Expression of immune-related genes in the digestive organ of shrimp, Penaeus monodon, after an oral infection by Vibrio harveyi

Developmental and Comparative Immunology 34 (2010) 19–28

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Expression of immune-related genes in the digestive organ of shrimp, Penaeus monodon, after an oral infection by Vibrio harveyi Wipasiri Soonthornchai a, Wanilada Rungrassamee b, Nitsara Karoonuthaisiri b, Padermsak Jarayabhand a, Sirawut Klinbunga c, Kenneth So¨derha¨ll d, Pikul Jiravanichpaisal c,* a

Department of Marine Science, Chulalongkorn University, Thailand Microarray Laboratory, National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency (NSTDA), 113 Paholyothin, Thailand Science Park, 12120, Thailand c Aquatic Molecular Genetics and Biotechnology Laboratory, National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency (NSTDA), 113 Paholyothin, Thailand Science Park, 12120, Thailand d Department of Comparative Physiology, Uppsala University, Norbyva¨gen 18A, 752 36 Uppsala, Sweden b

A R T I C L E I N F O

A B S T R A C T

Article history: Received 1 April 2009 Received in revised form 21 July 2009 Accepted 21 July 2009 Available online 7 August 2009

In all previous studies, to study shrimp immune response, bacteria were directly injected into the shrimp body and as a consequence the initial step of a natural interaction was omitted. In this study we have instead used an immersion technique, which is a more natural way of establishing an infection, to study immune responses in black tiger shrimp (Penaeus monodon). Normally, Vibrio harveyi (Vh) is highly pathogenic to post-larval shrimp, but not to juveniles which usually resist an infection. In post-larvae, Vh causes a massive destruction of the digestive system, especially in the hepatopancreas and in the anterior gut. We have therefore investigated changes in transcription levels of fifteen immune-related genes and morphological changes in juvenile shrimp following an immersion of shrimp in Vh suspension. We found that a pathogenic bacterium, Vh, has the capacity to induce a local expression of some immune-related genes in shrimp after such a bacterial immersion. Our results show that in the juvenile gut small changes in expression of the antimicrobial peptide (AMP) genes such as antilipopolysaccharide factor isoform 3, crustin and penaeidin were observed. However some other genes were more strongly induced in their expression compared to the AMP genes. C-type lectin, Tachylectin 5a1 and mucin-like peritrophic membrane were increased in their expression and the C-type lectin was affected most in its expression. Several other examined genes did not change their expression levels. By performing histology studies it was found that Vh infection induced a strong perturbation of the midgut epithelium in some regions. As a consequence, the epithelial cells and basement membrane of the infected site were completely damaged and necrotic and massive hemocyte infiltration occurred underneath the affected tissue to combat the infection. ß 2009 Elsevier Ltd. All rights reserved.

Keywords: Innate immunity Shrimp gut Shrimp intestine Vibrio harveyi Antimicrobial peptides C-type lectin

1. Introduction World production of the important species of cultivated shrimp, Penaeus monodon and Litopenaeus vannamei, has increased exponentially since the early 1970s. The production of shrimp from aquaculture in 2005 reached over 2.2 million MT. However, with the rapid increase of shrimp culture increased problems with serious disease outbreaks occur [1].

* Corresponding author at: Aquatic Molecular Genetics and Biotechnology Laboratory, National Center for Genetic Engineering and Biotechnology, National Science and Technology Development Agency, Rajdhevee, 10400 Bangkok, Thailand. Tel.: +66 02 6448150; fax: +66 02 6448190. E-mail address: [email protected] (P. Jiravanichpaisal). 0145-305X/$ – see front matter ß 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.dci.2009.07.007

Vibriosis is the most predominant bacterial disease causing mass mortalities of cultured shrimp worldwide [2–4]. Vibriosis in giant tiger shrimp is commonly caused by several different vibrios such as Vibrio harveyi (Vh), Vibrio parahaemolyticus, and Vibrio alginolyticus. Among them, Vh is the most virulent and prevalent pathogen of larval and grow-out shrimp culture [5–8]. Luminous bacterial vibriosis was named after the luminous symptoms (the shrimp fluoresce) [5] and can cause severe damage to the hepatopancreas [8]. Virulence factors in Vh include the ability to attach and form biofilms, quorum sensing, and secretion of various extracellular products (ECPs) including proteases, hemolysins, lipopolysaccharides, and interaction with bacteriophages [9]. ECPs of Vh are toxic to shrimp [10], and a cysteine protease is one of the major exotoxins [11], and appears to be important for virulence [12]. Thus, vibriosis outbreak in shrimp farming leads to catastrophic financial losses.

20

W. Soonthornchai et al. / Developmental and Comparative Immunology 34 (2010) 19–28

Being an aquatic animal, shrimp are constantly exposed to a variety of bacteria and viruses. While most of them are harmless bacteria, some of them can be pathogenic. Shrimp have several known defense mechanisms to protect themselves against pathogen invasion. The external cuticle provides an effective physical and chemical barrier against the attachment and penetration of pathogens [13]. Unlike foregut and hindgut the midgut (equivalent to intestine) is not lined by cuticle [14] and therefore provides a favorable site for invasion of pathogens [15,16]. In most cases, the defense mechanisms of the cuticle and that of the digestive tract are sufficient to protect against even highly virulent pathogens. However, when pathogens are able to break these defense barriers and enter into the body, they will encounter the innate immune systems. This system consists of cellular and humoral responses and the well-known mechanisms of these responses are phagocytosis, blood coagulation, nodule formation, and encapsulation [17]. Some hydrolytic enzymes are also involved in these processes such as lysozyme [18,19]. Several innate immune response systems have been characterized in crustaceans and P. monodon: the prophenoloxidase activating system (proPO) is induced which in turn will lead to melanization and generation of factors for immune reactions such as the cell adhesion factor, peroxinectin [17,20]. Moreover, during an infection, an array of inducible and constitutive effector molecules, such as antimicrobial peptides (AMPs), lectins and factors required for cellular defense will be engaged in the defense reactions [17]. To date, most knowledge on the invertebrate immune response has been elucidated from the analysis of host reactions after direct injection of bacteria into the body cavity or tissues of these animals. Although this approach has been shown to be effective for identifying virulence factors and host defense mechanisms, it bypasses the natural entry of microbes through oral routes of infection and subsequent persistence within the organism [21]. Therefore, to mimic a natural bacterial infection, in the present work shrimp were exposed to Vh by an immersion method. Using this method, the pathogenic bacteria can enter through the mouth and pass through shrimp intestine. This study focuses on characterizing molecular responses in shrimp intestines triggered by Vh infection. Hence, we selected fifteen candidate genes which are involved or predicted to be involved in shrimp immunity. The expression profiles of all fifteen candidate genes were analyzed in different parts of the intestine and those that were changed in their expression were further analyzed during different time periods after a Vh oral infection. 2. Materials and methods 2.1. Animal and bacterial strain Penaeus monodon juveniles (3–4-month old; 13.2  2.0 g) were obtained from a farm in Nakhonsithammarat province in Thailand. They were transported to the Center of Excellence for Marine and Biotechnology (CEMB), Chulalongkorn University and maintained in tanks with running aerated water at ambient temperature (28  2 8C), salinity at 20 parts per thousand (ppt). The bacterium used was V. harveyi 1526 (Vh) [22]. Bacteria were routinely inoculated in tryptic soy broth (TSB, Oxoid) at 28 8C with constant aeration or on a TSA agar plate supplemented with 2% NaCl. All media and culture of bacteria were performed according to standard methods as described by Collins and Lyne [23]. Bacterial cells were harvested from stationary phase cultures, washed twice with 2% NaCl and resuspended in the same solution. Cell counts were estimated from the optical density (OD) values at 600 nm and the corresponding colony forming units (CFU) were obtained from a serial dilution of bacterial culture grown on agar plates.

