signal for dysadherin in the acrosomal region of round spermatids (Fig. 3C, a–c). In addition, a specific signal for dysadherin was observed in the acrosomal region and flagellum of testicular spermatozoa (Fig. 3D). Moreover, RT-PCR analysis of ejaculated sperm RNA resulted in detection of dysadherin mRNA (Fig. 3E). Immunohistochemical analysis of epididymal tissue sections revealed a specific signal for dysadherin mainly confined to the basal cells (Fig. 3C, d–f). To determine whether the difference in Mr between dysadherin forms is caused by changes in its coding sequence, the full-length dysadherin mRNA from testis and from MDA-MB-231 cells were sequenced, showing a high degree of identity found between both transcripts and that previously reported (NM_144779.2; >99%); particularly in the testicular dysadherin sequence, a one-nucleotide change was identified: C/T at position 173 (from ATG) that would result in a S/F change in position 58 (Supplemental Fig. 1).
Coimmunolocalization Analysis of Dysadherin with E-cadherin and the a4 Subunit of NaD,KD-ATPase Our group has reported immunodetection of E-cadherin in human spermatozoa and showed evidence for its involvement in gamete interaction (8). Because in somatic cells dysadherin modulates E-cadherin functions (2), immunolocalization studies were done by simultaneously using anti-dysadherin and anti–E-cadherin antibodies. A high proportion of spermatozoa specifically stained for both proteins in the acrosomal cap, and the signal overlapped in the sperm head apical region excluding the equatorial segment (Fig. 4A). The a4 subunit of Naþ,Kþ-ATPase has been previously reported to be selectively expressed in the testis and in the sperm flagellum (13). In view of the functional association between dysadherin and Naþ,KþATPase in somatic cells (4, 5, 31, 32), the distribution of both proteins was evaluated in spermatozoa. A specific staining for both proteins was found, and merged images showed an overlapped signal in the sperm flagellum, suggesting their colocalization (Fig. 4B).
DISCUSSION The present investigation aimed to characterize dysadherin expression in male reproductive tissues and spermatozoa, as well as to perform colocalization studies with E-cadherin and Naþ,Kþ-ATPase. First, expression of dysadherin in nontumor tissues of the male reproductive tract was demonstrated. The transcript and the protein were detected in testicular and epididymal tissues. Dysadherin was immunodetected in round spermatids and testicular spermatozoa. These results differed from those in a previous report by Batistatou et al. (33), who used the same antibody and described its expression only in germ cell tumors, although images of sections containing non-neoplastic tissue are not shown. In agreement with our findings, expression of several cancer antigens has been reported in the male gonad (34). Immunohistochemical analysis revealed dysadherin expression in postmeiotic germ cells. Interestingly, a distinct 91-kDa dysadherin form is detected in protein extracts from testis and spermatozoa and differs from that found in somatic cells (MDA-MB-231, 55 kDa). However, no major differences between their nucleotide se-
560
Gabrielli et al.
quences were detected and were highly similar to the sequence reported (NM_144779.2). Dysadherin is heavily glycosylated (35), and differences between the dysadherin forms identified in cell lines (50–55 kDa) and the nonglycosylated form (20 kDa) have been attributed to O-glycosylation (1). In addition, dysadherin forms with an Mr higher than 50–55 kDa have been reported in pancreatic cell lines (16). On the basis of these findings, a differential dysadherin glycosylation in the testis may explain our results. In this regard, several reports have described novel glycosyltransferases involved in testis O-glycosylation pathways (36, 37); these enzymes may be responsible for a distinct glycosylation of testis dysadherin. In agreement with this, a specific O-glycosylation of the angiotensin-converting enzyme testicular-specific isoform has been reported (38). The expression of a dysadherin testicular splice variant may not be ruled out, because alternative pre-mRNA splicing has been found highly prevalent in testis (39–41). Our results have shown that dysadherin localizes to the acrosomal region and flagellum, both in testicular and ejaculated spermatozoa. The signal for dysadherin in the sperm acrosomal region was consistent and intense in cells pretreated with methanol; this treatment probably disrupted the plasma membrane and allowed access of the antibody to internal compartments, specifically the acrosome. Localization of dysadherin in the acrosomal membrane is supported by its detection in the acrosomal region of round spermatids but not in the plasma membrane of germ cells. In somatic cells, dysadherin is a negative regulator of E-cadherin and may disturb interactions of the extracellular cadherin domains or, alternatively, compete by its cytoplasmic domain for the actin cytoskeleton (1). Colocalization experiments from this study have shown that dysadherin and E-cadherin signals overlap in the sperm head apical portion, results that lead us to propose a functional relationship between these proteins. In previous studies from our laboratory, E-cadherin was localized to the plasma membrane of acrosome intact spermatozoa (8); on the other hand, results from this study would localize dysadherin to the acrosomal membrane. Dysadherin and E-cadherin could interact in the sperm cytoplasm by means of their intracellular domains; such an interaction was suggested for members of the acrosomal exocytosis machinery (42–44). Dysadherin in the acrosomal membrane could modulate E-cadherin adhesive function by competing for the actin cytoskeleton (2). In support to this possibility, dysadherin was found to colocalize with actin in human spermatozoa (data not shown). Besides its presence in the sperm head, dysadherin was also detected in the sperm flagellum. Dysadherin colocalized with the Naþ,Kþ-ATPase a4 subunit, a subunit primarily expressed in the sperm flagellum and involved in cell motility (11–15). In somatic cells, dysadherin has been shown to function as a modulator of Naþ,Kþ-ATPase activity (4, 5, 30, 31). The spatial colocalization observed for dysadherin and the Naþ,Kþ-ATPase a4 subunit allows us to propose that sperm motility could be indirectly modulated by dysadherin. Studies are currently underway to characterize the modulatory role of dysadherin upon E-cadherin and Naþ,Kþ-ATPase using somatic cells and animal experimental models. In conclusion, this is the first report describing the expression of dysadherin in human testis and epididymis from nontumor tissues, as well as its presence in testicular and ejaculated spermatozoa. Protein colocalization with E-cadherin in the acrosomal region and with the Naþ,Kþ-ATPase a4 subunit in the flagellum may be indicative of a dysadherin role as modulator of these proteins. Future studies addressing the mechanism of action for dysadherin may help understanding of the molecular basis of sperm function.
Dysadherin in male reproductive tract and sperm
Vol. 96, No. 3, September 2011
Acknowledgments: The authors thank N. Zambrano, M.D., V. Rawe, Ph.D., and C. Alvarez-Sed o, M.Sc., from Centro de Estudios en Ginecologıa y Reproducci on, as well as A. Baldi, M.D., and members of his research team (instituto de Biologıa y Medicina Experimental) for their assistance throughout
the study; Prof. S. Hirohashi, M.D., Ph.D., and Y. Nakanishi, M.D., Ph.D. (National Cancer Center Research Institute, Tokyo, Japan), for providing the anti-dysadherin antibody; and N. Edelsztein and L. Lapyckyj, from our group, for their technical assistance.
