Expression of inducible cAMP early repressor is coupled to the cAMP-protein kinase A signaling pathway in osteoblasts

Bone 32 (2003) 483– 490

www.elsevier.com/locate/bone

Expression of inducible cAMP early repressor is coupled to the cAMP-protein kinase A signaling pathway in osteoblasts J.M. Nervina,a,1 S. Tetradis,a,1 Y.-F. Huang,a D. Harrison,a C. Molina,b and B.E. Kreama,* b

a Department of Medicine, University of Connecticut Health Center, Farmington, CT 06030, USA Department of Obstetrics, Gynecology and Women’s Health, New Jersey Medical School, Newark, NJ 07103, USA

Received 4 September 2002; revised 27 December 2002; accepted 22 January 2003

Abstract We previously showed that parathyroid hormone (PTH) induces inducible cAMP early repressor (ICER) in osteoblastic cells and mouse calvariae. PTH signaling in osteoblastic cells is transduced by PTH receptor 1, which is coupled to cAMP-protein kinase A (PKA), protein kinase C (PKC), and calcium signaling pathways. In the present study, we examined the role of these pathways in mediating PTH-induced ICER mRNA and protein expression in osteoblastic MC3T3-E1 cells. Using RT–PCR, we found that PTH(1–34), forskolin (FSK), and 8-bromo-cAMP (8Br-cAMP) induced ICER expression, while phorbol myristate acetate (PMA), ionomycin, and PTH(3–34) did not. Similar results were found for the induction of ICER protein. PKA inhibition by H89 markedly reduced PTH- and FSK-induced ICER expression, while PKC depletion by PMA had little effect. We also tested ICER induction by other osteotropic signaling agonists. Other cAMP-PKA pathway activators, such as PTH-related protein (PTHrP), induced ICER expression, while agents that signal through other pathways did not. PTHrP maximally induced ICER mRNA at 2– 4 h, which then returned to baseline by 10 h. Finally, PTH, FSK, and PTHrP induced ICER in cultured mouse calvariae and osteoblastic ROS 17/2.8, UMR-106, and Pyla cells. We conclude that ICER expression in osteoblasts requires activation of the cAMP-PKA signaling pathway. © 2003 Elsevier Science (USA). All rights reserved. Keywords: ICER; Parathyroid hormone; cAMP; Osteoblast; Bone

Introduction Serum calcium homeostasis occurs primarily through the actions of parathyroid hormone (PTH) on bone and kidney [1]. As an osteotropic agent, PTH has both anabolic and catabolic effects, depending upon the exposure pattern. Intermittent pulses of PTH induce new bone formation, while chronically high levels of PTH lead to bone loss [2–5]. PTH’s anabolic effect is of particular interest because it marks PTH as a potential therapeutic agent for osteoporosis patients for whom current therapies arrest bone loss but do not replace resorbed bone. Although considerable effort has been directed toward clarifying PTH’s mechanism of ac* Corresponding author. Department of Medicine, MC-1850, University of Connecticut Health Center, Farmington, CT 06030. E-mail address: [email protected] (B.E. Kream). 1 Present address. Department of Diagnostic and Surgical Sciences, UCLA School of Dentistry, Los Angeles, California 90095-1668.

tion, we still do not understand the molecular mediators of PTH’s anabolic and catabolic effects on bone. Thus, it is critical to delineate the molecular pathways mediating PTHinduced skeletal changes if we are to take advantage of its anabolic activity. PTH’s effects on osteoblasts are mediated by a cell surface PTH/PTH-related peptide (PTHrP) receptor known as PTHRI [6], which is a G protein-coupled receptor that activates the cAMP-protein kinase A (PKA), protein kinase C (PKC), and calcium [7–9] pathways. Binding of either PTH or PTHrP to PTHR1 simultaneously activates all three pathways, although most data point to the cAMP-PKA signaling pathway as the primary mediator of PTH effects in osteoblasts [10,11]. In fact, many cAMP-responsive genes have been identified in PTH-treated osteoblasts, including collagenase [12,13], c-fos [14], type I collagen [15,16], insulin-like growth factor-I [17], interleukin-6 [18,19] and cyclo-oxygenase-2 (cox-2; PGHS-2) [20].

8756-3282/03/$ – see front matter © 2003 Elsevier Science (USA). All rights reserved. doi:10.1016/S8756-3282(03)00056-5