Fig. 1. The different parts of the shrimp digestive system are shown. It is divided into four parts: the foregut, hepatopancreas (HP), the midgut and the hindgut. The foregut and hindgut are covered by a cuticle which is continuous to the external part, whereas the midgut epithelium layer is bordered by a peritrophin membrane (dot line).

2.2. Expression profiling of immune-related genes in gut of unchallenged and challenged shrimp by RT-PCR 2.2.1. Unchallenged shrimp To know whether shrimp gut express some immune-related genes, the gut tissues were dissected from apparently healthy and unchallenged juvenile shrimp and then this tissue was equally divided into three parts namely anterior midgut (A), middle midgut (M) and posterior with hindgut (PH) as shown in Fig. 1. 2.2.2. Challenged shrimp To mimic a natural bacterial infection in shrimp, immersion of shrimp in a bacterial suspension was used in this study. Ten juvenile shrimp were placed in a 12-L plastic box containing 10 L of bacterial solution in 20 ppt salinity sea water (at a final concentration of ca. 1.0  107 CFU/ml). Five replicates were performed at the same time. One shrimp was collected from each replicate at 3, 6, 12, 24, and 48 h after bacterial immersion for collection of different tissues. Shrimp which were not given any infection (time 0) served as the control. Control shrimp were also held in plastic boxes during the course of the experiment. In the first experiment, there was no difference of gene expression between anterior (A) and middle midgut, therefore in all subsequent experiments, they were divided into two parts namely anterior-middle midgut (AM) and posterior midgut with hindgut (PH). 2.3. RNA isolation Each sample was homogenized in liquid nitrogen and RNA was extracted by using TriReagent1 (Molecular Research Center) as recommended by the manufacturer’s instruction. The precipitated RNA was dissolved in RNase-free water before subjected to DNase treatment with RNase-free DNase I (0.5 U/mg, Promega) for 30 min at 37 8C. The DNA-free RNA was purified by phenol:chloroform extraction. RNA samples were precipitated with 1/10 volume of 3 M sodium acetate and 1 volume of isopropanol. The RNA pellets were washed with 70% ethanol and resuspended in DEPC-treated sterile water. 2.4. Reverse transcription-PCR (RT-PCR) A total of 1.5 mg of DNA-free RNA was reverse-transcribed using an ImProm-IITM reverse transcriptase according to the manufacturer’s protocol (Promega). The cDNA (100 ng) was subsequently amplified using gene specific primer sets (Table 1). The immunerelated genes analyzed in this study are listed in Table 1. The PCR cycle parameters were an initial denaturation at a 94 8C for 3 min, followed by 25–35 cycles (depending on each gene) of 94 8C denaturation for 30 s, a 60 8C annealing for 45 s, and a 72 8C

W. Soonthornchai et al. / Developmental and Comparative Immunology 34 (2010) 19–28

21

Table 1 Primers for RT-PCR used in this study. Gene

Accession No. or EST libraries

References

Primer sequence (50 –30 )

Antimicrobial peptides antilipopolysaccharide factor isoform 2 (ALF2)

EF523561

[24]

CAAGCGGTGCAGGACCTCC (F) TTAGTGCTCAAGCCAAATCCTGG (R)

297

antilipopolysaccharide factor isoform 3 (ALF3)

EF523562

[24]

CAAGGGTGGGAGGCTGTGG (F) TGAGCTGAGCCACTGGTTGG (R)

286

crustin

BI784446

[25]

TCCCTGGAGGTCAATTGAGTG (F) AGTCGAACATGCAGGCCTATCC (R)

233

penaeidin

BI784459

[25]

AGGATATCATCCAGTTCCTG (F) ACCTACATCCTTTCCACAAG (R)

Melanization and adhesion Peroxinectin (PrX)

AF188840

[26]

CGAAGCTTCTTGCAACTACCA (F) GCAGGCTGATTAAACTGGCTT (R)

547

Prophenoloxidase (proPO)

AF099741

[27]

TGGCACTGGCACTTGATCTA (F) GCGAAAGAACACAGGGTCTCT (R)

590

DQ078266

[28]

AAAGTCACACCACCGAAGCAG (F) TCAAGGCAGTTCTCGTTTCC (R)

508

b-1,3-Glucan Binding Protein (BGBP)

AF368168

[29]

ACGAGATAACCATGTCCGGC (F) CATCGGCGAAGGAACCTGTA (R)

558

Macrophage mannose receptor 1 precursor homolog (MMR)

HC-H-S01-0706-LF

Unpublished data

CCGCTGCTTATCTGGTCTTG (F) GCTTCGGTCTCCGCACTTT (R)

439

Tachylectin 5a1 (TL5a1)

GlEp-N-N01-1607-LF

Unpublished data

GCCAGAGCCTGAACCAGATCC (F) TGTCCGTGCCAATCATACCAG (R)

340

Tachylectin 5a2 (TL5a2)

HC-N-N01-1087-LF, HC-N-N01-11852-LF

Unpublished data

GGCCTGCAGGAGATGAGAAT (F) AATGCCGGCCTTATCATCA (R)

386

ficolin 2 isoform b precursor homolog (ficolin)

HPa-N-N03-2032-LF

Unpublished data

GAAGACAACGAGAACATCAG (F) CTCGCAGTTGGTCTGGTTCG (R)

534

AF539466

[30]

GGCCTCCGTAAGGAACATTT (F) CTTGCTGTTGTAAGCCACCC (R)

460

AY726542

Unpublished data

CAGTTCGCAAATGCAGCAGA (F) CAAGACCGAGCAATGGAACC (R)

460

Peritrophic membrane Mucin-like peritrophin (Mucin-like PM)