REFERENCES 1. Ino Y, Gotoh M, Sakamoto M, Tsukagoshi K, Hirohashi S. Dysadherin, a cancer-associated cell membrane glycoprotein, down-regulates E-cadherin and promotes metastasis. Proc Natl Acad Sci U S A 2002;99:365–70. 2. Nam JS, Hirohashi S, Wakefield LM. Dysadherin: a new player in cancer progression. Cancer Lett 2007;255:161–9. 3. Shimamura T, Yasuda J, Ino Y, Gotoh M, Tsuchiya A, Nakajima A, et al. Dysadherin expression facilitates cell motility and metastatic potential of human pancreatic cancer cells. Cancer Res 2004;64:6989–95. 4. Lubarski I, Pihakaski-Maunsbach K, Karlish SJ, Maunsbach AB, Garty H. Interaction with the Na, K-ATPase and tissue distribution of FXYD5 (related to ion channel). J Biol Chem 2005;280:37717–24. 5. Lubarski I, Karlish SJ, Garty H. Structural and functional interactions between FXYD5 and the Naþ-Kþ-ATPase. Am J Physiol Renal Physiol 2007;293. F1818–6. 6. Delprat B, Bibert S, Geering K. FXYD proteins: novel regulators of Na, K-ATPase. Med Sci (Paris) 2006;22:633–8. 7. Garty H, Karlish SJ. Role of FXYD proteins in ion transport. Annu Rev Physiol 2006;68:431–9. 8. Marın-Briggiler CI, Veiga MF, Matos ML, Echeverrıa MF, Furlong LI, Vazquez-Levin MH. Expression of epithelial cadherin in the human male reproductive tract and gametes and evidence of its participation in fertilization. Mol Hum Reprod; 2008:561–71. 9. Shamraj OI, Lingrel JB. A putative fourth Naþ, K(þ)-ATPase alpha-subunit gene is expressed in testis. Proc Natl Acad Sci U S A 1994;1:2952–6. 10. Wagoner K, Sanchez G, Nguyen AN, Enders GC, Blanco G. Different expression and activity of the alpha1 and alpha4 isoforms of the Na, K-ATPase during rat male germ cell ontogeny. Reproduction 2005;130:627–41. 11. Woo AL, James PF, Lingrel JB. Sperm motility is dependent on a unique isoform of the Na, K-ATPase. J Biol Chem 2000;275:20693–9. 12. Hlivko JT, Chakraborty S, Hlivko TJ, Sengupta A, James PF. The human Na, K-ATPase alpha 4 isoform is a ouabain-sensitive alpha isoform that is expressed in sperm. Mol Reprod Dev 2006;73:101–15. 13. Sanchez G, Nguyen AN, Timmerberg B, Tash JS, Blanco G. The Na, K-ATPase alpha4 isoform from humans has distinct enzymatic properties and is important for sperm motility. Mol Hum Reprod 2006;12:565–76. 14. Jimenez T, Sanchez G, Wertheimer E, Blanco G. Activity of the Na, K-ATPase alpha4 isoform is important for membrane potential, intracellular Ca2þ, and pH to maintain motility in rat spermatozoa. Reproduction 2010;139:835–45. 15. Jimenez T, Sanchez G, McDermott JP, Nguyen AN, Kumar TR, Blanco G. Increased expression of the Na, K-ATPase alpha4 isoform enhances sperm motility in transgenic mice. Biol Reprod 2011;84:153–61.
Fertility and Sterility
16. Shimamura T, Sakamoto M, Ino Y, Sato Y, Shimada K, Kosuge T, et al. Dysadherin overexpression in pancreatic ductal adenocarcinoma reflects tumor aggressiveness: relationship to e-cadherin expression. J Clin Oncol 2003;21:659–67. 17. Suarez SS, Wolf DP, Meizel S. Induction of the acrosome reaction in human spermatozoa by a fraction of human follicular fluid. Gamete Res 1986;14:107–21. 18. Nam JS, Kang MJ, Suchar AM, Shimamura T, Kohn EA, Michalowska AM, et al. Chemokine (C-C motif) ligand 2 mediates the prometastatic effect of dysadherin in human breast cancer cells. Cancer Res 2006;66:7176–84. 19. Marın-Briggiler CI, Lapyckyj L, Gonzalez Echeverrıa MF, Rawe VY, Alvarez Sedo C, Vazquez-Levin MH. Neural cadherin is expressed in human gametes and participates in sperm-oocyte interaction events. Int J Androl 2010;33:e228–39. 20. World Health Organization. WHO laboratory manual for the examination of human semen and sperm cervical mucus interaction. New York: Cambridge University Press; 1999. 21. Brinkley BR, Beall PT, Wible LJ, Mace ML, Turner DS, Cailleau RM. Variations in cell form and cytoskeleton in human breast carcinoma cells in vitro. Cancer Res 1980;40:3118–29. 22. Jaffe EA, Hoyer LW, Nachman RL. Synthesis of antihemophilic factor antigen by cultured human endothelial cells. J Clin Invest 1973;52:2757–64. 23. Marın-Briggiler CI, Gonzalez-Echeverrıa F, Buffone M, Calamera JC, Tezon JG, VazquezLevin MH. Calcium requirements for human sperm function in vitro. Fertil Steril 2003;79:1396–403. 24. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990;215:403–10. 25. Gasteiger E, Gattiker A, Hoogland C, Ivanyi I, Appel RD, Bairoch A. ExPASy: the proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res 2003;3:3784–8. 26. Lapyckyj L, Castillo LF, Matos ML, Gabrielli NM, L€uthy IA, Vazquez-Levin MH. Expression analysis of epithelial cadherin and related proteins in IBH-6 and IBH-4 human breast cancer cell lines. J Cell Physiol 2010;222:596–605. 27. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680–5. 28. Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of proteins from polyacrilamide gels to nitrocellulose sheets procedure and some applications. Proc Natl Acad Sci U S A 1979;76:4350–4. 29. de Lamirande E, Leclerc P, Gagnon C. Capacitation as a regulatory event that primes spermatozoa for the acrosome reaction and fertilization. Mol Hum Reprod 1997;3:175–94. 30. De Jonge C. Biological basis for human capacitation. Hum Reprod Update 2005;11:205–14.
