Expression of hematopoietic transcription factors Runt, CBFβ and GATA during ontogenesis of scallop Chlamys farreri

Developmental and Comparative Immunology 61 (2016) 88e96

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Expression of hematopoietic transcription factors Runt, CBFb and GATA during ontogenesis of scallop Chlamys farreri Feng Yue a, c, Lingling Wang b, Hao Wang a, Linsheng Song b, * a

Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Rd., Qingdao 266071, China Key Laboratory of Mariculture & Stock Enhancement in North China's Sea, Ministry of Agriculture, Dalian Ocean University, Dalian 116023, China c University of Chinese Academy of Sciences, Beijing 100049, China b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 13 October 2015 Received in revised form 19 March 2016 Accepted 19 March 2016 Available online 21 March 2016

Transcription factors Runx1, CBFb and GATA1/2/3 play essential roles in regulating hematopoietic development during embryogenesis of vertebrate. In previous study, the orthologous genes of Runt, CBFb and GATA1/2/3 have been identified from scallop Chlamys farreri and proved to have conserved function in regulating hemocyte production. Here, these three transcription factors were selected as hematopoietic markers to explore potential developmental events of hematopoiesis during ontogenesis of scallop. The transcripts of CfRunt, CfCBFb and CfGATA were detected abundantly after 32-cell embryo, trochophore and morula stage, and reached to a peak level in 32-cell embryos and D-shaped veligers, pediveligers or gastrula respectively. Further whole-mount immunofluorescence assay showed that the immunoreactivity of CfRunt was firstly observed at 32-cell stage and then its distribution was specialized gradually to the mesoderm during gastrulation. By trochophore, the expression of CfRunt, CfCBFb and CfGATA proteins occurred coincidently in two specific symmetry cell mass located bilaterally on prototroch, and then disappeared rapidly in D-shaped or umbonal vliger, respectively. However, remarkable expressions of the three transcription factors were observed consistently in a new sinus structure appeared at the dorsal anterior side of D-shaped and umbonal veliger. After bacterial challenge, the mRNA expression levels of the three transcription factors were up-regulated or down-regulated significantly in trochophore, D-shaped veliger and pediveliger, indicating the available hematopoietic regulation in scallop larvae. The results revealed that scallop might experience two waves of hematopoiesis during early development, which occurred in the bilateral symmetry cell mass of trochophore and the sinus structure of veliger. © 2016 Elsevier Ltd. All rights reserved.

Keywords: Chlamys farreri Ontogenesis Transcription factor Hematopoietic development Bacterial challenge

1. Introduction The function of both innate and adaptive immune system in organism to defend against environmental pathogens is dominantly dependent on various immunocytes. In adult vertebrates and some invertebrates, the distinct immunocytes are derived from a common set of hematopoietic progenitors or hematopoietic stem cells (HSCs) resided in specific hematopoietic tissue (Krzemien € derh€ et al., 2010; Lin and So all, 2011; Orkin and Zon, 2008). Hematopoiesis, defined as the process of which immunocyte generated from progenitors or HSCs, plays indispensable roles in regulating the homeostasis of immunocyte with respect to the

* Corresponding author. E-mail address: [email protected] (L. Song). http://dx.doi.org/10.1016/j.dci.2016.03.021 0145-305X/© 2016 Elsevier Ltd. All rights reserved.

whole immune defense system of organism throughout its life (Kondo et al., 2003; Lanot et al., 2001). The embryonic origin of adult hematopoietic tissue and ontogeny of hematopoiesis always fascinated scientists for a long time. Over the past decades, our knowledge on hematopoietic development has been greatly elucidated due to the elaborately study on mouse (see review (Cumano and Godin, 2007)), zebrafish (see review (Paik and Zon, 2010)) and fly Drosophila (see review (Evans et al., 2003)). Increasing studies in these model animals demonstrate that transcription factors Runt (Runx1), CBFb and GATA1/2/3 are necessary in hematopoietic development by regulating the emergence of HSC from endothelial hematopoietic clusters and the cell fate determination of HSCs (Bresciani et al., 2014; Frelin et al., 2013; Ling et al., 2004; North et al., 1999; Yokomizo et al., 2001). In Drosophila, silencing of lozenge, one of the Runt family genes, resulted in the loss of crystal cells neither in