484

J.M. Nervina et al. / Bone 32 (2003) 483– 490

In addition to showing that PTH-dependent cox-2 transcription requires activation of the cAMP-PKA pathway, we found that this induction is independent of new protein synthesis, thus classifying cox-2 as a PTH-induced early response gene in osteoblasts [20]. Surprisingly, we also found that attenuation of PTH-induced cox-2 transcription does require new protein synthesis. This indicated to us that PTH might also induce a repressor of cox-2 gene transcription. We subsequently found that PTH induces the transcriptional repressor ICER (inducible cAMP early repressor) in osteoblastic MC3T3-E1 cells and mouse calvariae and that ICER represses the expression of a transfected cox-2 promoter–reporter construct in MC3T3-E1 cells [21]. ICER belongs to the cAMP response element modulator (CREM) family of basic leucine zipper transcription factors and is thought to serve as a dominant negative repressor of cAMP-dependent gene expression [22]. ICER expression is coupled to the cAMP-PKA pathway in several cell types. An exception to this is in PC12 pheochromocytoma cells, in which ICER can be induced not only through the cAMPPKA pathway but also the MAP kinase pathway [23]. This suggests that cAMP production and PKA activation is not always an a priori event in ICER induction. Given that ICER is induced following activation of PTHR1, which is coupled to multiple signaling pathways, we undertook a thorough examination of which pathways are involved in PTH-induced ICER expression in osteoblasts. Because PTH is a potent activator of the cAMP-PKA pathway and ICER expression in other tissues is almost exclusively cAMP-dependent, we hypothesized that PTHinduced ICER expression in osteoblasts occurs through the cAMP-PKA pathway. In the present study, we found that PTH-dependent ICER mRNA and protein expression in osteoblastic cells were tightly coupled to the cAMP-PKA pathway, with little or no contribution from the PKC or calcium pathways. In addition, we showed that ICER was expressed following treatment with PTHrP and that noncAMP-PKA pathway agonists did not induce ICER expression in osteoblasts.

Materials and methods Materials Synthetic bovine PTH(1–34), bovine PTH(3–34) amide, human PTHrP(1– 40), forskolin (FSK), phorbol myristate acetate (PMA), 8-bromocyclic AMP (8Br-cAMP), and ionomycin were purchased from Sigma Chemical Company (St. Louis, MO). PTH and PTHrP were prepared as stock solutions containing 1 mg/ml bovine serum albumin in 0.001 N HCl and diluted in culture medium at least 1000fold. FSK, PMA, and ionomycin were prepared as stock solutions in 100% ethanol and diluted in culture medium at

least 1000-fold. 8Br-cAMP was dissolved directly in the culture medium to a final concentration of 1 mM. Cell culture Osteoblastic murine MC3T3-E1 cells were the kind gift of Drs. M. Noda (Tokyo Medical and Dental University, Tokyo, Japan) and Y. Hakeda (Meikai University, Saitama, Japan). MC3T3-E1 were plated at 5000 cells/cm2 in DMEM supplemented with 10% heat-inactivated FCS, 100 U/ml penicillin, and 50 ␮g/ml streptomycin in a humidified atmosphere of 5% CO2 at 37°C. Medium was changed every 3 days, with a final medium change 2 days prior to treatment with effectors, which were pulsed directly into the culture medium. Thus, all treatments were performed 6 –7 days after plating, when the cells had reached confluency. Organ culture of mouse calvariae Timed-pregnant female CD-1 mice from Charles River Breeding Company (Boston, MA) were maintained in a 14 L:10 D photoperiod and were given commercial rodent chow and water ad lib. Calvariae were surgically removed from neonatal mice (6 – 8 days old) and cultured for 1 h in BGJb medium (Fitton-Jackson modification) supplemented with 1 mg/ml BSA, 100 ␮g/ml ascorbic acid, and 1 mM proline. Hemicalvariae were cultured overnight in individual 35-mm wells of six-well tissue culture plates in BGJb medium (formulated as above) and used for experiments following the overnight preculture. Effectors were pulsed directly into the culture medium. The University of Connecticut Health Center Animal Care Committee approved all animal protocols for this study. RNA extraction Total cellular RNA was extracted from one 100-mm plate of cells or six pooled hemicalvariae by the method of Chomczynski and Sacchi [24]. Samples were homogenized in 4 M guanidinium isothiocyanate (GTC), 25 mM sodium acetate, H2O-saturated phenol, and chloroform-isoamyl alcohol (24:1), precipitated with 100% isopropanol, reextracted in GTC, reprecipitated in 100% isopropanol, and washed with 80% ethanol. Total RNA was quantitated by absorbence at 260 nm and purity was assessed as the OD260/ OD280 ratio. Reverse transcription–polymerase chain reaction RT–PCR was done using a standard protocol as previously described [21]. Briefly, 3 mg RNA was incubated with oligo dT primers (Gibco BRL, Grand Island, NY) in RT buffer at 70°C for 3 min. An RT solution containing dNTPs, DTT, RNAse BLOCK 1 (Stratagene, La Jolla, CA), and M-MLV RT (Gibco BRL) was added and the final mixture was incubated at 42°C for 1 h. The reaction was

J.M. Nervina et al. / Bone 32 (2003) 483– 490

terminated by incubation at 80°C for 10 min. PCR was performed using the reverse-transcribed RNA mixture as a template, sense and antisense primers, Taq polymerase, PCR buffer, dNTPs, and MgCl2 for 25 cycles (45 s at 94°C, 45 s at 65°C, and 2 min at 72°C). PCR was hot started at 94°C for 2 min, after which dNTPs were added. ICER PCR primers correspond to bases ⫺16/⫹4 of the sense strand (5⬘TATGCAAAACGGCAACATGG3⬘) and to bases ⫹1068/⫹1090 of the antisense strand (5⬘CTACTAATCTGTTTTGGGAGAGC3⬘). Murine GAPDH was amplified using specific primers (Clontech Laboratories, Inc., Palo Alto, CA) that produced either a 983- or a 452-bp product to serve as an internal control. PCR products were fractionated by 6% polyacrylamide gel electrophoresis and visualized by ultraviolet illumination of the ethidium bromidestained gel. RT–PCR is expected to generate four ICER products of 779 (ICER I), 743 (ICER I␥), 382 (ICER II), and 346 (ICER II␥) bp. RT–PCR data are representative of three independent experiments.