IN-N-S01-0247-LF

Unpublished data

ATTGGCAGCATCCTACCGAC (F) CGGATGAGGAATGTGGCAA (R)

653

Internal control gene Elongation factor 1a (EF1a)

DQ021452

[31]

ATGGTTGTCAACTTTGCCCC (F) TTGACCTCCTTGATCACACC (R)

500

Lectins C-type lectin (C-lectin)

Enzymes Lysozyme

Cytosolic manganese superoxide dismutase (MnSOD)

extension for 45 s, and a final extension at 72 8C for 7 min. Five microliters of each PCR product were analyzed on a 1.5% agarose gel electrophoresis, stained with ethidium bromide, and visualized under a transilluminator. The expected sizes of all products are listed in Table 1. 2.5. Expression analysis by relative quantitative real-time PCR (qPCR) To further confirm the changes in expression of ALF3, crustin, penaeidin, C-lectin, TL5a1, and mucin-like PM induced by bacterial challenge, we also quantified these genes using relative quantitative real-time PCR (qPCR) analysis, as described by Livak and Schmittgen [32]. Relative expression levels of ALF3, crustin, penaeidin, C-lectin, TL5a1, and mucin-like PM transcripts were measured by qPCR using the following primer pairs: ALF3 qPCR F and R, crustin qPCR F and R, penaeidin qPCR F/R, C-lectin qPCR F/R, TL5a1 qPCR F/R, and mucin-like PM qPCR F/R, respectively (Table 2). EF1a, a housekeeping gene, was used as an internal

Size (bp)

228–243

Table 2 Primers for qPCR used in this study. Gene

Primer sequence (50 –30 )

Size (bp)

ALF3

TCTCATCTCTCAACAGGAGGCCAA (F) GGTAGAGCTTCCATTGCCAACTGC (R)

103

crustin

AGTTCCTGGAGTTGGAGGTGGATT (F) ACCTCGTTCTGCAGTAATTGCACTC (R)

119

penaeidin

ACAGTCGTATTTGTCCCAGCAGGT (F) AACACCAACCACACACAGACCCAT (R)

111

C-lectin

AGTGCTGGACGAGTGCTTCTATCT (F) TTGAGAGCATAGACGTTCCTGGGT (R)

117

TL5a1

TTGGTGGTACACGAAATGTCACGC (F) AAGGAGTAATGGTGTCCGTGCCAA (R)

117

Mucin-like PM

ACTGGAAACCGAAGGATGTTCCCT (F) TTGTTGCAGTCCTTGTGTGGCTTG (R)

123

EF1a

AGGCGTACTGGTAAGGAACTGGAA (F) AGAGGAGCATACTGTTGGAAGGTCTC (R)

123

22

W. Soonthornchai et al. / Developmental and Comparative Immunology 34 (2010) 19–28

control for all qPCR experiments and was amplified using a primer pair, EF1a qPCR F/R (Table 2). Each primer set was designed to generate 100–130 bp amplicons. Each reaction was performed in a total volume of 20 ml using 0.5 ml of cDNA, 200 nM of each gene specific primer pair with 2 IQ SYBR green supermix (BioRad) using iCycler (BioRad). Cycling parameters were 95 8C for 3 min; 40 cycles of 95 8C for 30 s, 59 8C for 20 s, and 72 8C for 30 s; final extension at 72 8C for 1 min. The specificity of PCR products was confirmed by dissociation curve analysis performed at the end of qPCR by continuously heating from 55 8C to 95 8C with an increment of 0.5 8C. Data were analyzed using iCycler iQ Optical System Software Version 3.1. The relative fold of induction was determined by DDCt method [32]. The standard deviation was calculated based on five animals with three replicates each. Statistical analysis was performed with the Data Analysis tool of Microsoft Excel program (Microsoft Office 2007, Microsoft Inc., Seattle, WA). Data were expressed as mean  SD. Significant difference of gene expression between each time after Vh challenge was determined by paired Student’s t-test (two-tail). Differences were considered statistically significant at P < 0.05. 2.6. Tissue distribution of ALF3, crustin, penaeidin, C-lectin, TL5a1, and mucin-like PM and proPO in unchallenged shrimp The six genes which were most effected in their expression after bacterial challenge were selected to examine the tissue distribution in 16 tissues from normal non-infected shrimp. Total RNA was extracted from epidermis (EP), eyestalk (ES), gill (G), heart (H), hemocyte (HC), hepatopancreas (HP), anterior-middle midgut (AM), posterior midgut with hindgut (PH), lymphoid organ (LP), muscle (MC), abdominal ganglion (AG), pleopod (PP), stomach (ST), thoracic ganglion (TG), testis (TT) and ovary (OV) as described in the RNA isolation protocol. The RNA was reverse-transcribed and the resulting cDNA was used as a template for RT-PCR. 2.7. Expression analysis in circulating hemocytes, hepatopancreas and stomach of challenged shrimp Important tissues of the digestive system such as hepatopancreas and stomach or for immune processes such as hepatopancreas and hemocytes were also studied for immune gene expression following a bacterial challenge. At each time point, hemocytes, stomach, hepatopancreas were retrieved from the samples as described in Section 2.2. Hemocytes were collected from the ventral sinus using a syringe containing 500 ml of an anticoagulant (10% sodium citrate) then the samples were immediately centrifuged at 3300  g at 4 8C for 5 min. The resulting hemocyte pellet was resuspended in 1 ml of TriReagent1 (Molecular Research Center) and kept at 80 8C until use.

5 min and then viewed in a Zeiss SUPRA 35VP transmission electron microscope. 3. Results 3.1. Expression profiling of immune-related genes in gut of unchallenged shrimp by RT-PCR Gene expression profiles of fifteen known immune genes were examined in guts of normal non-infected shrimp. The morphology of gut epithelial cells is different in each part of the anterior, middle and hindgut [34]. Therefore, each shrimp gut was divided into three parts: anterior midgut (A), middle midgut (M), and posterior midgut with hindgut (PH) (Fig. 1). The fifteen candidate genes in Table 1 were chosen as they may have some functions also in the intestine. The expression analysis in the different parts of the gut showed that all fifteen genes were expressed (Fig. 2). Interestingly, ALF2, ALF3, crustin, penaeidin, PrX, C-lectin, BGBP, MMR, TL5a2, Lysozyme, MnSOD and mucin-like PM, were expressed at quite high levels in all parts of the gut (Fig. 2). In contrast, the TL5a1 transcript appeared to be highly expressed in the PH, but expressed at a much lower level in A and M of the shrimp gut. The proPO transcript was expressed at a very low level in all parts of the shrimp gut. Inconsistent pattern of expression in different gut regions was seen for ficolin. 3.2. Expression profiling of immune-related genes in gut of challenged shrimp by RT-PCR The immersion method we used was efficient in that Vh passed through the mouth and intestine, since we could not isolate any bacteria from the hemolymph. Since there were no obvious differences in expression of the tested genes between the anterior (A) and middle (M) parts of midgut in the normal shrimp (Fig. 2), we consequently combined these two into one part, and we designated this as anterior-middle midgut (AM) in our further experiments. Then the expression profiles of the fifteen immune-related genes were examined in the shrimp gut after shrimp were immersed in Vh solution. Compared to the control animals which did not receive a bacterial challenge, the transcription levels of ALF2, PrX, proPO, BGBP, MMR, TL5a2,