F. Yue et al. / Developmental and Comparative Immunology 61 (2016) 88e96

embryos nor in the lymph gland of larva (Lebestky et al., 2000). Serpent, an ortholog of GATA in Drosophila, has been found to distribute in the prohemocytes of head mesoderm and lymph gland directly controlling the hemocyte specification during early development (Lebestky et al., 2000, 2003). Recently, the orthologs of GATA1/2/3 have also been found in sea urchin Strongylocentrotus. purpuratus and demonstrated to play essential roles in regulating immunocyte development (Solek et al., 2013). Thus, transcription factors Runt (Runx1), CBFb and GATA1/2/3 are usually considered as molecular markers of hematopoietic development. By tracing the expression of hematopoietic markers like Runt (Runx1) and GATA1/2/3 family members, it has been found that model animals are all experienced two waves of de novo hematopoiesis during early development, although the origin sites of the hematopoiesis are different among species (Chen and Zon, 2009; Crozatier and Meister, 2007; Davidson and Zon, 2004; Galloway and Zon, 2003). In zebrafish, the first wave of hematopoiesis, termed primitive hematopoiesis, occurs intraembryonically in ventral mesoderm-derived tissue called the intermediate cell mass (ICM), in which the first HSCs appear and give rise to myeloid cells and erythrocytes (Detrich et al., 1995). The second wave, termed definitive hematopoiesis, occurs in ventral wall of dorsal aorta in 30 h embryo, in which the second HSCs appear (Burns et al., 2002). Subsequently the second HSCs will migrate and seed in the caudal hematopoietic tissue, thymus and kidney giving rise to all blood lineages including lymphocytes (Jin et al., 2007; Murayama et al., 2006). Similarly, in Drosophila, the first wave of hematopoiesis occurs in the head mesoderm of embryo, called embryonic hematopoiesis (Rehorn et al., 1996; Tepass et al., 1994), which gives rise to plasmatocytes and crystal cells (Lebestky et al., 2000). While the second wave occurs in the lymph gland of larva, called lymph gland hematopoiesis, which generates three types of adult hemocytes (Holz et al., 2003). However, compared to the extensive study in model animals, our knowledge of hematopoietic development in other invertebrates is still limited. As invertebrate, scallop Chlamys farreri exclusively relies on innate immunity to defend against the invasion of foreign pathogens. Despite the molecular basis of innate immune system has been illustrated intensely in adult scallop (Song et al., 2010), studies on the immune defense mechanism of scallop embryos and larvae are just rising in recent years (Yue et al., 2013). Many reports have described similar major events during embryonic and larval development of different scallop species based on morphology and anatomy, including organ and shell formation (de Jong, 2013; Desrosiers et al., 1996; Hodgson and Burke, 1988; Shumway and Parsons, 2011). However, little is known about the hematopoietic development during ontogenesis of scallop. In our previous reports, the orthologous genes of Runt, CBFb and GATA1/2/3 have been identified in scallop C. farreri and demonstrated to have conserved function in regulating hemocyte production of scallop (Yue et al., 2014a, 2014b). In the present study, we examined the expression patterns of the three transcription factors to explore the potential developmental events of hematopoiesis during scallop ontogenesis. 2. Materials and methods 2.1. Scallop embryos, larvae and sample collection All scallop embryos and larvae in different developmental stages were reproduced and collected as previously described (Yue et al., 2013) in Xunshan scallop hatchery (Yixiang farm, Rongcheng, China) in April 2012, including oocytes (eggs), fertilized eggs, 2-cell embryos, 4-cell embryos, 8-cell embryos, 16-cell embryos, 32-cell

89

embryos, morula (6 h post-fertilization, hpf), blastula (11 hpf), gastrula (18 hpf), trochophore (22 hpf), D-shaped veligers (2 day post-fertilization, dpf), umbonal veligers (7 dpf) and pediveligers (23 dpf). For RNA extraction, three to six samples for each stage were collected and freezed in liquid nitrogen. For whole-mount immunofluorescence staining, samples before trochophore stage were fixed in fresh 4% paraformaldehyde in PBS for 16 h at 4
C, while samples after trochophore stage were first relaxed by gradual addition of 7.5% MgCl2 and then fixed. After fixation, all samples were washed with PBS, dehydrated in methanol (25%, 50%, 75% and 100%), and stored at 20
C. 2.2. Bacterial challenge Bacterial challenge of scallop larvae was performed as previously described (Yue et al., 2013). In brief, equal amount of larvae at different stages were transferred into each tank filling with filtered seawater. For bacterial challenge group, Vibrio anguillarum were added into each tank at a final concentration of 1  108 CFU L1, while the group without V. anguillarum added was treated as control. Each group was replicated for six times and samples were collected at 0, 6, 12 and 24 h after bacterial challenge for RNA extraction. 2.3. RNA extraction, cDNA synthesis and real-time PCR Total RNA extraction, cDNA synthesis and real-time PCR analysis were carried out as previously described (Yue et al., 2013). Briefly, total RNA was isolated from scallop embryos and larvae using Trizol reagent (Invitrogen, USA) and then treated with DNase I (Promega, USA) to eliminate genomic DNA contamination. The cDNA was synthesized according to Promega M-MLV RT Usage information (Promega, USA) using oligo (dT)-adaptor as primer. Subsequently, quantitative real-time PCR was employed to quantify the expression of target genes (CfRunt, CfCBFb and CfGATA) during scallop ontogenesis and bacterial challenge. The reaction was performed with SYBR Green Master Mix (Takara, Japan) on an ABI 7300 RealTime Detection System (Applied Biosystems, USA) and all primers used in this study were listed in Table 1. The relative expression level of target genes was calculated by comparative Ct method (2DDCt method) (Livak and Schmittgen, 2001) with the internal control of CfEF-1a. 2.4. Protein recombination and polyclonal antibody preparation For protein recombination, DNA sequences corresponding to the N-terminal amino acid sequence of CfRunt (143aa), full-length sequence of CfCBFb (183aa) and full-length sequence of CfGATA (457aa) were cloned in to pET-30a vector (Primers were shown in Table 1). The strains Escherichia. coli BL21 (DE3)-pLysS with recombinant plasmid (pET-30a-CfRunt-fragment, pET-30a-CfCBFb and pET-30a-CfGATA) were cultured and IPTG (1 mmol L1) was added to induce the expression of recombinant protein. The recombinant proteins CfRunt, CfCBFb and CfGATA were purified by a Ni2þ chelating Sepharose column under denatured condition (8 mol L1 urea), and then refolded in gradient urea-TBS glycerol buffer (50 mmol L1 Tris-HCl, 50 mmol L1 NaCl, 10% glycerol, 2 mmol L1 reduced glutathione, 0.2 mmol L1 oxide glutathione, a gradient urea concentration of 6, 5, 4, 3, 2, 1, 0 mol L1 urea, pH 8.0; each gradient at 4
C for 12 h). The purity of obtained recombinant proteins was evaluated by SDS-polyacrylamide gel electrophoresis, and the concentration of purified proteins was quantified by BCA method (Smith et al., 1985). The obtained proteins were stored at 80
C for further use. For preparation of antibodies, the renatured proteins of CfRunt,