485

Fig. 1. Agents that activate the cAMP-PKA pathway induced ICER mRNA in osteoblasts. Confluent MC3T3-E1 cells were treated with vehicle, 10 nM bovine PTH(1–34), 10 ␮M FSK, 3 mM 8Br-cAMP (8-BR), 0.1 ␮M PMA, or 1 ␮M ionomycin for 2 h. RNA was extracted and used for RT–PCR as described under Materials and methods. This RT–PCR assay generated the four predicted ICER products: 779 (ICER I), 743 (ICER I␥), 382 (ICER II), and 346 (ICER II␥) bp. M, molecular weight markers; C, cells treated with vehicle.

Preparation of nuclear extracts and Western blotting Results Nuclear extracts were prepared as previously described [25]. Briefly, after treatment with agonists, MC3T3-E1 cells were washed, scraped, centrifuged, and resuspended in buffer A (10 mM Hepes–KOH, pH 7.9, 0.75 mM spermidine, 0.15 mM spermine, 0.1 mM EDTA, 10 mM KCl, and freshly added 0.5 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride, 1 mg/ml leupeptin, and 1 mg/ml pepstatin). Cells were repelleted by centrifugation, resuspended in buffer A, centrifuged and homogenized in 0.5 ml of buffer B (20 mM Hepes–KOH, pH 7.9, 20% glycerol (v/v), 0.42 mM NaCl, 0.75 mM spermidine, 0.15 mM spermine, 0.2 mM EDTA, and freshly added 0.5 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride, 1 mg/ml leupeptin, and 1 mg/ml pepstatin). Homogenates were incubated at 4°C for 30 min, centrifuged, and supernatants were collected and dialyzed for 6 h against 250 ml of buffer C (20 mM Hepes–KOH, pH 7.9, 20% glycerol (v/v), 0.1 mM NaCl, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride, 1 mg/ml leupeptin, and 1 mg/ml pepstatin). Protein content of the extracts was quantified using the BCA assay [26]. Protein extracts were stored at ⫺70°C until Western immunoblot assay. Nuclear extract (40 ␮g) was fractionated by electrophoresis on a 12.5% polyacrylamide/SDS gel, transferred to a PVDF membrane (Millipore Corporation, Bedford, MA), and incubated with a polyclonal anti-CREM antibody (1: 200 dilution) that recognizes all CREM and ICER proteins [22]. Following incubation with horseradish peroxidase (HRP)-conjugated secondary antibody (1:3000 dilution), signals were illuminated by a Phototope-HRP Western blot detection system (New England Biolabs, Beverly, MA) and detected with a BioMax film (Eastman Kodak Company, Rochester, NY).

Effect of PTH-coupled pathway activators on ICER mRNA and protein expression in MC3T3-E1 cells Several selective activators were used to determine which pathway mediates PTH-induced ICER expression. FSK and 8Br-cAMP activate the cAMP-PKA pathway. FSK directly activates adenylate cyclase, while 8Br-cAMP acts as a cAMP analog and directly activates PKA. The PKC pathway was activated by PMA, which is a diacylglycerol analog that directly activates PKC. The calcium ionophore ionomycin was used to activate the calcium pathway. As shown in Fig. 1, only 10 ␮M FSK and 3 mM 8BrcAMP mimicked bovine PTH(1–34) induction of ICER mRNA after a 2-h treatment. Neither 100 nM PMA nor 1 ␮M ionomycin induced ICER mRNA expression after 2 h. Likewise, FSK, PTH, and 8Br-cAMP, but not PMA, induced a group of low-molecular-weight protein bands centered around 14.5 kDa that were immunoreactive with a polyclonal CREM antibody on a Western blot (Fig. 2). Although some of the high-molecular-weight bands may represent CREM isoforms, ICER proteins are clearly discemible as low-molecular-weight, inducible immunoreactive products. We also assessed the ability of PTH(3–34) to induce ICER mRNA. The absence of the first two amino acids renders PTH incapable of activating the cAMP-PKA pathway [27]. Thus, PTH(3–34) provides indirect evidence for cAMP involvement in ICER induction. PTH(3–34) at concentrations ranging from 0.1 to 100 nM did not induce ICER mRNA (Fig. 3).

486

J.M. Nervina et al. / Bone 32 (2003) 483– 490

Fig. 2. Agents that activate the cAMP-PKA pathway induced ICER protein in osteoblasts. Confluent MC3T3-E1 cells were treated with vehicle, 10 nM bovine PTH(1–34), 10 ␮M FSK, 3 mM 8Br-cAMP (8-BR), or 0.1 ␮M PMA for 4 h. Nuclear extracts were prepared and Western blotting was performed as described under Materials and methods. ICER proteins were discernible as inducible, low-molecular-weight proteins migrating in proximity to the migration of the 14.3-kDa standard. Higher-molecular-weight species were not inducible and may represent other CREM isoforms or nonspecific bands. M, molecular weight markers; C, cells treated with vehicle.

