Expression of inflammasome-related genes in bladder cancer and their association with cytokeratin 20 messenger RNA

Urologic Oncology: Seminars and Original Investigations ] (2015) ∎∎∎–∎∎∎

Original article

Expression of inflammasome-related genes in bladder cancer and their association with cytokeratin 20 messenger RNA Giulia Poli, B.Sc.a,1, Stefano Brancorsini, Ph.D.b,1, Giovanni Cochetti, M.D., Ph.D.a, Francesco Barillaro, M.D.a, Maria Giulia Egidi, Ph.D.a,*, Ettore Mearini, M.D., Ph.D.a a

Department of Surgical and Biomedical Sciences, Institute of Urological, Andrological Surgery and Minimally Invasive Techniques, University of Perugia, Italy b Department of Experimental Medicine—Section of Terni, University of Perugia, Italy Received 5 February 2015; received in revised form 10 July 2015; accepted 12 July 2015

Abstract Background: Inflammation plays a crucial role in different stages of cancer development and has long been associated with various types of cancer. Strong associations between dysregulated inflammasome activity and human heritable and acquired inflammatory diseases highlight the importance of this pathway in the immune response. The inflammasome is a large complex of NOD-like receptors called NLRs and drives growth and progression of different tumors. The aim of the present study was the characterization of some NLR genes, NLRP3, NLRP4, NLRP9, and NAIP, in urine sediment of patients with bladder cancer. Cytokeratin 20 and survivin were used as confirmed markers of bladder cancer. Basic procedures: For this study, 3 groups of subjects were considered: patients harboring bladder cancer, subjects affected by bladder inflammation (CTR1), and healthy subjects (CTR0). Total RNA was extracted from urine sediments and resulting complementary DNA was used for amplification by real-time polymerase chain reaction. Results were stratified according to tumor stage, grade, and risk of progression and recurrence. Main findings: The expression of cytokeratin 20 was always significantly higher in patients with bladder cancer when compared with that in both the tumor-free groups. NLRP3, NLRP4, NLRP9, and NAIP were overexpressed in patients with BCa when compared with that in CTR0. Stratification according to tumor stage, grade, and risk of recurrence and progression showed NLRP up-regulations in patients with early-stage cancer. NAIP was overexpressed in high-risk patients in comparison to CTR0 and in high-grade patients compared with CTR0 and CTR1. Principal conclusions: These data are relevant to demonstrate the role of inflammasome in urothelial carcinoma, making NLR genes in urine sediment potential candidates for bladder cancer diagnosis. r 2015 Elsevier Inc. All rights reserved.

Keywords: Bladder cancer; Gene expression; Cytokeratin; Inflammasome

1. Introduction Bladder carcinoma (BCa) is the seventh most common cancer in the world, with 430,000 newly diagnosed cases annually and more than 165,000 cancer-related deaths [1]. The research was performed in the Department of Surgical and Biomedical Sciences, Via Mazzieri 3, 05100 Terni, University of Perugia, Italy. This research project was supported by Fondazione Cassa di Risparmio di Terni e Narni. The authors contributed equally to the work and share the first authorship. Corresponding author. Tel.: þ39-338-351-9999; fax: þ39-074-420-2804. E-mail address: [email protected] (M.G. Egidi). 1 *

http://dx.doi.org/10.1016/j.urolonc.2015.07.012 1078-1439/r 2015 Elsevier Inc. All rights reserved.

The diagnosis is based on cystoscopy and voided urine cytology (VUC) [2]. The weakness of VUC lies in its low sensitivity (ranged from 30%–92%): for low-grade (LG) tumors, sensitivity ranges from 30% to 40% [3]. Although VUC represents the gold standard for the noninvasive diagnosis of BCa, cystoscopy is an invasive, painful, and potentially infectious procedure. The development of new tools for the early diagnosis and prognosis of BCa is a challenge in uro-oncologic research, and it could provide benefits for invasiveness and lowering of health service costs. In a systematic review, Vrooman and Witjes [4] described the most important urinary biomarkers studied so far. All mentioned markers outperformed cytology in

2

G. Poli et al. / Urologic Oncology: Seminars and Original Investigations ] (2015) 1–7

sensitivity, but they lost in specificity. As an example, the NMP22 BladderChek assay is more sensitive and easy to perform than cytology is. BTA-stat is an on-bench test but its scores are lower than cytology. The reliability of BTATRAK and CYFRA21-1 tests is impaired by benign urological conditions: this makes them less usable in clinical practice. The value of the ImmunoCyt test is limited by its specificity. Microsatellite analysis has good sensitivity/specificity, and it is able to detect LG/lowstage tumors; unfortunately, the test is complicated. Considering these premises, the current generation of markers for the diagnosis of BCa did not add much to urinary cytology, and larger clinical trials are needed to define their efficacy. Among all candidate biomarkers for BCa, cytokeratin 20 (CK20) is considered a marker of urothelial differentiation and is highly expressed in BCa [5]. CK20 is a low-molecular-weight protein and is expressed in superficial and intermediate cells of normal urothelium [6]. The role of CK20 as a positive marker for urothelial carcinomas has been explored in several studies at the messenger RNA (mRNA) and protein level [7,8]. Another promising candidate is survivin mRNA, whose diagnostic value in BCa has been explored in urine sediments [9]. The immune system plays a crucial role during the formation, immunomodulation, and progression of tumors [10], and its microenvironment is significantly regulated by NOD-like receptors (NLRs) through cytokine production [11]. Polymorphisms in cytokine genes have been associated with different diseases, including BCa [12]. A recent study hypothesized a possible correlation between NOD2, RIPK2, TLR10, and C13ORF31 gene polymorphisms and the risk of developing urothelial cancer [13]. The NLR family comprises 20 members and plays a pivotal role in the recognition of intracellular ligands [14]. On activation by detection of pathogen-associated molecular patterns, NLRs change their conformation and recruit proteins, assembling high-molecular-weight platforms called inflammasomes [15]. The activation of inflammasomes allows the autocatalytic cleavage of procaspase 1 that modulates the proteolytic maturation of a set of inflammatory cytokines, influencing the formation and progression of tumor [11]. Several studies demonstrate the role of NLR inflammasomes in cancer. For example, NLRP3 gene polymorphisms have been associated with melanoma [16], myeloma [17], and colorectal cancer [18]. In the present study we characterized NLR genes in urine sediments and evaluated their contribution to predict bladder cancer together with CK20.