31. Miller TJ, Davis PB. FXYD5 modulates Naþ absorption and is increased in cystic fibrosis airway epithelia. Am J Physiol Lung Cell Mol Physiol 2008;294:L654–64. 32. Miller TJ, Davis PB. S163 is critical for FXYD5 modulation of wound healing in airway epithelial cells. Wound Repair Regen 2008;16:791–9. 33. Batistatou A, Scopa CD, Ravazoula P, Nakanishi Y, Peschos D, Agnantis NJ, et al. Involvement of dysadherin and E-cadherin in the development of testicular tumours. Br J Cancer 2005;93:1382–7. 34. Simpson AJ, Caballero OL, Jungbluth A, Chen YT, Old LJ. Cancer/testis antigen, gametogenesis and cancer. Nat Rev Cancer 2005;5:615–25. 35. Tsuiji H, Takasaki S, Sakamoto M, Irimura T, Hirohashi S. Aberrant O-glycosylation inhibits stable expression of dysadherin, a carcinoma-associated antigen, and facilitates cell-cell adhesion. Glycobiology 2003;13:521–7. 36. Sato T, Gotoh M, Kiyohara K, Kameyama A, Kubota T, Kikuchi N, et al. Molecular cloning and characterization of a novel human beta 1,4-N-acetylgalactosaminyltransferase, beta 4GalNAc-T3, responsible for the synthesis of N, N’-diacetyllactosediamine, galNAc beta 1-4GlcNAc. J Biol Chem 2003;278:47534–44. 37. Hiruma T, Togayachi A, Okamura K, Sato T, Kikuchi N, Kwon YD, et al. A novel human beta1,3-N-acetylgalactosaminyltransferase that synthesizes a unique carbohydrate structure, GalNAcbeta1-3GlcNAc. J Biol Chem 2004;279:14087–95. 38. Ehlers MR, Chen YN, Riordan JF. The unique N-terminal sequence of testis angiotensin-converting enzyme is heavily O-glycosylated and unessential for activity or stability. Biochem Biophys Res Commun 1992;183:199–205. 39. Yeo G, Holste D, Kreiman G, Burge CB. Variation in alternative splicing across human tissues. Genome Biol 2004;5:R74. 40. Elliott DJ. Grellscheid SN.Alternative RNA splicing regulation in the testis. Reproduction 2006;132:811–9. 41. He C, Zuo Z, Chen H, Zhang L, Zhou F, Cheng H, et al. Genome-wide detection of testis- and testicular cancer-specific alternative splicing. Carcinogenesis 2007;28:2484–90. 42. Kierszenbaum AL. Fusion of membranes during the acrosome reaction: a tale of two SNAREs. Mol Reprod Dev 2000;57:309–10. 43. Deng X, Wang Y, Zhou Y, Soboloff J, Gill DL. STIM and Orai: dynamic intermembrane coupling to control cellular calcium signals. J Biol Chem 2009;284:22501–5. 44. Zanetti N, Mayorga LS. Acrosomal swelling and membrane docking are required for hybrid vesicle formation during the human sperm acrosome reaction. Biol Reprod 2009;81:396–405.
561
SUPPLEMENTAL FIGURE 1 Nucleotide and protein sequence analysis of dysadherin from human testis. (A) Nucleotide sequence comparison between the sequence of human testicular dysadherin and the reported NM_144779.2. (B) Protein sequence comparison between the amino acidic sequences deduced from the nucleotide sequences of human testicular dysadherin and the reported NM_144779.2.
Gabrielli. Dysadherin in male reproductive tract and sperm. Fertil Steril 2011.
561.e1
Gabrielli et al.
Dysadherin in male reproductive tract and sperm
Vol. 96, No. 3, September 2011
SUPPLEMENTAL TABLE 1 Sequence of primers designed for the specific amplification of human dysadherin and GAPDH in PCR protocols. Gene Human dysadherin (fragment) Human dysadherin (full length) GADPH
Forward primer
Reverse primer
Amplicon size (bp)
50 ACGTTGAAAGATACCACGTCC30
50 ATCCGTTCCTTCCAGTTGC30
180
50 GCTCCGGACATATGTCGCCCTCTG30
50 GTCAGTAAGCTTCCTGCAACGATTCCGGC30
550
50 TTCGTCATGGGTGTGAAC30
50 AGTGAGCTTCCCGTTCAGC30
297
Note: GAPDH ¼ glyceraldehyde-3-phosphate dehydrogenase. Gabrielli. Dysadherin in male reproductive tract and sperm. Fertil Steril 2011.
Fertility and Sterility
561.e2
Instituto de Biologıa y Medicina Experimental, National Research Council of Argentina, University of Buenos Aires, Buenos Aires, Argentina; b Centro de Investigaciones Endocrinologicas, National Research Council of Argentina, Buenos Aires, Argentina; and c Department of Molecular and Integrative Physiology, University of Kansas Medical Center, Kansas City, Kansas
Objective: To study expression of dysadherin in human testis, epididymis, and spermatozoa. Design: Prospective study. Setting: Basic research laboratory. Patient(s): Testis, epididymis, and testicular spermatozoa from patients under treatment and semen from volunteer donors. Intervention(s): Reverse transcription–polymerase chain reaction, immunohistochemistry, immunocytochemistry, and Western immunoblotting. Main Outcome Measure(s): Dysadherin messenger RNA (mRNA) analysis in testis, epididymis, and ejaculated spermatozoa, immunohistochemistry of both tissues, Western immunoblotting of tissue/cell extracts, and immunocytochemistry of spermatozoa. Result(s): Dysadherin mRNA was found in testis, epididymis, and ejaculated spermatozoa. Whereas testis and spermatozoa exhibited a distinctive 91-kDa protein form, the epididymis showed a 50-kDa moiety, also found in MDA-MB-231 breast cancer cells. Nucleotide sequence analysis revealed >99% homology between testicular and somatic cell mRNA, suggesting differential protein glycosylation. Dysadherin was immunodetected in round spermatids and testicular/ejaculated spermatozoa. It localizes to the acrosomal region and flagellum and colocalized with E-cadherin in the head and with the Naþ,Kþ-ATPase a4 subunit in the flagellum. Conclusion(s): This is the first report on expression of dysadherin in the male gonad and in spermatozoa. Its colocalization with E-cadherin and Naþ,Kþ-ATPase leads us to postulate a role for dysadherin as a modulator of sperm function. (Fertil Steril 2011;96:554–61. 2011 by American Society for Reproductive Medicine.) Key Words: Spermatozoa, dysadherin, epithelial cadherin, Naþ,Kþ-ATPase, a4-subunit
Dysadherin is a transmembrane glycoprotein identified as the target of a monoclonal antibody that reacts with a variety of human cancer cells but with few normal cells. It is composed of 178 amino acids organized in a highly O-glycosylated extracellular domain, a single-transmembrane segment, and a short cytoplasmic tail (1). Presence of dysadherin has been reported in different tumors (2), and its expression causes increased cell motility and reduced cell–cell adReceived January 13, 2011; revised and accepted June 20, 2011; published online July 20, 2011. N.M.G. has nothing to disclose. M.F.V. has nothing to disclose. M.L.M. has nothing to disclose. S.Q. has nothing to disclose. H.C. has nothing to disclose. G.B. has nothing to disclose. M.H.V.-L. has nothing to disclose. N.M.G. and M.F.V. contributed equally to this work. This work was supported by grant nos. PIP 5352 and 2120 from the National Research Council of Argentina and grant no. PICT2004 5-26110 from the National Agency to Promote Science and Technology (M.H.V.-L.). nica Hebe Vazquez-Levin, Ph.D., Instituto de BiolReprint requests: Mo ogıa y Medicina Experimental, CONICET, Vuelta de Obligado 2490, Room B16 and B24, Buenos Aires C1428ADN, Argentina (E-mail: [email protected]).