Effect of PTH-coupled pathway inhibitors on ICER mRNA expression in MC3T3-E1 cells The PKA-specific inhibitor H89 was tested for its ability to affect ICER mRNA induction in MC3T3-E1 cells. A 1-h pretreatment with 30 ␮M H89 markedly reduced ICER mRNA induction by 10 nM PTH and 10 ␮M FSK (Fig. 4). Overnight pretreatment with 1 ␮M PMA to deplete cellular PKC [28] did not affect ICER mRNA expression following a subsequent 2-h treatment with 10 nM PTH or 10 ␮M FSK (data not shown). Effect of PTHrP on ICER mRNA induction in MC3T3-E1 cells

␮M FSK were used as positive controls, while 100 nM PMA served as a negative control. Of the agents tested, only the positive controls (PTH and FSK) induced ICER mRNA as determined by RT–PCR. Fibroblast growth factor-2 (10 nM), transforming growth factor (TGF)-␣ (1 ng/ml), epidermal growth factor (1 ng/ml), platelet-derived growth factor (1 ng/ml), lipopolysaccharide (100 ng/ml), 1,25-dihydroxyvitamin D3 (10 nM), estradiol (10 nM), dexamethasone (10 ␮M), retinoic acid (10 ␮M), interleukin-1 (10 ng/ml), interleukin-4 (10 ng/ml), TGFB (1 ng/ml), and serum (10%) did not induce ICER mRNA in MC3T3-E1 cells (data not shown) ICER mRNA induction in other osteoblast models To insure that the cAMP-dependent nature of ICER induction was not unique to MC3T3-E1 cells but was a common osteoblast response, we examined ICER mRNA induction by 10 nM PTH(1–34), 10 ␮M FSK, and 10 nM PTHrP(1– 40) in several other osteoblastic models. All three agents induced ICER mRNA expression in ROS 17/2.8, UMR-106, and Py1a cells (data not shown). A 2-h treatment with each agonist at the concentration shown induced ICER mRNA expression in cultured neonatal mouse calvariae (Fig. 7). In calvariae, there was a weak ICER signal in control calvariae and a slight upregulation of ICER mRNA by PMA and ionomycin.

Discussion PTH affects bone metabolism through the cell surface PTHrP receptor. This receptor was renamed PTHR1 following the isolation of a second class of PTH receptor, termed PTHR2. Although PTHR2 specifically binds PTH, there is

Because PTH and PTHrP signal through the same receptor in osteoblasts, we assessed the kinetics of PTHrP-induced ICER expression in MC3T3-E1 cells using human PTHrP(1– 40). Both the dose response (0.0001 to 100 nM) (Fig. 5) and time course (1–10 h) (Fig. 6) for PTHrPinduced ICER mRNA expression were similar to those in PTH-treated MC3T3-E1 cells as we previously reported [21]. As detected by RT–PCR, PTHrP-induced ICER mRNA levels peaked at 2 h and then returned to control levels by 10 h (Fig. 6). PTHrP induced ICER mRNA at concentrations as low as 0.01 nM (Fig. 5), making PTHrP as potent as PTH in affecting ICER expression [21]. Effect of various pathway agonists on ICER mRNA induction in MC3T3-E1 cells Confluent MC3T3-E1 cells were treated for 2 h with a number of agents that signal through pathways other than cAMP-PKA. For these experiments, 10 nM PTH and 10

Fig. 3. PTH(3–34) did not induce ICER mRNA in osteoblasts. Confluent MC3T3-E1 cells were treated with vehicle, 10 nM bovine PTH(1–34), 10 ␮M FSK, 0.1 ␮M PMA, or bovine PTH(3–34) at the concentrations indicated for 2 h. RNA was extracted and used for RT–PCR as described under Materials and methods. M, molecular weight markers; C, cells treated with vehicle.

J.M. Nervina et al. / Bone 32 (2003) 483– 490

Fig. 4. PKA inhibition reduced PTH- and FSK-induced ICER mRNA expression in osteoblasts. Confluent MC3T3-E1 cells were pretreated with vehicle (left) or 30 ␮M H89 (right) for 1h and then with vehicle, 10 nM bovine PTH(1–34), 10 ␮M FSK, or 0.1 ␮M PMA for 2 h. RNA was extracted and used for RT–PCR as described under Materials and methods. M, molecular weight markers; C, cells treated with vehicle.