90

F. Yue et al. / Developmental and Comparative Immunology 61 (2016) 88e96 Table 1 Primers used in this study. Name

Primer sequence (50 e30 )

Sequence information

CfRunt-Re-F CfRunt-Re-R CfCBFb-Re-F CfCBFb-Re-R CfGATA-Re-F CfGATA-Re-R CfRunt-RT-F CfRunt-RT-R CfCBFb-RT-F CfCBFb-RT-R CfGATA-RT-F CfGATA-RT-R CfEF-1a-RT-F CfEF-1a-RT-R oligo (dT)-adaptor

CGGAATTCATGACCGAGGTTGTCCCGGGGGA TTAGCGGCCGCATTAACGTAGTTTTATTTTGCTT CGCGGATCCATGATGCCTCGAGTTGTTCCCGAT CCAAGCTTGCTGGCCCTCTGCTTCCTGCTCTGCCT CGGAATTCATGGAGGTCCCAACAGAGCAGCAC CCCAAGCTTGTCACGCCATCGCCCCAACCATAT GAAGCGGACGAGGAAAGAGTT CGACGGTGACTTTGATGGC ATGGAGAGGATGGGTGGACTTG CGCTCCTGCTGCTGACGATACT GGCATTCAGACGAGGAACAGG GATATAGGACCCGCCCAGAGAC ATCCTTCCTCCATCTCGTCCT GGCACAGTTCCAATACCTCCA GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTT TTTVN

Protein recombination

CfCBF and CfGATA were dialyzed against ddH2O before freeze concentrated. Protein was then immunized to 6 weeks old rats for four times to acquire polyclonal antibody as described previously (Cheng et al., 2006). 2.5. Western blot analysis Purified proteins of CfRunt, CfCBFb and CfGATA or cell nuclear proteins extracted from scallop hemocytes were subjected to 12% SDS-PAGE after denatured with protein loading buffer under 100
C, and then transferred onto PVDF membrane (Millipore, USA). The membranes were blocked in blocking buffer (5% milk proteins in TBST) at 4
C overnight and then incubated with the primary antibodies (rat-anti-scallop CfRunt, rat-anti-scallop CfCBFb and ratanti-scallop CfGATA) at 4
C for 12 h, respectively. After washing with TBST, The membranes were incubated with secondary antibody goat anti-rat IgG-HRP (1:5000, abcam, USA) at room temperature for 1 h. To visualize the blotted protein, the membranes were washed and incubated with Western Lightning-ECL reagent (PerkinElmer, USA), and then exposed to film (Kodak, USA). 2.6. Whole-mount immunofluorescence assay Whole-mount immunofluorescence assay was conducted as previously described (Yue et al., 2013). In brief, the embryos or larvae kept in 100% methanol were rinsed in 0.01 M PBS for 3  15 min. The shells of larvae were decalcified with EDTA solution and blocked overnight with blocking solution (10% normal goat serum, 0.25% bovine serum albumin, 1% TritonX-100 and 0.03% sodium azide in 0.01 M PBS). The specimens were incubated with the primary antibodies at 4
C for 3 days, and then incubated with secondary antibody Alexa Fluor 488-goat anti-rat IgG (1:1000, Invitrogen, USA). All specimens were mounted in 80% glycerol in PBS for further observation. The specimens incubated with preimmune sera plus secondary antibody was selected as negative control. All specimens were examined as whole-mount using the Zeiss Laser-Scanning Confocal Microscopy System LSM 710 (Zeiss, Germany). 2.7. Statistical analysis Statistical analysis was performed by software SPSS 11.0. The statistical significance between different samples was determined by Student's t-test, or by one-way analysis of variance (ANOVA). All data were presented as means ± SE. P < 0.05 was set as statistically significant.

Real time PCR

Reverse transcription

3. Results 3.1. Temporal expression of CfRunt, CfCBFb and CfGATA during C. farreri ontogenesis The mRNA expression of transcription factors CfRunt, CfCBFb and CfGATA were all increased significantly during the ontogenesis of scallop, although the temporal patterns were different. Both of CfRunt and CfCBFb transcripts were present at low levels in unfertilized eggs and early cleavage embryos (Fig. 1A and B). The transcripts of CfRunt were accumulated approximately 18.4-fold and 11.1-fold at 32-cell embryo and D-shaped veliger stages compared to that of unfertilized eggs (P < 0.05), thereafter declined in abundance and kept expressing at a stable level after umbonal veliger stage (Fig. 1A). The transcripts of CfCBFb were detected abundantly after trochophore stage, and then reached to a peak value at D-shaped veliger and pediveliger stage, which was 23.3fold and 24.6-fold of that at unfertilized eggs (P < 0.05, Fig. 1B). In contrast, the transcript of CfGATA was undetected before 16-cell embryo stages, appeared to express after 16-cell embryo stage, and reached to a peak value at gastrula stage, which was 61.5-fold of that at 16-cell embryo stage (P < 0.05, Fig. 1C). Thereafter, the expression level of CfGATA transcript was decrease gradually and maintained at a stable level after D-shaped veliger stage (Fig. 1C). 3.2. Recombinant protein purification and antibody specificity analysis To detect protein distribution of the three transcription factors CfRunt, CfCBFb and CfGATA during C. farreri ontogenesis, a recombinant protein peptide of CfRunt fragment (contains Runt domain), CfCBFb and CfGATA was expressed respectively. High purity of recombinant proteins was proved by SDS-PAGE and the antibodies were proved to interact with CfRunt, CfCBFb or CfGATA specifically (Fig. 2). 3.3. Spatial expression of CfRunt during C. farreri ontogenesis The immunoreactivities of the three transcription factors CfRunt, CfCBFb and CfGATA were detected at 9 developmental stages of C. farreri (Supplementary Fig. 1) using whole-mount immunofluorescence technique. The signal of CfRunt protein was observed firstly at 32-cell stage, and the distributions were specialized gradually with development as to the vegetal pole cells in morula, mesoblastema in gastrula, central region cells and bilateral symmetry cells in the prototroch of trochophore, bilateral