554
hesiveness (1, 3). The dysadherin mechanism of action would involve negative regulation of the cell–cell adhesion protein epithelial cadherin (E-cadherin) (1). In addition to its involvement in cancer, a physiological role for dysadherin was reported in mice; its expression was described in kidney, duodenum, spleen, and lung (4) and was related to regulation of ion transport. Dysadherin was found to interact with the Naþ,KþATPase a-subunit and modulate its properties (4, 5). Sequence analysis revealed an FXYD motif, identified in a protein family that interacts/modulates Naþ,Kþ-ATPase functions (6, 7). Our group has previously reported expression of E-cadherin and Naþ,Kþ-ATPase in the human male reproductive tract and spermatozoa. E-cadherin localized to the acrosomal region of intact ejaculated and capacitated spermatozoa, and evidence was shown of its involvement in sperm–oocyte interaction (8). In addition, studies have identified the a4 subunit of Naþ,Kþ-ATPase specifically expressed in male germ cells (9, 10); this isoform is present in the sperm flagellum, and its activity is important in maintaining cell motility (11–15). At present there is no information regarding detection of dysadherin in the male reproductive tract and spermatozoa. This work describes the expression of dysadherin in testicular and epididymal
Fertility and Sterility Vol. 96, No. 3, September 2011 Copyright ª2011 American Society for Reproductive Medicine, Published by Elsevier Inc.
0015-0282/$36.00 doi:10.1016/j.fertnstert.2011.06.053
FIGURE 1 Immunodetection of dysadherin in human ejaculated spermatozoa. (A) Indirect immunofluorescence of selected motile human spermatozoa recovered from the ejaculate, using NCC-M53 anti-dysadherin antibody (dysadherin: a–c) or mouse IgG (control: g–i). Corresponding brightfield photomicrographs (d–f and j–l, respectively) are also shown. Cells were treated without (a, d, g, j) and with methanol (b, c, e, f, h, i, k, l). Bar ¼ 10 mm in d, e, j, and k, 5 mm in f and l. (B) Sodium dodecyl sulfate–polyacrylamide gel electrophoresis and Western immunoblotting of protein extracts from spermatozoa developed using the NCC-M53 antibody. Protein extracts from HUVEC and MDA-MB-231 somatic cells are included for comparison. The estimated molecular weight of dysadherin forms is indicated.
Gabrielli. Dysadherin in male reproductive tract and sperm. Fertil Steril 2011.
tissues, as well as its presence in noncapacitated, in vitro capacitated, and calcium-ionophore acrosome-reacted human spermatozoa. In addition, a spatial correlation of dysadherin with E-cadherin and Naþ,Kþ-ATPase is reported.
MATERIALS AND METHODS Human samples were obtained with patient and donor written consent, according to procedures approved by the Ethics Board of the Argentine Society of Clinical Investigation, the Instituto de Biologıa y Medicina Experimental, and the Centro de Estudios en Ginecologıa y Reproduccion.
Antibodies Immunodetection of dysadherin was done using monoclonal antibody NCCM53 (16). In addition, specific antibodies to E-cadherin (H-108; Santa Cruz Biotechnology) and the Naþ,Kþ-ATPase a4 subunit (13) were used. Cy3-anti rabbit IgG (Chemicon-Millipore), Cy3-anti mouse IgG (Sigma), and fluorescein isothiocyanate conjugate (FITC)–anti-mouse IgG (Sigma) (immunocytochemistry), horseradish peroxidase–conjugated goat anti-rabbit/antimouse IgGs (Western immunoblotting) were used as secondary antibodies. For immunohistochemical experiments, the streptavidin-peroxidase LSABþ System-HRP (DAKO) was used.
Chemicals
Culture Media
Chemicals were purchased from Sigma Chemical, BioRad, Qiagen, and Invitrogen Life Technologies, unless specified.
Human sperm medium (HSM) (17) was used for sperm handling. The M. D. Anderson metastastic breast 231 (MDA-MB-231) and human umbilical vein
Fertility and Sterility
555
FIGURE 2 Immunodetection of dysadherin after sperm capacitation and acrosomal exocytosis. (A) Indirect immunofluorescence analysis of 18h-Cap spermatozoa (a, b, e, f, i, and j) and of acrosome-reacted cells after calcium ionophore A23187 treatment (c, d, g, h, k, l) using NCC-M53 antidysadherin antibody (a–d). The corresponding FITC-PSA (e–h) and brightfield (i–l) images for each cell are also shown. Bar ¼ 10 mm in i and k and 5 mm in j and l. ‘‘Acrosome-intact’’ and ‘‘acrosome-reacted’’ spermatozoa were classified with the following criteria: presence of a bright staining over the acrosomal cap (‘‘intact’’) and cell labelling in the equatorial segment or showing no label in the acrosome (‘‘acrosomereacted’’). (B) Dysadherin immunostaining pattern in intact and in acrosome-reacted human spermatozoa. Cells were stained with NCC-M53 anti-dysadherin antibody, followed by incubation with FITC-PSA to assess the acrosomal status. A representative image is displayed, showing the signal for dysadherin (left, dysadherin), FITC-PSA (middle, PSA) staining, and the composed image (right, merge). Bar ¼ 7.5 mm. (C) Distribution of dysadherin immunostaining patterns for the sperm acrosomal cap (left) and flagellum (right). Values for populations of noncapacitated (NC), 18h-Cap (C), and acrosome-reacted (AR) spermatozoa. Cells were stained with NCC-M53 anti-dysadherin antibody, followed by incubation with FITC-PSA to assess the acrosomal status on the cells. Results are expressed as mean SD, n ¼ 3. *P< .001 (analysis of variance).
Gabrielli. Dysadherin in male reproductive tract and sperm. Fertil Steril 2011.
556
Gabrielli et al.
Dysadherin in male reproductive tract and sperm
Vol. 96, No. 3, September 2011
FIGURE 3 Expression of dysadherin in human male reproductive tissues. (A) Reverse transcription–polymerase chain reaction analysis of dysadherin RNA of human testis, caput, corpus, and cauda epididymis. MDA-MB-231 cells were used as a positive control. Negative controls for RT and PCR procedures were included. Experiments were repeated three times with similar results; a representative experiment is shown. (B) Sodium dodecyl sulfate–polyacrylamide gel electrophoresis and Western immunoblot analysis of dysadherin in protein extracts of spermatozoa, testis, epididymis, and HUVEC cells using NCC-M53 anti-dysadherin antibody. The estimated molecular weight of dysadherin forms is indicated. (C) Immunohistochemical localization of dysadherin in human testis (a, b) and epididymis (d, e) using NCC-M53 anti-dysadherin antibody. (c, f) Controls. Bar ¼ 10 mm in a and c, 25 mm in b, 50 mm in d–f. (D) Immunofluorescence analysis of testicular spermatozoa using NCC-M53 anti-dysadherin antibody (dysadherin) or mouse IgG (control). The corresponding brightfield photomicrograph (brightfield) for each cell is shown at right. Bar ¼ 5 mm. (E) Reverse transcription–polymerase chain reaction analysis of dysadherin RNA in human ejaculated spermatozoa. Negative controls for RT and PCR procedures are also shown. Experiments were repeated three times with similar results. An image of the agarose gel from a typical experiment is shown.
Gabrielli. Dysadherin in male reproductive tract and sperm. Fertil Steril 2011.