little indication that this receptor is of significance in bone, as PTHR2 is highly expressed in the pancreas and brain but has yet to be identified in the skeleton [29 –31]. Instead, PTHR1 is thought to mediate PTH’s effects in osteoblastic cells [7]. This receptor is a member of the G proteincoupled, seven transmembrane-spanning receptor family and is activated by both PTH and PTHrP, a peptide hormone that shares 8 of its first 13 amino acids with PTH [32]. PTHrP functions in an autocrine or paracrine manner and is vital for normal skeletal development, as PTHrP-deficient mice undergo premature skeletal ossification [33,34]. This pattern is mimicked in PTHrP-deficient mice [35–37] thus reinforcing the role of this receptor-ligand pair in development. Identifying the signaling pathways that mediate PTHinduced gene expression via PTHR1 activity is complicated by the fact that PTHR1 is coupled to cAMP-PKA, PKC, and calcium signaling pathways. Using selective pathway agonists and antagonists, we have determined that PTH-induced ICER mRNA and protein in osteoblastic cells were cAMP-dependent, as manipulation of the cAMP-PKA signaling pathway alone consistently affected ICER expression in each osteoblast model tested. The selective cAMP-PKA activators FSK and 8Br-cAMP mimicked PTH-induced ICER mRNA (Fig. 1) and protein (Fig. 2) expression and inhibition of PKA by H89 markedly reduced PTH- and FSK-induced ICER mRNA expression (Fig. 4). In contrast, selective PKC activators and inhibitors had no effect on PTH- or FSK-induced ICER mRNA. Additionally, calcium signaling was not sufficient to induce ICER mRNA. Finally, PTH(3–34), even at 100 nM, was unable to induce ICER mRNA (Fig. 3). The cAMP-dependent nature of PTH-induced ICER expression in osteoblastic cells is consistent with previous studies in other tissues, including the pineal gland [22,38,39], thyroid gland [40], endometrium [41], ovary [42], Sertoli cells [43], liver [44], T lymphocytes [45], and

487

heart [46]. Interestingly, nerve growth factor induces ICER in adrenal PC12 cells through the ras-MAP kinase pathway [23], suggesting that ICER induction may not be strictly coupled to the cAMP-PKA pathway in all cell types. In addition, along with forskolin and PMA, gastrin, cholecystokinin, and epidermal growth factor induce ICER in pancreatic AR42J cells [47]. Osteoblasts demonstrate a remarkable fidelity between ICER induction and cAMP-PKA pathway activation in osteoblastic cells. Indeed, among the several MAP kinase pathway activators tested here, none was capable of inducing ICER in MC3T3-E1 cells. One possible explanation for why ICER mRNA was undetected following treatment with the non-cAMP-PKA activators tested in this study is that the single dose used for each agent and the single time point used were not optimal for inducing ICER in these cells. This seems unlikely, as the doses used produced maximal effects in other studies and the 2-h time point represents the time when ICER is maximally induced in virtually every tissue studied, including osteoblastic cells. Even if peak ICER expression was missed, some level of induction should have been detectable by RT–PCR. Therefore, we conclude that ICER induction in osteoblastic cells is primarily coupled to the cAMP-PKA signaling pathway. Our conclusion that PTH-induced ICER expression is cAMP dependent in osteoblastic cells has significant functional implications. ICER is a potent repressor of cAMPmediated gene expression [22,38], and it is known that many, but not all, of PTH’s effects are mediated through the cAMP-PKA arm of its signaling triad [10,11]. Therefore, ICER offers a mechanism for selectively inhibiting the cAMP-PKA portion of the PTH response, leaving the PKC

Fig. 5. PTHrP induced ICER mRNA expression in a dose-dependent manner in osteoblasts. Confluent MC3T3-E1 cells were treated with vehicle, 10 nM bovine PTH(1–34), 10 ␮M FSK, and human PTHrP(1– 40) at the indicated concentrations for 2 h. RNA was extracted and used for RT–PCR as described under Materials and methods. M, molecular weight markers; C, cells treated with vehicle.

488

J.M. Nervina et al. / Bone 32 (2003) 483– 490

Fig. 6. PTHrP induced ICER mRNA expression in a time-dependent manner in osteoblasts. Confluent MC3T3-E1 cells were treated with vehicle or 10 nM human PTHrP(1– 40) for the times indicated. RNA was extracted and used for RT–PCR as described under Materials and methods. M, molecular weight markers; C, cells treated with vehicle.

and calcium pathways unaffected. Such tightly regulated control of cAMP-mediated events would confer a level of economy and precision to gene expression that could enhance survival. An example of this kind of molecular finetuning can be seen in CREM-deficient (hence ICER-deficient) mice [48]. These mice have altered N-acetyltransferase (NAT) expression in the pineal gland[49]. NAT is an enzyme involved in melatonin synthesis and undergoes a circadian rhythm of expression and activity that is cAMP dependent. Interestingly, NAT expression and activity are higher in CREM knockouts, although the circadian rhythm of NAT remains intact [48]. This suggests that CREM proteins, including ICER, do confer a degree of transcriptional precision and that these proteins primarily play an inhibitory role in controlling cAMP-dependent gene expression. It also suggests that redundant systems control cAMP signaling events, as NAT expression is not completely unregulated in these mice, suggesting that ICER finetunes cAMP-dependent gene expression. To determine the role of ICER in bone, we are studying the impact of both ICER/CREM deficiency and osteoblasttargeted ICER expression in mice. ICER does not appear to be vital for bone development, as CREM-knockout mice, which lack all CREM proteins including ICER, do not have overt bone abnormalities. However, it may be necessary to manipulate CREM knockout mice to reveal a phenotype. This idea is supported by a partial hepatectomy model in which CREM knockout mice have delayed liver regeneration compared to normal mice; the defect is due to deregulation of a number of cell cycle genes and a subsequent delay in the usual peak of cell replication that follows partial hepatectomy [50]. Any conclusions from our examination of CREM knockout mice must, however, take into account the fact that they are deficient not only in ICER, but in all CREM proteins. In this regard, we have found that, in addition to ICER, normal osteoblasts express nearly the entire repertoire of known CREM isoforms (Liu and Kream,