2.8. Histopathology and electronic microscopy All samples were fixed in R–F fixative [33] and processing of samples was performed following techniques by Bell and Lightner [34]. Paraffin embedded tissues were sectioned at 4–5 mm thickness and tissue sections were stained with a Mayer’s hematoxylin and Eosin (H&E). The slide sections were examined under light microscopy. For transmission electron microscopy, shrimp gut samples were fixed in 3% glutaraldehyde in 0.1 M PBS (pH 7.4), then washed three times for 5 min each in the same buffer, postfixed 45 min in 1% OsO4 in 0.1 M sodium cacodylate buffer, dehydrated through a series of ethanol, and infiltrated and embedded in TAAB 812 resin. Thick sections (2 mm) were stained with methylene blue for light microscope observation and thin sections (50 nm) were stained with uranylacetate for 30 min and lead citrate for

Fig. 2. Expression profiling of fifteen immune-related genes in the gut of three noninfected shrimp (N1–3) in anterior midgut (A), middle midgut (M) or posterior midgut with hindgut (PH).

W. Soonthornchai et al. / Developmental and Comparative Immunology 34 (2010) 19–28

23

Fig. 3. Time course study of the expression of six genes in the gut of bacteria-challenged shrimp (N = 5) in anterior and middle midgut (AM) and posterior with hindgut (PH). PCR product after amplification with 30 cycles.

ficolin, Lysozyme and MnSOD were not obviously different after the Vh exposure (data not shown). However, the expression levels of ALF3, crustin, penaeidin, C-lectin, TL5a1 and mucin-like PM were altered in their expression by RT-PCR after 3–6 h of the bacterial challenge as it was in normal animals (Fig. 3). Notably was that TL5a1 was still mainly expressed in PH after the bacterial challenge (Fig. 3). 3.3. Expression analysis by relative quantitative real-time PCR (qPCR) To further confirm the RT-PCR expression patterns of the six most affected genes after the bacterial challenge, quantitative real-time PCR (qPCR) analysis was performed as described by Livak and Schmittgen [32]. The qPCR results were consistent with the expression patterns of these genes as determined by the RT-PCR analysis (Fig. 5A and B). A time course study of the relative induction fold of each gene was determined after the Vh exposure. Thus, unchallenged shrimp served as an internal control for each sample. The ALF3 expression showed a 7-fold increase in the AM after 6 and 24 h post-challenge and decreased down to a 2-fold induction at the 48 h time point (Fig. 4A). In PH, the ALF3 gene was 2-fold induced at 6 h post-challenge and gradually decreased to 1.7 and 1.0 at 24 and 48 h, respectively (Fig. 4B).

In AM, penaeidin was induced to its highest expression at the 6h time point, and decreased then down to ca. 2- and 3-fold induction of transcripts at 24 and 48 h after the challenge, and a similar trend was observed in PH. The C-lectin gradually increased in the AM at 6, 24 and 48 h after challenge, where expression increased to 10.7- and 15.1-fold, at 24 and 48 h respectively. This was the highest normalized level of expression observed for any tested gene in this study. Similarly, a dramatic difference was seen in PH at the 48-h time point, where the level reached 10.4-fold. C-lectin expression was the only gene among all genes tested which was highly induced in its expression during the experimental period following a Vh challenge, with a significant induction as early as 6 h, and with a continuous increase to 48 h post-challenge. In AM, the TL5a1 transcript level showed no induction at 6 h (1.2-fold), whereas after 24 h exposure time, it was obviously induced 3-fold and then decreased after a prolonged exposure to the pathogen for 48 h. Surprisingly, there was no obvious change of TL5a1 expression in the PH. Crustin and mucin-like PM were not clearly induced in their expression during the experimental period in AM or PH. Interestingly, according to Log 2 relative expression in AM/PH in all time points (Fig. 5), the expression level of mucin-like PM was much higher in AM than PH. This suggests that the mucin-

24

W. Soonthornchai et al. / Developmental and Comparative Immunology 34 (2010) 19–28

Fig. 4. Time course study of expression of six genes by using qPCR in AM (A) or PH (B) after challenge by Vh immersion. The mRNA levels were determined by qPCR and are expressed relative to EF1a expression. Each histogram represents the mean fold change relative to the control  S.D. of five replicates. Significant differences are indicated by different letter (a–c) at P < 0.05.

Fig. 5. Time course study of relative expression in AM/PH of six genes after challenge by Vh immersion. The mRNA levels were determined by qPCR and are expressed relative to EF1a expression. Each histogram represents the mean fold change relative to the control  S.D. of five replicates.

like PM might play a crucial role for the upper part of the intestine since this part it is not lined by exoskeleton containing chitin and hence the mucin-like PM may provide an effective physical barrier to pathogens. On the other hand, TL5a1 was expressed at a higher level in PH than AM (Fig. 5). These observations suggest that the shrimp intestine might respond to a bacterial infection in a different way in different parts of the intestine. 3.4. Tissue distribution of ALF3, crustin, penaeidin, C-lectin, TL5a1, mucin-like PM and proPO in unchallenged shrimp According to the qPCR analysis, six genes (ALF3, crustin, penaeidin, C-lectin, TL5a1 and mucin-like PM) were increased after

the bacterial challenge. RT-PCR analysis of sixteen different tissues of normal non-challenged shrimp was performed and was compared to the proPO transcript, which is used as a marker transcript for hemocytes (Fig. 6). The EF1a was used as an internal control. The AMP transcripts (ALF3, crustin and penaeidin) were expressed highly in hemocytes and moderately in AM. A high level of expression of the C-lectin was found in the hepatopancreas, AM and PH, lesser expression in hemocytes and very low level in other tissues. Interestingly, not only was the TL5a1 expression found in the stomach and the PH part of the digestive system, but it was also expressed at the highest level among the examined organs in epidermis and at a lower level in abdominal ganglion, pleopod and eyestalk. The mucin-like PM was expressed in a limited number of

Fig. 6. Expression of ALF3, crustin, penaeidin, C-type lectin, TL5a1, mucin-like PM and ProPO in sixteen different tissues from normal non-infected shrimp. EF1a was used as a ubiquitously expressed control. EP = epidermis, ES = eye stalk, G = gill, H = heart, HC = hemocyte, HP = hepatopancreas, M = midgut, MH = midgut and hindgut, LP = lymphoid organ, AG = abdominal ganglion, PP = pleopod, ST = stomach, TG = thoracic ganglion, TT = testis, OV = ovary.