F. Yue et al. / Developmental and Comparative Immunology 61 (2016) 88e96

91

expression of CfRunt was mainly located in vegetal pole cells compared to few signals in animal pole, and then enriched in those regions with the formation of blastocysts (Fig. 3D and 3E). During gastrulation, the expression of CfRunt was almost completely paralleled with the formed mesoderm (Fig. 3F). In trochophore, the immunoreactivity of CfRunt was shifted to the ventral anterior side and restricted clearly to three specific spots presented in the prototroch of trochophore (Fig. 3G). One spot was localized as central region cell mass and the other two was bilateral symmetry cell mass. The expression of CfRunt in the bilateral symmetry cells was still distinguishable in the velum of D-shaped veligers; meanwhile a new immunoreactivity of CfRunt initially occurred at the dorsal anterior side of larvae as a specific sinus structure (Fig. 3H, Supplementary Fig. 2H). In umbonal veligers, the immunoreactivity of CfRunt in the bilateral symmetry cells disappeared and CfRunt was observed in the sinus structure and stomach region of larvae (Fig. 3I, Supplementary Fig. 2I). 3.4. Spatial expression of CfCBFb and CfGATA during C. farreri ontogenesis In contrast, the spatial expression patterns of CfCBFb and CfGATA during C. farreri ontogenesis were similar, but different with the CfRunt. Both the immunoreactivity of CfCBFb and CfGATA was observed firstly in early trochophore presented as the bilateral symmetry cells in prototroch, and then in the specific sinus structure of D-shaped and umbonal veligers (Figs. 4 and 5). The signals of CfCBFb and CfGATA were not detectable in fertilized eggs and embryos underlying cleavage (Figs. 4AeF and 5AeF). The earliest expression of CfCBFb and CfGATA proteins occurred consistently at trochophore stage, located notably at the same sits of prototroch as two specific spots which equaled with the bilateral symmetry cell mass (Figs. 4G and 5G). By D-shaped veliger stage, the two specific spots of CfCBFb disappeared rapidly with the formation of velum, whereas a new immunoreactivity of CfCBFb came up at the dorsal anterior side of larvae as a specific sinus structure (Fig. 4H). Compared to CfCBFb, the two specific spots of CfGATA still distinguishable in the velum of D-shaped veligers and a new immunoreactivity appeared at the dorsal anterior side of larvae as a specific sinus structure (Fig. 5H), which was consistent with the distribution of CfRunt. Subsequently, the immunoreactivity of CfCBFb was observed in the sinus structure, stomach region and the posterior side of umbonal veligers (Fig. 4I), while CfGATA was only observed in the sinus structure of umbonal veligers (Fig. 5I). In addition, there was no immunoreactive fluorescence in negative controls for the examined molecules at all 9 larval stages (Supplementary Fig. 2). 3.5. The expression patterns of CfRunt, CfCBFb and CfGATA in different larvae after bacterial challenge

Fig. 1. Expression level of hematopoietic transcription factors CfRunt, CfCBFb and CfGATA during ontogenesis of scallop C. farreri by real-time quantitative PCR. (A) CfRunt, (B) CfCBFb, (C) CfGATA. Date was shown as mean ± S.E (n ¼ 3e6), and bars with different letters mean significantly different (P < 0.05).

symmetry cells and the specific sinus structure in D-shaped veligers, and the sinus structure in umbonal veligers (Fig. 3). The immunoreactivity of CfRunt was not detectable in fertilized eggs and 2-cell embryos (Fig. 3A and 3B). However, strong immunopositive fluorescence of CfRunt appeared at 32-cell stage throughout the whole embryo (Fig. 3C). By morula stage, the

After bacterial challenge, both the mRNA expression of CfRunt and CfGATA increased significantly in larvae of different stages, while the mRNA expression of CfCBFb was different among different larval stages (Fig. 6). The expression levels of CfRunt in trochophore, D-shaped veligers and pediveligers were all significantly upregulated at 12 and 24 h post bacterial challenge, and reached the highest level at 24, 24 and 12 h respectively, which was 5.0, 3.0 and 3.3-fold of the corresponding control (P < 0.05, Fig. 6AeC). No significant changes of the CfCBFb expression was observed after bacterial challenge in trochophore (Fig. 6D). In D-shaped veliger, the expression levels of CfCBFb was decreased at 12 h post bacterial challenge (0.58-fold, P < 0.05, Fig. 6E), however it increased dramatically at 12 h post bacterial challenge in pediveligers which was 4.1-fold of the

92

F. Yue et al. / Developmental and Comparative Immunology 61 (2016) 88e96

Fig. 2. SDS-PAGE and Western blot analysis of the purification of recombinant proteins and antibody specificity. (A) CfRunt. Lane M: protein marker; lane 1: E. coli without IPTG induction; lane 2: E. coli induced by IPTG; lane 3: Purified rCfRunt; lane 4: Western blot analysis of the rCfRunt polyclonal antibody using purified rCfRunt; lane 5: Western blot analysis of the rCfRunt polyclonal antibody using nuclear protein of hemocyte. (B) CfCBFb. Lane M: protein marker; lane 1: E. coli without IPTG induction; lane 2: E. coli induced by IPTG; lane 3: Purified rCfCBFb; lane 4: Western blot analysis of the rCfCBFb polyclonal antibody using purified rCfCBFb. (C) CfGATA. Lane M: protein marker; lane 1: E. coli without IPTG induction; lane 2: E. coli induced by IPTG; lane 3: Purified rCfGATA; lane 4: Western blot analysis of the rCfGATA polyclonal antibody using nuclear protein of hemocyte.