unpublished data). As a complementary model to examine the role of ICER in bone, we have also developed transgenic mice that exhibit Colla1-driven ICER expression in osteoblasts; at least one of the founder lines exhibits osteopenia (Huang and Kream, unpublished results). In all likelihood, the presence of ICER in osteoblasts represents a finetuning mechanism that allows cAMP-dependent gene expression to be regulated with great precision. We hypothesize that ICER could affect the magnitude and/or attenuation of gene expression in response to hormones, such as PTH, that stimulate cAMP production. In addition, ICER could be responsible for the refractory phase of cAMP signaling. If ICER does in fact play a role in finetuning PTH-induced gene expression, we would expect genes such as cox-2 [51] and interleukin-6 [19,52] to be expressed, but in a deregulated manner. Interestingly, in CREM knockout mice with partial liver hepatectomy, there is delayed attenuation of c-fos induction in response to cAMP [50]. Thus, we will likely find that cAMP-dependent gene expression in osteoblasts is less tightly regulated in the absence of ICER proteins. We believe that, in osteoblasts, ICER likely contributes to the normal pattern of gene expression in response to oscillatory hormones and signals. In summary, we have demonstrated that ICER mRNA and protein expression in osteoblastic cells required an intact cAMP-PKA signaling pathway. Manipulation of the cAMP-PKA pathway produced strong effects on ICER expression. We also found that, among several agents that affect osteoblast function, only those that signal through the cAMP-PKA pathway were able to induce ICER expression. PTHrP induced ICER with kinetics that were similar to PTH. Based on these data, we conclude that ICER expression in osteoblastic cells is primarily coupled to the cAMPPKA signaling pathway.

Fig. 7. Agents that activate the cAMP-PKA pathway induced ICER mRNA in mouse calvariae. Cultured neonatal mouse calvariae were treated with vehicle, 10 nM bovine PTH(1–34), 10 ␮M FSK, 10 nM human PTHrP(1– 40), 0.1 ␮M PMA, or 1 ␮M ionomycin for 2 h. RNA was extracted and used for RT–PCR as described under Materials and methods. M, molecular weight markers; C, calvariae treated with vehicle.

J.M. Nervina et al. / Bone 32 (2003) 483– 490

Acknowledgments This work was supported by a grant to B.E.K. (AR29850 and AR46542) from the National Institutes of Arthritis and Musculoskeletal Diseases of the National Institutes of Health.

References [1] Bringhurst FR, Demay MB, Kronenberg HM. Hormones and disorders of mineral metabolism. In: Wilson J, Foster D, Larsen P, Kronenberg HM, editors. Williams textbook of endocrinology. Philadelphia: WB Saunders; 1998, p. 1155–209. [2] Dempster DW, Cosman F, Parisien M, Shen V, Lindsay R. Anabolic actions of parathyroid hormone on bone. Endocrine Rev 1993;14: 690 –709. [3] Hock JM, Gera I. Effects of continuous and intermittent administration and inhibition of resorption on the anabolic response of bone to parathyroid hormone. J Bone Miner Res 1992;7:65–72. [4] Ishizuya T, Yokose S, Hori M, Noda T, Suda T, Yoshiki S, Yamaguchi A. Parathyroid hormone exerts disparate effects on osteoblast differentiation depending on exposure time in rat osteoblastic cells. J Clin Invest 1997;99:2961–70. [5] Podbesek R, Edouard C, Meunier PJ, Parsons JA, Reeve J, Stevensosn RW, et al. Effects of two treatment regimes with synthetic human parathyroid hormone fragment on bone formation and the tissue balance of trabecular bone in greyhounds. Endocrinology 1983; 112:1000 – 6. [6] Juppner H. Receptors for parathyroid hormone and parathyroid hormone-related peptide: exploration of their biological importance. Bone 1999;25:87–90. [7] Abou-Samra AB, Jupner H, Force T, Freeman MW, Kong XF, Schipani A, et al. Expression cloning of a common receptor for parathyroid hormone and parathyroid hormone-related peptide from rat osteoblast-like cells: a single receptor stimulates intracellular accumulation of both cAMP and inositol triphosphates and increases intracellular free calcium. Proc Natl Acad Sci USA 1992;89: 2732– 6. [8] Bringhurst FR, Juppner H, Guo J, Urena P, Potts JT, Kronenberg HM. Cloned, stably expressed parathyroid hormone(PTH)/PTH-related peptide receptor activate multiple messenger signals and biological responses in LLC-PK1 kidney cells. Endocrinology 1993;132: 2090 – 8. [9] Schwindinger WF, Fredericks J, Watkins L, Robinson H, Bathon JM, Pines M, et al. Coupling of the PTH/PTHrP receptor to multiple G-proteins: direct demonstration of receptor activation of Gs, Gq/11, and Gi(1) by [alpha-32P]GTP-gamma-azidoanilide photoaffinity labeling. Endocrine 1998;8:201–9. [10] Partridge NC, Bloch SR, Pearman AT. Signal transduction pathways mediating parathyroid hormone regulation of osteoblastic gene expression. J Cell Biochem 1994;55:321–7. [11] Swarthout JT, D’Alonzo RC, Selvamurugan N, Partridge NC. Parathyroid hormone-dependent signaling pathways regulating genes in bone cells. Gene 2002;282:1–17. [12] Civitelli R, Hruska KA, Jeffrey JJ, Kahn AJ, Avioli LV, Partridge NC. Second messenger signaling in the regulation of collagenase production by osteogenic sarcoma cells. Endocrinology 1989;124: 2928 –34. [13] Scott DK, Brakenhoff KD, Clohisy JC, Quinn CO, Partridge NC. Parathyroid hormone induces transcription of collagenase in rat osteoblastic cells by a mechanism using cyclic adenosine 3⬘,5⬘-monophosphate and requiring protein synthesis. Mol Endocrinol 1992;6: 2153–9.