W. Soonthornchai et al. / Developmental and Comparative Immunology 34 (2010) 19–28

tissues, the highest was found in AM and slightly lower levels in PH. The proPO expression level was specific to only the hemocytes (Fig. 6). 3.5. Expression analysis in circulating hemocytes, hepatopancreas and stomach of challenged shrimp We further characterized the expression profiles of the genes which were found to be most affected in their expression in three other tissues, which are important for digestion (hepatopancreas and gut) or for immune reactions (hepatopancreas and hemocytes) of the same challenged shrimp (Fig. 7). This was performed to compare whether the expression level of these immune genes in their ‘‘home’’ tissues was affected by a challenge using bacterial immersion. Expression levels of ALF3, crustin, C-lectin, penaeidin and TL5a1 were detected in the stomach tissue, but no effect in their expression was observed by the Vh challenge. In the hepatopancreas (Fig. 7) of bacteria-challenged shrimp, ALF3, crustin, penaeidin, C-lectin, TL5a1 and proPO transcript were induced at 24 h, and remained at a same level at 48 h exposure to Vh. However, in a few shrimp no change of gene expression could be observed (for example as in N1, Fig. 7) which is likely a result of an individual variation to the bacterial infection. The expression level of the C-lectin was fluctuated in the hepatopancreas during 12 h and then some had strongly increased this transcript at 24 and 48 h. Since the AMP transcripts were detected at very high levels in the circulating hemocytes (Figs. 6 and 7) and hemocyte infiltration is very common during an infection (Fig. 8B and D), the enhanced

25

expression of the AMP genes in the hepatopancreas at 24–48 h post-bacterial challenge could be a result of infiltrating hemocytes. In the bacteria-challenged shrimp, expression of ALF3, crustin, penaeidin, C-lectin, and TL5a1 was not affected in the circulating hemocytes. There was no detectable mucin-like PM transcript in the hepatopancreas or hemocytes and it was barely detected in stomach of bacteria-challenged shrimp (Fig. 7). 3.6. Histopathology To further investigate the impact of the infection on the gut morphology, a histopathological study at different time points was performed. The degree of infection ranged from a mild infection (a few hemocytes infiltrated into some parts of the hepatopancreas or midgut) to a moderate infection. In case of a moderate infection, by 24, Vh induced an increase in hemocyte numbers in the intertubular tissue of the hepatopancreas (Fig. 8B) compared to the control tissue (Fig. 8A). Epithelial cells detached from the basement membrane (Bas) of affected hepatopancreatic tubules and were necrotic (Fig. 8B). As the infection proceeded at 48 h, electron micrographs of cross-sections of the midgut showed that the Vh infection induced a strong perturbation of the midgut epithelium. In some, but not all regions, epithelial cells and basement membrane were damaged and had completely disappeared (Fig. 8D). Moreover, clumps of bacterial cells (b) among cell debris were found in the lumen (Fig. 8D). Interestingly, underneath the site of infection, where a damage of the tissue could be seen, we found many layers of infiltrated hemocytes

Fig. 7. Time course study of ALF3, crustin, penaeidin, C-lectin, TL5a1, mucin-like PM and proPO genes in circulating hemocytes, hepatopancreas and stomach by using RT-PCR. The expression was compared to an internal control, EF1a, after challenge by Vh immersion.

26

W. Soonthornchai et al. / Developmental and Comparative Immunology 34 (2010) 19–28

Fig. 8. Histopathology by H&E staining of hepatopancreas in infected shrimp after 48 h Vh immersion. Panels B and D are from challenged shrimp and panels A and C are from control shrimp. Numerous hemocytic infiltrations (panel B, arrows) and detachment of epithelial cells from the basement membrane (Bas) of affected hepatopancreatic tubules (T) (panel B) are shown, whereas no lesion can be observed in the hepatopancreas of control shrimp (panel A). Electron micrographs (panels C and D) of transversal sections of the midgut collected at 48 h after immersion by Vh showing that the infection provokes a strong perturbation of the shrimp gut (panel D). The epithelium layer is completely destroyed at the infected site and replaced by several layers of hemocytes (arrows). Bacteria (b) are seen among cell debris in the lumen. Bas = basement membrane, EC = epithelial cells, Lum = gut lumen, MV = microvilli, PM = peritrophic membrane.

(arrows) walled up to the gut lumen (Fig. 8D). In contrast, epithelial cells of uninfected shrimp retained their integrity and with a low number of hemocytes (arrows) scattered in the submucosa and muscularis layer under the basement membrane (Bas) (Fig. 8C). Infected shrimp showed well-developed capsules around the infected sites in the hepatopancreas or parts of midgut and bacteria were usually well confined inside these capsules. Therefore, other visceral organs, including gill and heart appeared normal indicating that there was no systemic infection occurring in any of the tested shrimp. 4. Discussion Most previous studies on bacterial infections in shrimp have been conducted using injection of different bacteria directly into the body cavity to monitor expression changes of different immune genes. To study shrimp’s defense mechanism against infections in a more natural context, we investigated the interactions between shrimp and a pathogenic bacterium in the natural route through intestinal tract. When immersed with the highly pathogenic Vh, post-larvae normally die within two days. In contrast, juvenile shrimp were able to survive even at a higher dose of bacteria. Hence, juvenile shrimp were used as a model to study effects of infections on immune gene expression in the intestine through natural infection routes. Among decapod crustacean AMPs, ALFs [35], crustins [36,37] and penaeidins [38] and their tissue distribution have been studied in some detail [36]. According to the tissue distribution analysis in this study, ALF3, crustin and penaeidin were detected in the midgut and expressed higher in the anterior-middle region than in the hindgut, and they all had a low expression in the hepatopancreas. After bacterial challenge, the expression levels of all these AMPs were increased by 24 h in AM and PH. Since these AMP transcripts