Fertility and Sterility
557
FIGURE 4 Co-immunolocalization analysis of dysadherin with E-cadherin and Naþ,Kþ-ATPase. (A) Immunolocalization analysis of dysadherin (NCCM53 anti-dysadherin antibody, left) and E-cadherin (H-108 anti-E-cadherin antibody, middle) on motile human spermatozoa recovered from the ejaculate. Merge images (right) revealed an overlapped signal for both proteins in the proximal acrosomal region (yellow). Bar ¼ 10 mm for upper panel, 5 mm for lower panels. The secondary antibody used for the images shown in Figure 1A, b and Figure 4 are different: whereas a Cy3-anti mouse IgG was used in Figure 1A, b, a FITC-anti-mouse IgG was used in Figure 4, for the colocalization studies. Cy3 (indocarbocyanine) is a brighter, more photostable fluorophore that gives a stronger signal and less background than most other fluorophores, such as FITC. (B) Immunolocalization analysis of dysadherin (NCC-M53 anti-dysadherin antibody, left) and Naþ,Kþ-ATPase (anti-Naþ,KþATPase a4 subunit, middle) on motile human spermatozoa recovered from the ejaculate. Merge images (right) show an overlapped signal for both proteins in the flagellum (yellow). Bar ¼ 5 mm.
Gabrielli. Dysadherin in male reproductive tract and sperm. Fertil Steril 2011.
endothelial cells (HUVEC) were grown in Dulbecco’s modified Eagle’s medium–F12 medium with 10% fetal bovine serum, 2 ng/mL b-fibroblast growth factor, 10 ng/mL vascular endothelial growth factor, and 50 mg/mL gentamicin (18).
90% live, 75% progressively motile, and more than 14% morphologically normal spermatozoa were included. MDA-MB-231 (21) and HUVEC (22) cells were used for dysadherin controls in messenger RNA (mRNA)/protein studies.
Human Tissues and Cells
Human Sperm Selection, Capacitation, and Acrosome Reaction
Testicular and epididymal tissues were obtained from adult men undergoing orchiectomy as treatment for prostatic carcinoma and not receiving any hormonal presurgical treatment. Testicular spermatozoa were obtained from patients undergoing testicular biopsy recovered for assisted reproductive technology and processed as previously reported (19). Semen samples were provided by normozoospermic donors according to World Health Organization standards (20); only samples with more than
Liquified semen samples were diluted in HSM supplemented with 0.3% globulin-fatty acid-free bovine serum albumin and subjected to the swimup procedure to select motile spermatozoa (20). Sperm concentration was adjusted to 1.5 106 cells/mL in capacitating medium (HSM with 2.6% bovine serum albumin), and 2-mL aliquots were incubated for 4 hours (4h-Cap) or 18 hours (18h-Cap) at 37 C under capacitating conditions (23). In some cases, 18h-Cap spermatozoa were exposed to 10 mM calcium-ionophore
558
Gabrielli et al.
Dysadherin in male reproductive tract and sperm
Vol. 96, No. 3, September 2011
A23187 for 45 minutes to induce acrosomal exocitosis. At the end of the incubation, spermatozoa were washed, fixed, and processed for cell staining.
RNA Expression Analysis in Tissues and Spermatoza Total RNA from motile spermatozoa, somatic cells (MDA-MB-231), testes, and caput/corpus/cauda epididymides was isolated using the RNeasy kit (Qiagen). RNA expression was determined by reverse transcription; complementary DNA was synthesized using a reaction mixture containing total RNA, oligodT, and SuperScript II reverse transcriptase (Invitrogen Life Technologies). Negative controls omitting the RNA or the reverse transcriptase were included. Complementary DNA from cells/tissues were subjected to PCR procedures followed by electrophoresis in agarose gels to detect dysadherin mRNA. Protocols were carried out with primers to amplify a fragment and whole-dysadherin mRNA. Glyceraldehyde-3-phosphate dehydrogenase was used as housekeeping gene. Negative controls for complementary DNA synthesis and PCR procedures were included (primers are listed in Supplemental Table 1). Polymerase chain reaction products were purified and subjected to nucleotide sequence analysis at the Core Research Center from the University of Chicago. Nucleotide sequences were compared using the BLAST program (24). Protein sequences were obtained using the Translate program (ExPASy Proteomics Server) (25).
Tissue and Sperm Protein Extracts, SDS-PAGE, and Western Immunoblotting Protein extracts from human testis, epididymides, spermatozoa, and MDAMB-231 cells were prepared (8, 26) and processed for SDS-PAGE and Western immunoblotting as reported elsewhere (27, 28). Protein extracts from human testis and epididymides were obtained as part of the procedure designed to isolate total RNA with the Trizol reagent (Invitrogen Life Technologies). Tissue and MDA-MB-231 standard cell lysates were sonicated three times at maximal power (Sonifier Cell Disruptor, model W 140; Heat Systems Ultrasonics) for 30 seconds or until the solution was no longer viscous and were stored at 70 C until used. Total sperm protein extracts were prepared by washing ejaculated sperm suspensions twice with phosphate-buffered saline (PBS, pH 7.4) supplemented with a cocktail of protease inhibitors, followed by centrifugation at 400 g for 10 minutes; cell pellets were resuspended in Laemmli sample buffer (26) and further processed for SDS-PAGE and Western immunoblotting as previously reported (27, 28).
Immunocytochemical Analysis Spermatozoa were subjected to immunocytochemistry as previously described (8). Briefly, fixed cells were incubated in a wet chamber with the first antibody (anti-dysadherin: 2.5 mg/mL; anti-a4 subunit of Naþ,Kþ-ATPase: 1 mg/mL; anti–E-cadherin: 2.5 mg/mL; control: same concentration of purified IgG from the same species of the first antibody). The secondary antibody (Cy3 or FITC-labeled anti-mouse or anti-rabbit IgG antibodies, as specifically indicated) was diluted in PBS and placed with the sperm samples for 1 hour at room temperature in darkness. Slides were washed with PBS, mounted with Vectashield (Vector Laboratories) antifade solution, and evaluated in a Nikon fluorescence microscope (Nikon Instruments) coupled to an image analyzer (IPLab Scientific Imaging Software for Windows). When specified, spermatozoa were observed with a confocal microscope (Nikon C1; excitation lines: 488 nm and 544 nm; emission filters: 515–530 nm and 570-LP nm). Images were acquired using a 60/1.40 oil objective and analyzed using standard procedures for fluorescent imaging. In some cases sperm fixation with paraformaldehyde was followed by a 4-minute incubation with methanol 100% at 4 C. The immunostaining procedure was performed on selected post–swim-up (noncapacitated) spermatozoa, as well as in spermatozoa incubated for 4 hours (4h-Cap) and 18 hours (18h-Cap) under conditions that promote capacitation, and in 18h-Cap spermatozoa incubated with calcium ionophore A23187. In most cases, protocols for dysadherin immunodetection were coupled to a staining procedure with Pisum sativum agglutinin labeled with FITC (FITC-PSA) to determine the acrosomal status of each sperm cell; in these protocols, at the end of the immunostaining procedure cells were incubated for 1 hour with 25 mg/mL
Fertility and Sterility
FITC-PSA in PBS for 1 hour, washed, and mounted as previously described. Acrosome-intact and acrosome-reacted spermatozoa were classified with the following criteria: presence of a bright staining over the acrosomal cap for an ‘‘intact’’ spermatozoon, and cell labelling in the equatorial segment or showing no label in the acrosome for ‘‘acrosome reacted’’ sperm cells. In double immunostaining procedures, additional controls were carried out. These included samples stained with a single color, to check for bleed-through into the other channels, and samples with the first antibody developed in mouse and the secondary antibody raised in rabbit, or vice versa, to rule out cross-reactions.