Fig. 3. Whole-mount immunofluorescence of CfRunt in different embryonic and larval stages of scallop C. farreri. (A) fertilized eggs, (B) 2-cell embryos, (C) 32-cell embryos, (D) morula, (E) blastula, (F) gastrula, (G) trochophore, (H) D-shaped veligers and (I) umbonal veligers. The immunoreactive area was marked with arrow. dg: digestive gland; h: hinge; m: mouth; pr: prototroch; st: stomach; u: umbo; ve: velum. A: anterior; D: dorsal; P: posterior; V: ventral. Bar ¼ 20 mm.

F. Yue et al. / Developmental and Comparative Immunology 61 (2016) 88e96

93

Fig. 4. Whole-mount immunofluorescence of CfCBFb in different embryonic and larval stages of scallop C. farreri. (A) fertilized eggs, (B) 2-cell embryos, (C) 32-cell embryos, (D) morula, (E) blastula, (F) gastrula, (G) trochophore, (H) D-shaped veligers and (I) umbonal veligers. The immunoreactive area was marked with arrow. dg: digestive gland; h: hinge; m: mouth; pr: prototroch; st: stomach; u: umbo; ve: velum. A: anterior; D: dorsal; P: posterior; V: ventral. Bar ¼ 20 mm.

corresponding control (P < 0.05, Fig. 6F). The expression levels of CfGATA in trochophore, D-shaped veligers and pediveligers were all significantly upregulated at 6, 12 or 24 h post bacterial challenge, and reached to the highest level at 12, 24 and 12 h respectively, which was 2.5, 4.2 and 2.0-fold of the corresponding control (P < 0.05, Fig. 6GeI). 4. Discussion Immunocytes, despite distinct in cell type, are produced by the committed differentiation of same hematopoietic progenitors or hematopoietic stem cells underlying hematopoiesis. The developmental process of hematopoiesis is thus generally considered as the process of which the ontogeny of immune system (Lavine and Strand, 2002; Zapata et al., 2006). During ontogenesis, transcription factors like Runt, CBFb and GATA1/2/3 function as the intrinsic switch which interact with other signaling pathways and compose a complex transcriptional network governing the hematopoietic development, HSC emergence and immunocyte generation (Loose et al., 2007; Orkin and Zon, 2008). In the present study, the expression patterns of transcription factors CfRunt, CfCBFb and CfGATA were first investigated during

ontogenesis of scallop to identify the potential origin site and developmental pattern of hematopoiesis. Unexpectedly, the transcripts of CfRunt were detected abundantly as early as in 32-cell embryo and then decreased gradually in morula, blastula and gastrula. While the spatial distributions of CfRunt protein were found throughout the whole embryo at 32-cell stage, and then enriched in the vegetal pole cells in morula, subsequently located in the mesoderm of gastrula. Similar temporal and spatial expression of Runt was also found in sea urchin (Coffman et al., 1996; Robertson et al., 2002). Since Runt has been reported to participate in the body axis formation and segmentation in Drosophila embryo (Gergen and Wieschaus, 1986), it indicated that the abundant expression of CfRunt in early embryo might be necessary for the polarity establishment and cell fate determination of scallop embryo. The specific distribution of CfRunt in mesoderm implied that the mesoderm might be the origin of hematopoietic progenitors of scallop, which was consistent with the emergence of hematopoiesis in other animals (Orkin and Zon, 2008). In contrast, the transcript of CfCBFb was detected at a low level during early development of embryo, while the transcript of CfGATA appeared and gradually increased after 16-cell stage, and reached a peak level at gastrula stage. However, no immunoreactivities of CfCBFb and

94

F. Yue et al. / Developmental and Comparative Immunology 61 (2016) 88e96

Fig. 5. Whole-mount immunofluorescence of CfGATA in different embryonic and larval stages of scallop C. farreri. (A) fertilized eggs, (B) 2-cell embryos, (C) 32-cell embryos, (D) morula, (E) blastula, (F) gastrula, (G) trochophore, (H) D-shaped veligers and (I) umbonal veligers. The immunoreactive area was marked with arrow. dg: digestive gland; h: hinge; m: mouth; pr: prototroch; st: stomach; u: umbo; ve: velum. A: anterior; D: dorsal; P: posterior; V: ventral. Bar ¼ 20 mm.