were detected at very high levels in hemocytes (Figs. 6 and 7) and hemocyte infiltration in many tissues is predominant upon infection (Fig. 8B and D). The increased expression of the AMP genes in the hepatopancreas and the midgut is most likely a result of infiltrated hemocytes. The proPO gene is specifically expressed in the hemocytes (Fig. 6); therefore, the proPO transcript was used as a hemocyte marker to monitor hemocyte infiltration into different tissues [39]. As suspected the proPO transcript was present in hepatopancreas and midgut which most likely is due to that infiltrating hemocytes were observed in these tissues (Fig. 8). However, it should be observed that ALF3, crustin and penaeidin are all expressed at fairly high levels in AM (Figs. 2 and 6), which suggest that these genes can play a role in the local immune response in the gut and that they can be enhanced in their expression when a pathogen enters into the midgut (Figs. 3 and 4). Among the examined genes, only the C-lectin was continuously increased until the end of the experiment (48 h after a bacterial challenge). The C-lectin in this study was previously cloned and characterized from P. monodon by Luo et al. [28] and was named Pmlectin. It was reported to be specific for bacterial lipopolysaccharides (LPS) and binding was mainly mediated through the Oantigen. It has a strong hemagglutinating, bacteria-agglutinating activity and opsonic effect that enhance hemocytic phagocytosis [28]. Although Pmlectin did not have antibacterial activity or was involved in the activation of the proPO system [40], it functioned both as a pattern recognition protein (PRP) and an opsonin. In this way, it can provide a local immune response and protect the digestive system in shrimp from a bacteria infection. Therefore, the presence of the C-type lectin can be one of the front-line defenses against pathogens in the digestive organs particularly in midgut and hepatopancreas, which are not covered with cuticle as in stomach and hindgut. Since shrimp contain several lectins and probably have different specificities for detecting a variety of

W. Soonthornchai et al. / Developmental and Comparative Immunology 34 (2010) 19–28

pathogens [41–44], more information of these lectins may give insights into the potential roles of lectins as a local immune response in the digestive system of shrimp. Another lectin tested in our study was Tachylectin 5a (TL5a), which was first cloned and characterized from horseshoe crab, Tachypleus tridentatus [45]. In the horseshoe crab, TL5A was expressed abundantly in heart and intestine and faintly in hepatopancreas whereas TL5B was detected only in hemocytes [45]. In shrimp, the expression of TL5a1 was detected by RT-PCR in gut (PH), epidermis, abdominal ganglion, pleopod, stomach, and eyestalk and hardly expressed in hemocytes. Surprisingly, in the gut the TL5a1 transcript was expressed much higher in the PH than in the AM (Fig. 5). It was reported that the environment in the hindgut is a suitable site for bacterial colonization [46]. As a consequence, the high constitutive expression of TL5a1 in the PH might be involved in protection against bacterial colonization. However, the functions of Tachylectins need to be elucidated in shrimp. Lysozyme is ubiquitous in both eukaryotes and prokaryotes. Expression and activities of various lysozymes against bacteria have been studied in penaeid shrimp [30,47–49] as well as its response in expression to a bacterial challenge [18,19]. Although in our study, the expression of Lysozyme transcript was not distinctly altered in shrimp gut after bacterial immersion, the expression was found ubiquitously throughout the shrimp gut. Superoxide dismutases (SODs), important antioxidant enzymes, are present in almost all oxygen respiring animals. In decapod crustaceans, the characterization of SOD and its functions in immunomodulation have been reported [50–54]. A cytosolic manganese SOD (cytMn-SOD) was cloned from the hepatopancreas in freshwater prawn, Macrobachrium rosenbergii. The study showed that the expression in hepatopancreas decreased 3 h post-bacterial injection, but no obvious change was observed in the hemocytes at 3–24 h [54]. Our result shows that the MnSOD transcript was abundant in the midgut, but no obvious change was observed following the immersion challenge. Other defense mechanism like the peritrophic membrane or matrix (PM) may also play an important role against bacterial infections in the midgut. It is well documented in insects that the PM can protect the host from invasion of microorganisms and parasites in the midgut, which is not lined by cuticle. The PM is composed of acellular material produced by the midgut epithelium and consists of proteins and glycosaminoglycans embedded in a chitinous matrix [55]. Recently, several genes encoding PM constituents were reported to be up-regulated after an oral infection of Pseudomonas spp., confirming that the PM may play a defensive role by preventing contact between the bacteria and the gut epithelium [56]. Also in a crustacean, a peritrophin-like protein was up-regulated in hemocytes, heart, stomach, gut, and gills following infection of bacteria by injection, but was constitutively expressed in the ovaries [57]. Our study shows that the mucin-like PM expression was detected at very high level in the midgut (Fig. 5). However, the expression of the mucin-like PM gene was slightly increased by 6 h and then declined at 24 h and 48 h after exposure to Vh. This may indicate that Vh and/or its toxin perturbed the midgut epithelium and may have an affect on the constituent genes responsible for building the peritrophinmembrane such as the mucin-like PM. Liehl et al. [58] revealed that a major contribution to the Drosophila defense against Pseudomonas entomophila is provided by a local, rather than a systemic immune response which supports our results that the expression of five genes (ALF3, crustin, penaeidin, C-lectin and TL5a1) in the circulating hemocytes did not show any obvious changes during the experimental period whereas in the digestive system changes did occur. Also, no bacteria were re-isolated from the hemolymph of the treated