Immunohistochemical Analysis Small tissue fragments (testis and epididymides) were fixed for 24 hours at 4 C in methanol/acetic acid (95:5), embedded in paraffin, mounted on positive-charged slides (Genex Diagnostics Company), and processed as previously described (8).
Data Analysis Data were expressed as mean SD. When indicated, data were compared by analysis of variance followed by Bonferroni analysis. All statistical analyses were done using the GraphPad InStat program. A P value of < .05 was considered statistically significant.
RESULTS Presence and Localization of Dysadherin in Noncapacitated Human Spermatozoa Immunolocalization analysis of dysadherin was performed by fluorescence microscopy of noncapacitated motile human spermatozoa using the specific NCC-M53 monoclonal antibody; in all cases, costaining was performed with FITC-PSA to assign the sperm acrosome status. These studies showed a strong signal for dysadherin in the flagellum (Fig. 1A, a–c) in more than 95% of intact spermatozoa (Fig. 2C). In some cases a faint signal in the acrosomal region was found, which varied between donors and samples from the same donor. In methanol-treated spermatozoa, label in the acrosome region (Fig. 1A, b, c) was consistent in 84% 7% of the cells (Fig. 2C). The signal observed was absent in control samples (Fig. 1A, g–i). Western immunoblotting of protein extracts from motile noncapacitated spermatozoa showed a specific signal for a 91-kDa dysadherin form; the molecular weight was higher than those estimated for dysadherin in HUVEC (50 kDa) and MDA-MB-231 (55 kDa) cells lines (Fig. 1B).
Fate of Dysadherin During Capacitation and Acrosomal Exocytosis Localization of dysadherin was evaluated in spermatozoa after in vitro capacitation and A23187-calcium-ionophore–induced acrosome reaction, to assess changes in its localization during these events, as shown for other sperm components (29, 30). The 4hCap and 18h-Cap spermatozoa showed the same dysadherin localization as noncapacitated cells (Fig. 2A, a, b); more than 80% of spermatozoa exhibited this dysadherin localization (shown in the 18h-Cap condition; Fig. 2C). In contrast, spermatozoa that underwent acrosomal exocytosis (identified by colocalization with FITC-PSA) lost the dysadherin signal in the acrosomal region but retained the immunoreactivity in the flagellum (Fig. 2A, c, d and Fig. 2C). Confocal microscopy images (anti-dysadherin/FITCPSA) are shown in Figure 2B; merging images localized dysadherin in the apical region of the acrosomal cap.
559
Expression of Dysadherin in Male Reproductive Tract Expression of dysadherin mRNA was detected in testicular and epididymal tissues (Fig. 3A). Protein analysis revealed a 50-kDa epididymal dysadherin that comigrated with the form detected in HUVEC cells; in contrast, a 91-kDa dysadherin isoform was found in the testis that comigrated with the moiety detected in spermatozoa (Fig. 3B). Immunohistochemical analysis of testis sections showed a specific signal for dysadherin in the acrosomal region of round spermatids (Fig. 3C, a–c). In addition, a specific signal for dysadherin was observed in the acrosomal region and flagellum of testicular spermatozoa (Fig. 3D). Moreover, RT-PCR analysis of ejaculated sperm RNA resulted in detection of dysadherin mRNA (Fig. 3E). Immunohistochemical analysis of epididymal tissue sections revealed a specific signal for dysadherin mainly confined to the basal cells (Fig. 3C, d–f). To determine whether the difference in Mr between dysadherin forms is caused by changes in its coding sequence, the full-length dysadherin mRNA from testis and from MDA-MB-231 cells were sequenced, showing a high degree of identity found between both transcripts and that previously reported (NM_144779.2; >99%); particularly in the testicular dysadherin sequence, a one-nucleotide change was identified: C/T at position 173 (from ATG) that would result in a S/F change in position 58 (Supplemental Fig. 1).
Coimmunolocalization Analysis of Dysadherin with E-cadherin and the a4 Subunit of NaD,KD-ATPase Our group has reported immunodetection of E-cadherin in human spermatozoa and showed evidence for its involvement in gamete interaction (8). Because in somatic cells dysadherin modulates E-cadherin functions (2), immunolocalization studies were done by simultaneously using anti-dysadherin and anti–E-cadherin antibodies. A high proportion of spermatozoa specifically stained for both proteins in the acrosomal cap, and the signal overlapped in the sperm head apical region excluding the equatorial segment (Fig. 4A). The a4 subunit of Naþ,Kþ-ATPase has been previously reported to be selectively expressed in the testis and in the sperm flagellum (13). In view of the functional association between dysadherin and Naþ,KþATPase in somatic cells (4, 5, 31, 32), the distribution of both proteins was evaluated in spermatozoa. A specific staining for both proteins was found, and merged images showed an overlapped signal in the sperm flagellum, suggesting their colocalization (Fig. 4B).
DISCUSSION The present investigation aimed to characterize dysadherin expression in male reproductive tissues and spermatozoa, as well as to perform colocalization studies with E-cadherin and Naþ,Kþ-ATPase. First, expression of dysadherin in nontumor tissues of the male reproductive tract was demonstrated. The transcript and the protein were detected in testicular and epididymal tissues. Dysadherin was immunodetected in round spermatids and testicular spermatozoa. These results differed from those in a previous report by Batistatou et al. (33), who used the same antibody and described its expression only in germ cell tumors, although images of sections containing non-neoplastic tissue are not shown. In agreement with our findings, expression of several cancer antigens has been reported in the male gonad (34). Immunohistochemical analysis revealed dysadherin expression in postmeiotic germ cells. Interestingly, a distinct 91-kDa dysadherin form is detected in protein extracts from testis and spermatozoa and differs from that found in somatic cells (MDA-MB-231, 55 kDa). However, no major differences between their nucleotide se-
560
Gabrielli et al.