CfGATA were detected before trochophore meaning that the mRNA translation and protein synthesis of CfCBFb and CfGATA were not initiated in early embryo, which further indicated that CfCBFb and CfGATA might be not involved in the early events of embryo development. During ontogenesis, scallop embryo went through several planktonic larval stages before settlement, including trochophore, D-shaped veliger, umbonal veliger and pediveliger. The transition from gastrula to trochophore was the pivotal step since many developmental events occurred in this process, such as the differentiation of tissues, the formation of original shell, and the establishment of swimming ability. The present study showed that in trochophore, the distribution of CfRunt restricted clearly to three specific spots in the prototroch of larvae presented as one central region cell mass and two bilateral symmetry cell mass. Interestingly, the immunoreactivities of CfCBFb and CfGATA also appeared in the two bilateral symmetry cell mass at the same time. The coincident developmental patterns of these transcription factors suggested that the scallop hematopoiesis might start from trochophore stage and the two bilateral symmetry cell mass might be the potential emergence site of hematopoiesis in scallop. Similarly, previous study reported that the distributions of immune

receptor PGRP-S1 and immune effectors LBP/BPI, lysozyme and SOD were all detected in the two bilateral symmetry cell mass locating at the prototroch of trochophore (Yue et al., 2013), which strongly confirmed the potential origin of hematopoiesis in these regions. Interestingly, a new study on Pacific oyster Crassostrea gigas reported that the mRNA of GATA2/3 mainly located on the edge of shell field and was potentially involved in the larval shell formation (Liu et al., 2015). Different expression patterns between scallop CfGATA and oyster GATA2/3 during early development indirectly indicated that CfGATA is more related with the hematopoietic development. With the hatching of trochophore to D-shaped veliger, the morphological and behavioral characteristics of larvae improve systematically. Functional organs and shell is formed and the larvae begin to feeding actively (Shumway and Parsons, 2011). At this stage, abundant transcripts of CfRunt, CfCBFb and CfGATA were presented in the larvae. Meanwhile, the distinguishable distributions of CfRunt and CfGATA were still observed in the bilateral symmetry cell mass on velum whereas CfCBFb disappeared completely in those regions. However all of the three transcription factors were found to express consistently in a new sinus structure appeared at the dorsal anterior side of larvae. Subsequently in

F. Yue et al. / Developmental and Comparative Immunology 61 (2016) 88e96

95

Fig. 6. Temporal mRNA expression patterns of CfRunt, CfCBFb and CfGATA in different scallop larvae after bacterial challenge. (AeC) the mRNA expression of CfRunt in trochophore, D-shaped veligers and pediveligers, respectively. (DeF) the mRNA expression of CfCBFb in trochophore, D-shaped veligers and pediveligers, respectively. (GeI) the mRNA expression of CfGATA in trochophore, D-shaped veligers and pediveligers, respectively. Date was shown as mean ± S.E (n ¼ 6). *P < 0.05 versus the corresponding control.

umbonal veliger, the immunoreactivity of CfRunt and CfGATA on velum also disappeared and the three transcription factors were all expressed remarkably in the sinus structure. These results suggested that active hematopoiesis might be present in scallop veliger, which is reasonable and required for the larvae survival since they will confront the changeable environment after hatching. Surprisingly, it seems that the site of hematopoiesis was transferred from the bilateral symmetry cell mass to a new sinus structure during the development of trochophore to umbonal veliger. Indeed, similar expression patterns of Runt and GATA1/2/3 family members have been observed during ontogenesis in zebrafish and Drosophila (Crozatier and Meister, 2007; Paik and Zon, 2010). It has also been demonstrated that the embryonic emergence of hematopoiesis occurred in different sites at different stages and animals experienced two waves of de novo hematopoiesis (Crozatier and Meister, 2007; Paik and Zon, 2010). Based on all of the results above, it could be assumed that scallop might experience two waves of hematopoiesis during ontogenesis, similar to vertebrates and invertebrate Drosophila. The first wave of hematopoiesis occurred in the bilateral symmetry cell mass of trochophore, and the second wave occurred in the sinus structure of veliger. Previous reports have showed that pathogen infection could initiate the hematopoiesis of adult shrimp and scallop in order to €derha €ll et al., 2003; Yue et al., replenish the hemocyte pool (So

2014a). To further investigate the performance of emerging hematopoiesis in larvae, the mRNA expression profiles of CfRunt, CfCBFb and CfGATA were detected upon bacterial challenge at different larval stages. The results showed that the mRNA expression levels of both CfRunt and CfGATA were significantly upregulated at 6, 12 or 24 h post bacterial challenge in all larval stages, which suggested the available hematopoietic regulation of scallop larvae response to bacterial infection. In contrast, the mRNA expression of CfCBFb changed inconsistently in different larval stages after bacterial challenge. Since CBFb usually functions as the partner of Runt to increase its transcriptional activity (Adya et al., 2000; Wang et al., 1996), it was presumed that CfRunt and CfGATA might be indispensable for the generation of different types of hemocyte in larval hematopoiesis, while CfCBFb, a sophisticated regulator of CfRunt (Yue et al., 2014a), preferred to involving in the production of specific hemocyte dependent on different larval context. Supportively, by detecting the immune response of different larvae against bacterial challenge, the immune defense system of scallop has been found to appear in trochophore and develop maturely in D-shaped vliger (Yue et al., 2013). Thus, it could be further speculated that functional immunocytes might be produced during the two waves of hematopoiesis in scallop larvae. In conclusion, the transcripts of transcription factor CfRunt, CfCBFb and CfGATA were detected abundantly after 32-cell embryo, trochophore and morula, respectively. The spatial distribution of