489

[14] Clohisy JC, Scott DK, Brakenhoff KD, Quinn CO, Partridge NC. Parathyroid hormone induces c-fos and c-jun messenger RNA in rat osteoblastic cells Mol. Endocrinol 1992;6:1834 – 42. [15] Kano J, Toshitsugu S, Fukase M, Chihara K. Direct involvement of cAMP-dependent protein kinase in the regulation of alkaline phosphatase activity by parathyroid hormone (PTH) and PTH-related peptide in osteoblastic UMR-106 cells. Biochem Biophys Res Commun 1994;199:271– 6. [16] Kream BE, LaFrancis D, Petersen DN, Woody C, Clark S, Rowe DW, et al. Parathyroid hormone represses ␣1(1) collagen promoter activity in cultured calvariae from neonatal transgenic mice. Mol Endocrinol 1993;7:399 – 408. [17] McCarthy TL, Centrella M, Canalis E. Parathryoid hormone enhances the transcript and polypeptide levels of insulin-like growth factor I in osteoblast-enriched cultures from fetal rat bone. Endocrinology 1989; 124:1247–53. [18] Greenfield EM, Gornik SA, Horowitz MC, Donahue HJ, Shaw SM. Regulation of cytokine expression in osteoblasts by parathyroid hormone: rapid stimulation of interleukin-6 and leukemia inhibitory factor mRNA. J Bone Miner Res 1993;8:1163–71. [19] Huang Y-F, Harrison JR, Lorenzo JA, Kream BA. Parathyroid hormone induces interleukin-6 heterogeneous nuclear and messenger RNA expression in murine clavarial organ cultures. Bone 1998;23: 327–32. [20] Tetradis S, Pilbeam CC, Liu Y, Kream BE. Parathyroid hormone induces prostaglandin G/H synthase-2 expression by a cyclic adenosine 3⬘,5⬘-monophosphate-mediated pathway in the murine osteoblastic cell line MC3T3-E1. Endocrinology 1996;137:5435– 40. [21] Tetradis S, Nervina JM, Nemoto K, Kream BE. Parathyroid hormone induces expression of the inducible cyclic AMP early repressor in osteoblastic MC3T3-E1 cells and mouse calvariae. J Bone Miner Res 1998;13:1846 –51. [22] Molina CA, Foulkes NS, Lalli E, Sassone-Corsi P. Inducibility and negative autoregulation of CREM: an alternative promoter directs the expression of ICER, an early response repressor. Cell 1993;75:875– 86. [23] Monaco L, Sassone-Corsi P. Cross-talk in signal transduction: rasdependent induction of cAMP-responsive transcriptional repressor ICER by nerve growth factor. Oncogene 1997;15:2493–500. [24] Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol– chloroform extraction. Anal Biochem 1987;162:155–9. [25] Shapiro DJ, Sharp PA, Wahli WW, Keller MJ. A high-efficiency HeLa cell nuclear transcription extract. DNA 1988;7:47–55. [26] Smith PK, Krohn RI, Hermanson GT, Mailia AK, Gartner FH, Provenzano MD, et al. Measurement of protein using bicinchoninic acid. Anal Biochem 1985;150:76 – 85. [27] Fujimori A, Cheng S, Avioli LV, Civitelli R. Structure–function relationship of parathyroid hormone: activation of phopholipase-C, protein kinase-A and -C in osteosarcoma cells. Endocrinology 1992; 130:29 –36. [28] Blackshear PJ, Witters LA, Girard PA, Kuo JF, Quarno SN. Growth factor-stimulated protein phosphorylation in 3T3-L1 cells: evidence for protein kinase C-dependent and independent pathways. J Biol Chem 1985;260:13304 –15. [29] Takasu H, Potts JT, Bringhurst FR. Human PTH/PTHrP receptors and type-2 PTH receptors show discordant selectivity for human PTH analogs with amino-terminal modifications. J Bone Miner Res 1998; 23:S255. [30] Usdin TB, Bonner TI, Harta G, Mezey E. Distribution of parathyroid hormone-2 receptor messenger ribonucleic acid in rat. Endocrinology 1996;137:4285–97. [31] Usdin TB, Gruber C, Bonner TI. Identification and functional expression of a receptor selectively recognizing parathyroid hormone, the PTH2 receptor. J Biol Chem 1995;270:15455– 8.