27

shrimp, suggesting that no bacteria entered into hemolymph during these experiments. Therefore, under these conditions the bacterial infection may be confined only to the digestive system. This speculation was consistent with the histopathological observations that the midgut of infected shrimp showed completely destruction of the epithelial cells and it was replaced by intensely infiltrating hemocytes, which would provide a multilayered barrier and defense mechanism to the pathogenic bacteria (Fig. 8D). 5. Conclusions We have used a more natural way of establishing an infection in shrimp by immersion juvenile shrimp in a pathogen solution. By studying the effects of this Vh immersion on expression of the fifteen immune-related genes, we found that nearly all of these genes were constitutively expressed at high levels and only six of them were affected in their expression by the bacteria challenge. Unlike the studies that used bacterial injection as a method to introduce bacteria into body cavity of crustaceans, the expression differences of most of the immune genes did not dramatically increase. Immersion of shrimp in the Vh solution will lead to that the bacteria transferred from the mouth to the posterior part of the alimentary canal. Unlike normal flora of non-pathogenic bacteria, the pathogens use sophisticated strategies to counteract such immune responses in the gut. The persistence of Vh can result in colonization and probably multiplication in the shrimp gut. Subsequently, Vh and/or its toxins destroy the epithelium and try to evade the local immunity to gain an entry into the body cavity. At this stage of infection circulating hemocytes are recruited to the site of invasion to fight against the pathogens and also to heal the damaged tissues. If the pathogens overcome this protection, they will subsequently proceed to the systemic infection and lead to host death. However, if the pathogens are eliminated from the gut, the host will prevail. Acknowledgements This study has been supported by a grant to PJ and NK from National Center for Genetic Engineering and Biotechnology, Thailand and a grant to PJ and KS from the Swedish Science Research Council and Formas. References [1] Tanticharoen M, Flegel TW, Meerod W, Grudloyma U, Pisamai N. Aquacultural biotechnology in Thailand: the case of the shrimp industry. Int J Biotechnol 2008;10:588–603. [2] Lightner DV, Lewis DH. A septicemic bacterial disease syndrome of penaeid shrimp. Mar Fish Rev 1975;37:25–8. [3] Adams A. Response of penaeid shrimp to exposure to Vibrio species. Fish Shellfish Immunol 1991;1:59–70. [4] Lavilla-Pitogo CR, Leano EM, Paner MG. Mortalities of pond-cultured juvenile shrimp Penaeus monodon associated with dominance of luminescent vibrios in the rearing environment. Aquaculture 1998;164:337–49. [5] Lavilla-Pitogo CR, Baticados MCL, Cruz-Lacierda ER, de la Pena LD. Occurrence of luminous bacterial disease of Penaeus monodon larvae in the Phillipines. Aquaculture 1990;91:1–13. [6] Jiravanichpaisal P, Miyazaki T, Limsuwan C. Histopathology, biochemistry and pathogenicity of Vibrio harveyi infecting black tiger prawn Penaeus monodon. J Aquat Anim Health 1994;6:27–35. [7] Karunasagar I, Pai R, Malathi GR, Karunasagar I. Mass mortality of Penaeus monodon larvae due to antibiotic-resistant Vibrio harveyi infection. Aquaculture 1994;128:203–9. ˜ o EM, Lavilla-Pitogo CR, Paner MG. Bacteria flora in the hepatopancreas of [8] Lean pond-reared Penaeus monodon juvenile with luminous vibriosis. Aquaculture 1998;164:367–74. [9] Austin B, Zhang X-H. Vibrio harveyi: a significant pathogen of marine vertebrates and invertebrates. Lett Appl Microbiol 2006;43:119–24. [10] Liu P-C, Lee K-K, Chen S-N. Pathogenicity of different of Vibrio harveyi in tiger prawn, Penaeus monodon. Lett Appl Microbiol 1996;22:413–6.

28

W. Soonthornchai et al. / Developmental and Comparative Immunology 34 (2010) 19–28

[11] Liu P-C, Lee K-K. Cysteine protease is a major exotoxin of pathogenic luminous Vibrio harveyi in the tiger prawn, Penaeus monodon. Lett Appl Microbiol 1999; 28:428–30. [12] Lee K-K, Chen Y-L, Liu P-C. Hemostasis of tiger prawn Penaeus monodon affected by Vibrio harveyi, excellular products, and a toxic cysteine protease. Blood Cells Mol Dis 1999;25(13):180–92. [13] Martin GG, Rubin N, Swanson E. Vibrio parahaemolyticus and V. harveyi cause detachment of the epithelium from the midgut trunk of the penaeid shrimp Sicyonia ingentis. Dis Aquat Org 2004;60:21–9. [14] Lovett DL, Felder DL. Ontogenetic changes in enzyme distribution and midgut function in developmental stages of Penaeus setiferus (Crustacea, Decapoda, Penaeidae). Biol Bull 1990;160–74. [15] Ruby EG, Greenberg EP, Hastings JW. Planktonic marine luminous bacteria: species distribution in the water column. Appl Environ Microbiol 1980;39(2): 302–6. [16] Jayabalan N, Chandran R, Sivakumar V, Ramamoorthi K. Occurrence of luminescent bacteria in sediment. Curr Sci 1982;51:710–1. [17] Jiravanichpaisal P, Lee BL, So¨derha¨ll K. Cell-mediated immunity in arthropods: hematopoiesis, coagulation, melanization and opsonization. Immunobiology 2006;211:213–36. [18] Somboonwiwat K, Supungul P, Rimphanitchchayakit V, Aoki T, Hirono I, Tassanakajon A. Differentially expressed genes in hemocytes of Vibrio harveyi-challenged shrimp Penaeus monodon. J Biochem Mol Biol 2006;39:26–36. [19] Burge EJ, Madigan DJ, Burnett LE, Burnett KG. Lysozyme gene expression by hemocyte of Pacific white shrimp Litopenaeus vannamei, after injection with Vibrio. Fish Shellfish Immunol 2007;22:327–39. [20] Cerenius L, Lee BL, So¨derha¨ll K. The proPO-system: pros and cons for its role in invertebrate immunity. Trends Immunol 2008;29(6):263–71. [21] Vodovar N, Acosta C, Lemaitre B, Boccard F. Drosophila: a polyvalent model to decipher host–pathogen interactions. Trends Microbiol 2004;12:235–42. [22] Rengpipat S, Tunyanun A, Fast AW, Piyatiratitivorakul S, Menasveta P. Enhanced growth and resistance to Vibrio challenge in pond-reared black tiger shrimp Penaeus monodon fed a Bacillus probiotic. Dis Aquat Organ 2003;55:169–73. [23] Collins CH, Lyne PM. Microbiological methods, 4th ed., London: Butterworths. Inc.; 1976. p. 531. [24] Thrantada S, Somboonwiwat K, Rimphanitchaykit V, Tassanakajon A. Antilipopolysaccharide factors from the black tiger shrimp, Penaeus monodon, are encoded by two genomic loci. Fish Shellfish Immunol 2008;24:46–54. [25] Supungul P, Klinbunga S, Pichyangkura R, Hirono I, Aoki T, Tassanakajon A. Antimicrobial peptides discovered in the black tiger shrimp Penaeus monodon using the EST approach. Dis Aquat Org 2004;61:123–35. [26] Sritunyalucksana K, Wongsuebsantati K, Johansson MW, So¨derha¨ll K. Peroxinectin, a cell adhesive protein associated with the proPO system from the black tiger shrimp, Penaeus monodon. Dev Comp Immunol 2001;25(5-6):353–63. [27] Sritunyalucksana K, Cerenius L, So¨derha¨ll K. Molecular cloning and characterization of prophenoloxidase in the black tiger shrimp, Penaeus monodon. Dev Comp Immunol 1999;23(3):179–86. [28] Luo T, Yang H, Li F, Zhang X, Xu X. Purification, characterization and cDNA cloning of a novel lipopolysaccharide-binding lectin from the shrimp Penaeus monodon. Dev Comp Immunol 2006;30:607–17. [29] Sritunyalucksana K, Lee SY, So¨derha¨ll K. The beta-1,3-glucan binding protein from the black tiger shrimp, Penaeus monodon. Dev Comp Immunol 2002;26(3): 237–45. [30] Tyagi A, Khushiramani R, Karunasagar I, Karunasagar I. Antivibrio activity of recombinant lysozyme expressed from black tiger shrimp, Penaeus monodon. Aquaculture 2007;272:246–53. [31] Loongyai W, Phongdara A, Chotigeat W. Cloning and expression of a TCTP homolog from the ovaries of banana prawn. Mar Biol 2007;150(3):455–62. [32] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2-DDCt method. Methods 2001;25:402–8. [33] Hasson KW, Hasson J, Aubert H, Redman RM, Lightner DV. A new RNA-friendly fixative for the preservation of penaeid shrimp samples for virological detection using cDNA genomic probes. J Virol Meth 1997;66:227–36. [34] Bell TA, Lightner DV.In: A handbook of normal penaeid shrimp histology. Baton Rouge, LA: World Aquaculture Society; 1988. p. 2–3. [35] Somboonwiwat K, Marcos M, Tassanakajon A, Klinbunga S, Aumelas A, Romestand B. Recombinant expression and anti-microbial activity of anti-lipopolysaccharide factor (ALF) from the black tiger shrimp Penaeus monodon. Dev Comp Immunol 2005;29:841–51. [36] Relf JM, Chisholm JR, Kemp GD, Smith VJ. Purification and characterization of a cysteine-rich 11.5-kDa antibacterial protein from the granular haemocytes of the shore crab, Carcinus maenas. Eur J Biochem 1999;264:350–7.