96

F. Yue et al. / Developmental and Comparative Immunology 61 (2016) 88e96

CfRunt detected firstly at 32-cell stage throughout the embryo, and specialized gradually to the vegetal pole cells in morula and blastula, then enriched along mesoderm in gastrula. By trochophore, the expression of CfRunt, CfCBFb and CfGATA was consistently appeared in the bilateral symmetry cell mass of prototroch and then disappeared rapidly in D-shaped or umbonal vliger. However, the three transcription factors were all tended to express remarkably in a new sinus structure of D-shaped and umbonal veliger. Furthermore, the mRNA expressions of CfRunt, CfCBFb and CfGATA were changed significantly after bacterial challenge. These results indicated that scallop might experience two waves of hematopoiesis during ontogenesis and the emergence of hematopoiesis potentially occurs in the bilateral symmetry cell mass of trochophore and the sinus structure of veliger. Acknowledgments The authors thank all members of LS Song's laboratory for valuable discussions. This research was supported by National Natural Science Foundation of China (No. 31530069 to Dr. Linsheng Song), National High Technology Research and Development Program (863 Program, No. 2012AA10A401) from the Chinese Ministry of Science and Technology, and funding from Modern Agroindustry Technology Research System (CARS-48), Taishan Scholar Program of Shandong, and National & Local Joint Engineering Laboratory of Ecological Mariculture. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.dci.2016.03.021. References Adya, N., Castilla, L., Liu, P., 2000. Function of CBFb/Bro proteins. Semin. Cell Dev. Biol. 361e368. Elsevier. Bresciani, E., Carrington, B., Wincovitch, S., Jones, M., Gore, A.V., Weinstein, B.M., Sood, R., Liu, P.P., 2014. CBFb and RUNX1 are required at 2 different steps during the development of hematopoietic stem cells in zebrafish. Blood 124, 70e78. Burns, C.E., DeBlasio, T., Zhou, Y., Zhang, J., Zon, L., Nimer, S.D., 2002. Isolation and characterization of runxa and runxb, zebrafish members of the runt family of transcriptional regulators. Exp. Hematol. 30, 1381e1389. Chen, A.T., Zon, L.I., 2009. Zebrafish blood stem cells. J. Cell. Biochem. 108, 35e42. Cheng, S., Zhan, W., Xing, J., Sheng, X., 2006. Development and characterization of monoclonal antibody to the lymphocystis disease virus of Japanese flounder Paralichthys olivaceus isolated from China. J. Virol. Methods 135, 173e180. Coffman, J.A., Kirchhamer, C.V., Harrington, M.G., Davidson, E.H., 1996. SpRunt-1, a new member of the runt domain family of transcription factors, is a positive regulator of the aboral ectoderm-specific CyIIIAgene in sea urchin embryos. Dev. Biol. 174, 43e54. Crozatier, M., Meister, M., 2007. Drosophila haematopoiesis. Cell. Microbiol. 9, 1117e1126. Cumano, A., Godin, I., 2007. Ontogeny of the hematopoietic system. Annu. Rev. Immunol. 25, 745e785. Davidson, A.J., Zon, L.I., 2004. The ‘definitive’(and ‘primitive’) guide to zebrafish hematopoiesis. Oncogene 23, 7233e7246. de Jong, N.E., 2013. Reproduction and Larval Development of the New Zealand Scallop, Pecten Novaezelandiae. Auckland University of Technology. silets, J., Dube , F., 1996. Early developmental events following Desrosiers, R.R., De fertilization in the giant scallop (Placopecten magellanicus). Can. J. Fish. Aquat. Sci. 53, 1382e1392. Detrich, H.r., Kieran, M.W., Chan, F.Y., Barone, L.M., Yee, K., Rundstadler, J.A., Pratt, S., Ransom, D., Zon, L.I., 1995. Intraembryonic hematopoietic cell migration during vertebrate development. Proc. Natl. Acad. Sci. U. S. A. 92, 10713e10717. Evans, C.J., Hartenstein, V., Banerjee, U., 2003. Thicker than blood: conserved mechanisms in Drosophila and vertebrate hematopoiesis. Dev. Cell 5, 673e690. Frelin, C., Herrington, R., Janmohamed, S., Barbara, M., Tran, G., Paige, C.J., ~ iga-Pflücker, J.C., Souabni, A., Busslinger, M., 2013. GATA-3 Benveniste, P., Zun regulates the self-renewal of long-term hematopoietic stem cells. Nat. Immunol. 14, 1037e1044. Galloway, J.L., Zon, L.I., 2003. Ontogeny of hematopoiesis: examining the emergence of hematopoietic cells in the vertebrate embryo. Curr. Top. Dev. Biol. 53, 139e158. Gergen, J.P., Wieschaus, E., 1986. Dosage requirements for runt in the segmentation