quences were detected and were highly similar to the sequence reported (NM_144779.2). Dysadherin is heavily glycosylated (35), and differences between the dysadherin forms identified in cell lines (50–55 kDa) and the nonglycosylated form (20 kDa) have been attributed to O-glycosylation (1). In addition, dysadherin forms with an Mr higher than 50–55 kDa have been reported in pancreatic cell lines (16). On the basis of these findings, a differential dysadherin glycosylation in the testis may explain our results. In this regard, several reports have described novel glycosyltransferases involved in testis O-glycosylation pathways (36, 37); these enzymes may be responsible for a distinct glycosylation of testis dysadherin. In agreement with this, a specific O-glycosylation of the angiotensin-converting enzyme testicular-specific isoform has been reported (38). The expression of a dysadherin testicular splice variant may not be ruled out, because alternative pre-mRNA splicing has been found highly prevalent in testis (39–41). Our results have shown that dysadherin localizes to the acrosomal region and flagellum, both in testicular and ejaculated spermatozoa. The signal for dysadherin in the sperm acrosomal region was consistent and intense in cells pretreated with methanol; this treatment probably disrupted the plasma membrane and allowed access of the antibody to internal compartments, specifically the acrosome. Localization of dysadherin in the acrosomal membrane is supported by its detection in the acrosomal region of round spermatids but not in the plasma membrane of germ cells. In somatic cells, dysadherin is a negative regulator of E-cadherin and may disturb interactions of the extracellular cadherin domains or, alternatively, compete by its cytoplasmic domain for the actin cytoskeleton (1). Colocalization experiments from this study have shown that dysadherin and E-cadherin signals overlap in the sperm head apical portion, results that lead us to propose a functional relationship between these proteins. In previous studies from our laboratory, E-cadherin was localized to the plasma membrane of acrosome intact spermatozoa (8); on the other hand, results from this study would localize dysadherin to the acrosomal membrane. Dysadherin and E-cadherin could interact in the sperm cytoplasm by means of their intracellular domains; such an interaction was suggested for members of the acrosomal exocytosis machinery (42–44). Dysadherin in the acrosomal membrane could modulate E-cadherin adhesive function by competing for the actin cytoskeleton (2). In support to this possibility, dysadherin was found to colocalize with actin in human spermatozoa (data not shown). Besides its presence in the sperm head, dysadherin was also detected in the sperm flagellum. Dysadherin colocalized with the Naþ,Kþ-ATPase a4 subunit, a subunit primarily expressed in the sperm flagellum and involved in cell motility (11–15). In somatic cells, dysadherin has been shown to function as a modulator of Naþ,Kþ-ATPase activity (4, 5, 30, 31). The spatial colocalization observed for dysadherin and the Naþ,Kþ-ATPase a4 subunit allows us to propose that sperm motility could be indirectly modulated by dysadherin. Studies are currently underway to characterize the modulatory role of dysadherin upon E-cadherin and Naþ,Kþ-ATPase using somatic cells and animal experimental models. In conclusion, this is the first report describing the expression of dysadherin in human testis and epididymis from nontumor tissues, as well as its presence in testicular and ejaculated spermatozoa. Protein colocalization with E-cadherin in the acrosomal region and with the Naþ,Kþ-ATPase a4 subunit in the flagellum may be indicative of a dysadherin role as modulator of these proteins. Future studies addressing the mechanism of action for dysadherin may help understanding of the molecular basis of sperm function.
Dysadherin in male reproductive tract and sperm
Vol. 96, No. 3, September 2011
Acknowledgments: The authors thank N. Zambrano, M.D., V. Rawe, Ph.D., and C. Alvarez-Sed o, M.Sc., from Centro de Estudios en Ginecologıa y Reproducci on, as well as A. Baldi, M.D., and members of his research team (instituto de Biologıa y Medicina Experimental) for their assistance throughout
the study; Prof. S. Hirohashi, M.D., Ph.D., and Y. Nakanishi, M.D., Ph.D. (National Cancer Center Research Institute, Tokyo, Japan), for providing the anti-dysadherin antibody; and N. Edelsztein and L. Lapyckyj, from our group, for their technical assistance.
REFERENCES 1. Ino Y, Gotoh M, Sakamoto M, Tsukagoshi K, Hirohashi S. Dysadherin, a cancer-associated cell membrane glycoprotein, down-regulates E-cadherin and promotes metastasis. Proc Natl Acad Sci U S A 2002;99:365–70. 2. Nam JS, Hirohashi S, Wakefield LM. Dysadherin: a new player in cancer progression. Cancer Lett 2007;255:161–9. 3. Shimamura T, Yasuda J, Ino Y, Gotoh M, Tsuchiya A, Nakajima A, et al. Dysadherin expression facilitates cell motility and metastatic potential of human pancreatic cancer cells. Cancer Res 2004;64:6989–95. 4. Lubarski I, Pihakaski-Maunsbach K, Karlish SJ, Maunsbach AB, Garty H. Interaction with the Na, K-ATPase and tissue distribution of FXYD5 (related to ion channel). J Biol Chem 2005;280:37717–24. 5. Lubarski I, Karlish SJ, Garty H. Structural and functional interactions between FXYD5 and the Naþ-Kþ-ATPase. Am J Physiol Renal Physiol 2007;293. F1818–6. 6. Delprat B, Bibert S, Geering K. FXYD proteins: novel regulators of Na, K-ATPase. Med Sci (Paris) 2006;22:633–8. 7. Garty H, Karlish SJ. Role of FXYD proteins in ion transport. Annu Rev Physiol 2006;68:431–9. 8. Marın-Briggiler CI, Veiga MF, Matos ML, Echeverrıa MF, Furlong LI, Vazquez-Levin MH. Expression of epithelial cadherin in the human male reproductive tract and gametes and evidence of its participation in fertilization. Mol Hum Reprod; 2008:561–71. 9. Shamraj OI, Lingrel JB. A putative fourth Naþ, K(þ)-ATPase alpha-subunit gene is expressed in testis. Proc Natl Acad Sci U S A 1994;1:2952–6. 10. Wagoner K, Sanchez G, Nguyen AN, Enders GC, Blanco G. Different expression and activity of the alpha1 and alpha4 isoforms of the Na, K-ATPase during rat male germ cell ontogeny. Reproduction 2005;130:627–41. 11. Woo AL, James PF, Lingrel JB. Sperm motility is dependent on a unique isoform of the Na, K-ATPase. J Biol Chem 2000;275:20693–9. 12. Hlivko JT, Chakraborty S, Hlivko TJ, Sengupta A, James PF. The human Na, K-ATPase alpha 4 isoform is a ouabain-sensitive alpha isoform that is expressed in sperm. Mol Reprod Dev 2006;73:101–15. 13. Sanchez G, Nguyen AN, Timmerberg B, Tash JS, Blanco G. The Na, K-ATPase alpha4 isoform from humans has distinct enzymatic properties and is important for sperm motility. Mol Hum Reprod 2006;12:565–76. 14. Jimenez T, Sanchez G, Wertheimer E, Blanco G. Activity of the Na, K-ATPase alpha4 isoform is important for membrane potential, intracellular Ca2þ, and pH to maintain motility in rat spermatozoa. Reproduction 2010;139:835–45. 15. Jimenez T, Sanchez G, McDermott JP, Nguyen AN, Kumar TR, Blanco G. Increased expression of the Na, K-ATPase alpha4 isoform enhances sperm motility in transgenic mice. Biol Reprod 2011;84:153–61.