490

J.M. Nervina et al. / Bone 32 (2003) 483– 490

[32] Lanske B, Kronenberg HM. Parathyroid hormone-related peptide (PTHrP) and parathyroid hormone (PTH)/PTHrP receptor. Crit Rev Eukaryot Gene Expr 1998;8:297–320. [33] Amizuka N, Warshawsky H, Henderson JE, Goltzman D, Karaplis AC. Parathyroid hormone-related peptide-depleted mice show abnormal epiphyseal cartilage development and altered endochondral bone formation. J Cell Biol 1994;126:1611–23. [34] Karaplis AC, Luz A, Glowacki J, Bronson RT, Tybulewicz VLJ, Kronenberg H, et al. Lethal skeletal dysplasia from targeted disruption of the parathyroid hormone-related peptide gene. Genes Dev 1994;8:277– 89. [35] Lanske B, Divieti P, Kovacs CS, Pirro A, Landis WJ, Krane SM, et al. The parathyroid hormone (PTH)/PTH-related peptide receptor mediates actions of both ligands in murine bone. Endocrinology 1998;139:5194 –204. [36] Lanske B, Karaplis AC, Lee K, Luz A, Vortkamp A, Pirro A, et al. PTH/PTHrP receptor in early development and Indian hedgehogregulated bone growth. Science 1996;273:663– 6. [37] Vortkamp A, Lee K, Lanske B, Segre GV, Kronenberg HM, Tabin CJ. Regulation of rate of cartilage differentiation by Indian hedgehop and PTH-related protein. Science 1996;273:613–22. [38] Stehle JH, Foulkes NS, Molina CA, Simonneaux V, Pevet P, SassoneCorsi P. Adrenergic signals direct rhythmic expression of transcriptional repressor CREM in the pineal gland. Nature 1993;365:314 –20. [39] Stehle JH, Foulkes NS, Pevet P, Sassone-Corsi P. Developmental maturation of pineal gland function: synchronized CREM inducibility and adrenergic stimulation. Mol Endocrinol 1995;9:706 –16. [40] Lalli E, Sassone-Corsi P. Thyroid stimulating hormone (TSH)-directed induction of the CREM gene in the thyroid gland participates in the long-term desensitization of the TSH receptor. Proc Natl Acad Sci USA 1995;92:9633–7. [41] Gellersen B, Kempf R, Telgmann R. Human endometrial stromal cells express novel isoforms of the transcriptional modulator CREM and up-regulate ICER in the course of decidualization. Mol Endocrinol 1997;11:97–113. [42] Mukherjee A, Urban J, Sassone-Corsi P, Mayo KE. Gonadotropins regulate inducible cyclic adenosine 3⬘,5⬘-monophosphate early re-

[43]

[44]

[45]

[46]

[47]

[48]

[49]

[50]

[51]

[52]

pressor in the rat ovary: implications for inhibin ␣ subunit gene expression. Mol Endocrinol 1998;12:785– 800. Monaco L, Foulkes NS, Sassone-Corsi P. Pituitary follicle-stimulating hormone (FSH) induces CREM gene expression in Sertoli cells: involvement in long-term desensitization of the FSH receptor. Proc Natl Acad Sci USA 1995;92:10673–7. Servillo G, Penna L, Foulkes NS, Magni MV, DellaFazia MA, Sassone-Corsi P. Cyclic AMP signalling pathway and cellular proliferation: induction of CREM during liver regeneration. Oncogene 1997; 14:1601– 6. Bodor J, Spetz AL, Strominger JL, Habener JF. cAMP inducibility of transcriptional repressor ICER in developing and mature human T lymphocytes. Proc Natl Acad Sci USA 1996;93:3536 – 41. Folco EJ, Koren G. Degradation of the inducible cAMP early repressor (ICER) by the ubiquitin-proteasome pathway. Biochem J 1997; 328:37– 43. Thommesen L, Norsett K, Sandvik AK, Hofsli E, Laegreid A. Regulation of inducible cAMP early repressor expression by gastrin and cholecystokinin in the pancreatic cell line AR42J. J Biol Chem 2000;275:4244 –50. Blendy JA, Kaestner KH, Weinbauer GF, Nieschlag E, Schutz G. Severe impairment of spermatogenesis in mice lacking the CREM gene. Nature 1996;380:162–5. Foulkes NS, Borjigin J, Snyder SH, Sassone-Corsi P. Transcriptional control of circadian hormone synthesis via the CREM feedback loop. Proc Natl Acad Sci USA 1996;93:14140 –5. Servillo G, Della Fazia MA, Sassone-Corsi P. Transcription factor CREM coordinates the timing of hepatocyte proliferation in the regenerating liver. Genes Dev 1998;12:3639 – 43. Tetradis S, Pilbeam CC, Liu Y, Herschman HR, Kream BE. Parathyroid hormone increases prostaglandin G/H synthase-2 transcription by a cyclic adenosine 3⬘5⬘-monophosphate-mediated pathway in murine osteoblastic MC3T3-E1 cells. Endocrinology 1997;138:3594 – 600. Greenfield EM, Horowitz MC, Lavish SA. Stimulation by parathyroid hormone of interleukin-6 and leukemia inhibitory factor expression in osteoblasts is an immediate-early gene response induced by cAMP signal transduction. J Biol Chem 1996;271:10984 –9.