of Drosophila embryos. Cell 45, 289e299. Hodgson, C.A., Burke, R.D., 1988. Development and larval morphology of the spiny scallop, Chlamys hastata. Biol. Bull. 174, 303e318. Holz, A., Bossinger, B., Strasser, T., Janning, W., Klapper, R., 2003. The two origins of hemocytes in Drosophila. Development 130, 4955e4962. Jin, H., Xu, J., Wen, Z., 2007. Migratory path of definitive hematopoietic stem/progenitor cells during zebrafish development. Blood 109, 5208e5214. Kondo, M., Wagers, A.J., Manz, M.G., Prohaska, S.S., Scherer, D.C., Beilhack, G.F., Shizuru, J.A., Weissman, I.L., 2003. Biology of hematopoietic stem cells and progenitors: implications for clinical application. Annu. Rev. Immunol. 21, 759e806. Krzemien, J., Oyallon, J., Crozatier, M., Vincent, A., 2010. Hematopoietic progenitors and hemocyte lineages in the Drosophila lymph gland. Dev. Biol. 346, 310e319. Lanot, R., Zachary, D., Holder, F., Meister, M., 2001. Postembryonic hematopoiesis in Drosophila. Dev. Biol. 230, 243e257. Lavine, M., Strand, M., 2002. Insect hemocytes and their role in immunity. Insect Biochem. Mol. Biol. 32, 1295e1309. Lebestky, T., Chang, T., Hartenstein, V., Banerjee, U., 2000. Specification of Drosophila hematopoietic lineage by conserved transcription factors. Science 288, 146e149. Lebestky, T., Jung, S.-H., Banerjee, U., 2003. A Serrate-expressing signaling center controls Drosophila hematopoiesis. Genes Dev. 17, 348e353. €derha €ll, I., 2011. Crustacean hematopoiesis and the astakine cytokines. Lin, X., So Blood 117, 6417e6424. Ling, K.-W., Ottersbach, K., Van Hamburg, J.P., Oziemlak, A., Tsai, F.-Y., Orkin, S.H., Ploemacher, R., Hendriks, R.W., Dzierzak, E., 2004. GATA-2 plays two functionally distinct roles during the ontogeny of hematopoietic stem cells. J. Exp. Med. 200, 871e882. Liu, G., Huan, P., Liu, B., 2015. A GATA2/3 gene potentially involved in larval shell formation of the Pacific oyster Crassostrea gigas. Dev. Genes Evol. 225, 253e257. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2DDCT method. Methods 25, 402e408. Loose, M., Swiers, G., Patient, R., 2007. Transcriptional networks regulating hematopoietic cell fate decisions. Curr. Opin. Hematol. 14, 307e314. Murayama, E., Kissa, K., Zapata, A., Mordelet, E., Briolat, V., Lin, H.-F., Handin, R.I., Herbomel, P., 2006. Tracing hematopoietic precursor migration to successive hematopoietic organs during zebrafish development. Immunity 25, 963e975. North, T., Gu, T.-L., Stacy, T., Wang, Q., Howard, L., Binder, M., Marin-Padilla, M., Speck, N.A., 1999. Cbfa2 is required for the formation of intra-aortic hematopoietic clusters. Development 126, 2563e2575. Orkin, S.H., Zon, L.I., 2008. Hematopoiesis: an evolving paradigm for stem cell biology. Cell 132, 631e644. Paik, E.J., Zon, L.I., 2010. Hematopoietic development in the zebrafish. Int. J. Dev. Biol. 54, 1127e1137. Rehorn, K.-P., Thelen, H., Michelson, A.M., Reuter, R., 1996. A molecular aspect of hematopoiesis and endoderm development common to vertebrates and Drosophila. Development 122, 4023e4031. Robertson, A.J., Dickey, C.E., McCarthy, J.J., Coffman, J.A., 2002. The expression of SpRunt during sea urchin embryogenesis. Mech. Dev. 117, 327e330. Shumway, S.E., Parsons, G.J., 2011. Scallops: Biology, Ecology and Aquaculture. Elsevier. Smith, P., Krohn, R.I., Hermanson, G., Mallia, A., Gartner, F., Provenzano, M., Fujimoto, E., Goeke, N., Olson, B., Klenk, D., 1985. Measurement of protein using bicinchoninic acid. Anal. Biochem. 150, 76e85. €derha €ll, I., Bangyeekhun, E., Mayo, S., So € derh€ So all, K., 2003. Hemocyte production and maturation in an invertebrate animal; proliferation and gene expression in hematopoietic stem cells of Pacifastacus leniusculus. Dev. Comp. Immunol. 27, 661e672. Solek, C.M., Oliveri, P., Loza-Coll, M., Schrankel, C.S., Ho, E.C., Wang, G., Rast, J.P., 2013. An ancient role for Gata-1/2/3 and Scl transcription factor homologs in the development of immunocytes. Dev. Biol. 382, 280e292. Song, L., Wang, L., Qiu, L., Zhang, H., 2010. Bivalve Immunity, Invertebrate Immunity. Springer, pp. 44e65. Tepass, U., Fessler, L.I., Aziz, A., Hartenstein, V., 1994. Embryonic origin of hemocytes and their relationship to cell death in Drosophila. Development 120, 1829e1837. Wang, Q., Stacy, T., Miller, J.D., Lewis, A.F., Gu, T.-L., Huang, X., Bushweller, J.H., Bories, J.-C., Alt, F.W., Ryan, G., 1996. The CBFb subunit is essential for CBFa2 (AML1) function in vivo. Cell 87, 697e708. Yokomizo, T., Ogawa, M., Osato, M., Kanno, T., Yoshida, H., Fujimoto, T., Fraser, S., Nishikawa, S., Okada, H., Satake, M., 2001. Requirement of Runx1/AML1/PEBP2aB for the generation of haematopoietic cells from endothelial cells. Genes Cells 6, 13e23. Yue, F., Shi, X., Zhou, Z., Wang, L., Wang, M., Yang, J., Qiu, L., Song, L., 2013. The expression of immune-related genes during the ontogenesis of scallop Chlamys farreri and their response to bacterial challenge. Fish Shellfish Immunol. 34, 855e864. Yue, F., Zhou, Z., Wang, L., Sun, R., Jiang, Q., Yi, Q., Zhang, T., Song, L., 2014a. The essential roles of core binding factors CfRunt and CfCBFb in hemocyte production of scallop Chlamys farreri. Dev. Comp. Immunol. 44, 291e302. Yue, F., Zhou, Z., Wang, L., Wang, M., Song, L., 2014b. A conserved zinc finger transcription factor GATA involving in the hemocyte production of scallop Chlamys farreri. Fish Shellfish Immunol. 39, 125e135. Zapata, A., Diez, B., Cejalvo, T., Gutierrez-de Frias, C., Cortes, A., 2006. Ontogeny of the immune system of fish. Fish Shellfish Immunol. 20, 126e136.