Fertility and Sterility
16. Shimamura T, Sakamoto M, Ino Y, Sato Y, Shimada K, Kosuge T, et al. Dysadherin overexpression in pancreatic ductal adenocarcinoma reflects tumor aggressiveness: relationship to e-cadherin expression. J Clin Oncol 2003;21:659–67. 17. Suarez SS, Wolf DP, Meizel S. Induction of the acrosome reaction in human spermatozoa by a fraction of human follicular fluid. Gamete Res 1986;14:107–21. 18. Nam JS, Kang MJ, Suchar AM, Shimamura T, Kohn EA, Michalowska AM, et al. Chemokine (C-C motif) ligand 2 mediates the prometastatic effect of dysadherin in human breast cancer cells. Cancer Res 2006;66:7176–84. 19. Marın-Briggiler CI, Lapyckyj L, Gonzalez Echeverrıa MF, Rawe VY, Alvarez Sedo C, Vazquez-Levin MH. Neural cadherin is expressed in human gametes and participates in sperm-oocyte interaction events. Int J Androl 2010;33:e228–39. 20. World Health Organization. WHO laboratory manual for the examination of human semen and sperm cervical mucus interaction. New York: Cambridge University Press; 1999. 21. Brinkley BR, Beall PT, Wible LJ, Mace ML, Turner DS, Cailleau RM. Variations in cell form and cytoskeleton in human breast carcinoma cells in vitro. Cancer Res 1980;40:3118–29. 22. Jaffe EA, Hoyer LW, Nachman RL. Synthesis of antihemophilic factor antigen by cultured human endothelial cells. J Clin Invest 1973;52:2757–64. 23. Marın-Briggiler CI, Gonzalez-Echeverrıa F, Buffone M, Calamera JC, Tezon JG, VazquezLevin MH. Calcium requirements for human sperm function in vitro. Fertil Steril 2003;79:1396–403. 24. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990;215:403–10. 25. Gasteiger E, Gattiker A, Hoogland C, Ivanyi I, Appel RD, Bairoch A. ExPASy: the proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res 2003;3:3784–8. 26. Lapyckyj L, Castillo LF, Matos ML, Gabrielli NM, L€uthy IA, Vazquez-Levin MH. Expression analysis of epithelial cadherin and related proteins in IBH-6 and IBH-4 human breast cancer cell lines. J Cell Physiol 2010;222:596–605. 27. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680–5. 28. Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of proteins from polyacrilamide gels to nitrocellulose sheets procedure and some applications. Proc Natl Acad Sci U S A 1979;76:4350–4. 29. de Lamirande E, Leclerc P, Gagnon C. Capacitation as a regulatory event that primes spermatozoa for the acrosome reaction and fertilization. Mol Hum Reprod 1997;3:175–94. 30. De Jonge C. Biological basis for human capacitation. Hum Reprod Update 2005;11:205–14.
31. Miller TJ, Davis PB. FXYD5 modulates Naþ absorption and is increased in cystic fibrosis airway epithelia. Am J Physiol Lung Cell Mol Physiol 2008;294:L654–64. 32. Miller TJ, Davis PB. S163 is critical for FXYD5 modulation of wound healing in airway epithelial cells. Wound Repair Regen 2008;16:791–9. 33. Batistatou A, Scopa CD, Ravazoula P, Nakanishi Y, Peschos D, Agnantis NJ, et al. Involvement of dysadherin and E-cadherin in the development of testicular tumours. Br J Cancer 2005;93:1382–7. 34. Simpson AJ, Caballero OL, Jungbluth A, Chen YT, Old LJ. Cancer/testis antigen, gametogenesis and cancer. Nat Rev Cancer 2005;5:615–25. 35. Tsuiji H, Takasaki S, Sakamoto M, Irimura T, Hirohashi S. Aberrant O-glycosylation inhibits stable expression of dysadherin, a carcinoma-associated antigen, and facilitates cell-cell adhesion. Glycobiology 2003;13:521–7. 36. Sato T, Gotoh M, Kiyohara K, Kameyama A, Kubota T, Kikuchi N, et al. Molecular cloning and characterization of a novel human beta 1,4-N-acetylgalactosaminyltransferase, beta 4GalNAc-T3, responsible for the synthesis of N, N’-diacetyllactosediamine, galNAc beta 1-4GlcNAc. J Biol Chem 2003;278:47534–44. 37. Hiruma T, Togayachi A, Okamura K, Sato T, Kikuchi N, Kwon YD, et al. A novel human beta1,3-N-acetylgalactosaminyltransferase that synthesizes a unique carbohydrate structure, GalNAcbeta1-3GlcNAc. J Biol Chem 2004;279:14087–95. 38. Ehlers MR, Chen YN, Riordan JF. The unique N-terminal sequence of testis angiotensin-converting enzyme is heavily O-glycosylated and unessential for activity or stability. Biochem Biophys Res Commun 1992;183:199–205. 39. Yeo G, Holste D, Kreiman G, Burge CB. Variation in alternative splicing across human tissues. Genome Biol 2004;5:R74. 40. Elliott DJ. Grellscheid SN.Alternative RNA splicing regulation in the testis. Reproduction 2006;132:811–9. 41. He C, Zuo Z, Chen H, Zhang L, Zhou F, Cheng H, et al. Genome-wide detection of testis- and testicular cancer-specific alternative splicing. Carcinogenesis 2007;28:2484–90. 42. Kierszenbaum AL. Fusion of membranes during the acrosome reaction: a tale of two SNAREs. Mol Reprod Dev 2000;57:309–10. 43. Deng X, Wang Y, Zhou Y, Soboloff J, Gill DL. STIM and Orai: dynamic intermembrane coupling to control cellular calcium signals. J Biol Chem 2009;284:22501–5. 44. Zanetti N, Mayorga LS. Acrosomal swelling and membrane docking are required for hybrid vesicle formation during the human sperm acrosome reaction. Biol Reprod 2009;81:396–405.
561
SUPPLEMENTAL FIGURE 1 Nucleotide and protein sequence analysis of dysadherin from human testis. (A) Nucleotide sequence comparison between the sequence of human testicular dysadherin and the reported NM_144779.2. (B) Protein sequence comparison between the amino acidic sequences deduced from the nucleotide sequences of human testicular dysadherin and the reported NM_144779.2.
Gabrielli. Dysadherin in male reproductive tract and sperm. Fertil Steril 2011.
561.e1
Gabrielli et al.
Dysadherin in male reproductive tract and sperm
Vol. 96, No. 3, September 2011
SUPPLEMENTAL TABLE 1 Sequence of primers designed for the specific amplification of human dysadherin and GAPDH in PCR protocols. Gene Human dysadherin (fragment) Human dysadherin (full length) GADPH
Forward primer
Reverse primer
Amplicon size (bp)
50 ACGTTGAAAGATACCACGTCC30
50 ATCCGTTCCTTCCAGTTGC30
180
50 GCTCCGGACATATGTCGCCCTCTG30
50 GTCAGTAAGCTTCCTGCAACGATTCCGGC30
550
50 TTCGTCATGGGTGTGAAC30
50 AGTGAGCTTCCCGTTCAGC30
297
Note: GAPDH ¼ glyceraldehyde-3-phosphate dehydrogenase. Gabrielli. Dysadherin in male reproductive tract and sperm. Fertil Steril 2011.
Fertility and Sterility
561.e2