[37] Jiravanichpaisal P, Puanglarp N, Petkon S, Donnuea S, So¨derha¨ll I, So¨derha¨ll K. Expression of immune-related genes in larval stages of the giant tiger shrimp, Penaeus monodon. Fish Shellfish Immunol 2007;23:815–24. [38] Destoumieus D, Munoz M, Cosseau C, Rodriguez J, Bulet P, Comps M, et al. antimicrobial peptides with chitin-binding activity, are produced and stored in shrimp granulocytes and released after microbial challenge. J Cell Sci 2000;113(3):461–9. [39] So¨derha¨ll I, Bangyeekhun E, Mayo S, So¨derha¨ll K. Hemocyte production and maturation in an invertebrate, proliferation and gene expression in hematopoeitic stem cells of the freshwater crayfish, Pacifastacus leniusculus. Dev Comp Immunol 2003;27:661–72. [40] Liu Y-C, Li F-H, Bo D, Wang B, Luan W, Zhang X, et al. Molecular cloning, characterization and expression analysis of a putative C-type lectin (Fclectin) gene in Chinese shrimp Fenneropenaeus chinensis. Mol Immunol 2007;44: 597–607. [41] Kondo MH, Matsuyama H, Yano T. The opsonic effect of lectin on the phagocytosis by hemoytes of kuruma prawn, Penaeus japonicus. Fish Pathol 1992;27:217–22. [42] Mercy SPD, Ravindranath H. Hemolysis and clearance of erythrocytes in Scylla serrata are related to the agglutination by the native sialic acid-specific lectin. Comp Biochem Physiol 1994;109:1075–83. [43] Sierra C, Lascurain R, Pereyra A, Guevara J, Martinez G, Agundis C. Participation of serum and membrane lectins on the oxidative burst regulation in Macrobrachium rosenbergii hemocytes. Dev Comp Immunol 2005;29:113–21. [44] Ma TH, Tiu SH, He JG, Chan S-M. Molecular cloning of a C-type lectin (LvLT) from the shrimp Litopenaeus vannamei: early gene down-regulation after WSSV infection. Fish Shellfish Immunol 2007;23:430–7. [45] Gokudan S, Muta T, Tsuda R, Koori K, Kawahara T, Seki N, et al. Horseshoe crab acetyl group-recognizing lectins involved in innate immunity are structurally related to fibrinogen. Proc Natl Acad Sci 1999;96:10086–91. [46] Harris JM. Widespread occurrence of extensive epimural rod bacteria in the hindguts of marine Thalassinidae and Brachyura (Crustacean:Decapoda). Mar Biol 1993;116:615–29. [47] Hikima S, Hikima J-I, Rojtinnakorn J, Hirono I, Aoki T. Characterization and function of kuruma shrimp lysozyme possessing lytic activity against Vibrio species. Gene 2003;316:187–95. [48] de-la-Re-Vega E, Garcia-Orozco KD, Calderon-Arredondo SA, Romo-Figueroa MG, Islas-Osuna MA, Yepiz-Plascencia GM. Recombinant expression of marine shrimp lysozyme in Escherichia coli. Electr J Biotech 2004;7:295–301. [49] de-la-Re-Vega E, Garcia-Galaz A, Diaz-Cinco ME, Sotelo-Mundo RR. White shrimp (Litopenaeus vannamei) recombinant lysozyme has antibacterial activity against Gram negative bacteria: Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio cholerae. Fish Shellfish Immunol 2006;20:405–8. [50] Brouwer M, Brouwer TH, Grater W, Enghild JJ, Thogersen IB. The paradigm that all oxygen-respiring eukaryotes have cytosolic CuZn-superoxide dismutase and that Mn-superoxide dismutase is localized to the mitochondrion does not apply to a large group of marine arthopods. Biochemistry 1997;36:13381–8. [51] Johansson MW, Holmblad T, Tho¨rnqvist PO, Cammarata M, Parrinello N, So¨derha¨ll K. A cell-surface superoxide dismutase is a binding protein for peroxinectin, a cell-adhesive peroxidase in crayfish. J Cell Sci 1999; 112:917–25. [52] Orbea A, Fahimi D, Cajaraville MD. Immunolocalization of four antioxidant enzymes in digestive glands of mollusk and crustacean and fish liver. Histochem Cell Biol 2000;114:393–404. [53] Brouwer M, Brouwer TH, Grater W, Brown-Peterson NB. Replacement of a cytosolic copper/zinc superoxide dismutase by a novel cytosolic manganese superoxide dismutase in crustaceans that use copper (haemocyanin) for oxygen transport. Biochem J 2003;374:219–28. [54] Cheng W, Tung T-H, Liu C-H, Chen J-C. Molecular cloning and characterisation of cytosolic manganese superoxide dismutase (cytMn-SOD) from the giant freshwater prawn Macrobrachium rosenbergii. Fish Shellfish Immunol 2006;20:438–49. [55] Tellam RL, Wijffels G, Willadsen P. Peritrophic matrix proteins. Insect Biochem Mol Biol 1999;29:87–101. [56] Vodovar N, Vinals M, Liehl P, Basset A, Degrouard J, Spellman P, et al. Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species. PNAS 2005;102(32):11414–9. [57] Du X-J, Wang J-X, Liu N, Zhao X-F, Li F-H, Xiang J-H. Identification and molecular characterization of a peritrophin-like protein from fleshy prawn (Fenneropenaeus chinensis). Mol Immunol 2006;43:1633–44. [58] Liehl P, Blight M, Vodovar N, Boccard F, Lemaitre B. Prevalence of local immune response against oral infection in a Drosophila\Pseudomonas infection model. PLoS Pathog 2006;2:0551–561.