2. Materials and methods Subjects—We enrolled 84 patients who underwent flexible cystoscopy for appearance of macroscopic or microscopic hematuria, otherwise for irritative symptoms

and negative findings on urine culture. During the endoscopic examination, a biopsy for neoplasia or mucosal abnormalities was performed. The histological examination revealed 55 BCa and 29 cases of bladder inflammation that were included in the BCa and CTR1 groups, respectively. The histological diagnosis of bladder inflammation was performed in the presence of lymphocytes and neutrophils infiltration in the connective tissue of the bladder wall. A total of 28 age-matched healthy subjects were included in the study as controls (CTR0). Patients with BCa were stratified in Ta, T1, and T2 according to the degree of bladder wall infiltration, as reported by TNM classification system [19]. Moreover, the BCa group was stratified into LG and high grade (LG and HG) based on the degree of histological differentiation according to the World Health Organization Grading 2004 [20]. Patients with superficial BCa were further divided in LG (TaLG and T1LG) and HG (TaHG and T1HG). We further stratified patients with BCa into low-risk (LR) and high-risk (HR) superficial subtypes following the European Organization for Research and Treatment of Cancer risk criteria [21]. The investigation conformed to the principles outlined in the Declaration of Helsinki, and informed consent was obtained from the subjects or their relatives. Urine collection and RNA extraction—First catch–voided urine of patients was collected in sterile cups. Cell pellets were obtained after centrifugation (2000  g, 10 min, 41C). Cells were washed twice and lysed with 300 ml of lysis buffer (Total RNA Extraction Kit, Norgen Biotek Corp. Ontario, Canada). RNA was quantified by Qubit RNA assay (Invitrogen, Life Technologies, CA) and stored at 801C until use. NLRP3, NLRP4, NLRP9, and NAIP were selected, as they were expressed in the bladder urothelium (information available at www.nextprot.org). Polymerase chain reaction (PCR)—Assays were performed on a Stratagene Mx3005P instrument (Agilent Technology, Santa Clara, CA). We reverse transcribed 15 ng of RNA with SuperScript VILO complementary DNA Synthesis Kit (Invitrogen, Life Technologies, CA). Primer sequences for real-time PCR assays are listed in Table 1. Assays were performed with SYBR GreenER qPCR SuperMix Universal (Invitrogen, Life Technologies, CA). ROX was used as passive reference dye. We used 4 ml of complementary DNA (1:20) used for amplification in a PCR reaction volume of 20 ml. Assays were performed in triplicate and results were averaged. No-template controls were included. Ct values of target genes were normalized with β actin (ΔCttarget ¼ CtACTB –Cttarget). Statistical analysis—Data were analyzed with GraphPad Prism 6.0. Analysis of variance and Kruskal-Wallis tests were performed. The significance threshold was set at 0.05. Logistic regression analysis was performed to evaluate the association of selected genes with the outcome. Prediction models were based on mRNA expression values (ΔCts).

G. Poli et al. / Urologic Oncology: Seminars and Original Investigations ] (2015) 1–7

3

3. Results

Table 1 Primer sequences used for real-time PCR assays Primer name

Primer sequence

β actin fw β actin rev CK20 fw CK20 rev SURV fw SURV rev NLRP3 fw NLRP3 rev NLRP4 fw NLRP4 rev NLRP9 fw NLRP9 rev NAIP fw NAIP rev

3.1. Expression levels of NLRPs, NAIP, CK20, and survivin in BCa, CTR0, and CTR1 groups

ATCGTGCGTGACATTAAGGAGAAG AGGAAGGAAGGCTGGAAGAGTG AAGGAGCATCAGGAGGAAGTC GCCTGGAGCAGCATCAAC TGAGAACGAGCCAGACTTG TTCCTCTATGGGGTCGTCAT CGGGGCCTCTTTTCAGTTCT CCCCAACCACAATCTCCGAA AGACTCGTCACGAAGGGAGA ATAAAACCTCATCCCTGTCTATGT AGATGCTGGGGCTGCACAAAT ATTCCTCGTCAATCCAAGGTCC AGGACGGACAGAGCATTTGTT TGGGTGGCCATTTTCTGAGG

Patient data and hematological parameters are reported in Table 2. NLRP3, NLRP4, NLRP9, and NAIP gene expression increased significantly in patients with BCa, which was more than the levels in CTR0 (Fig. 1). CK20 mRNA was overexpressed in BCa with respect to both CTR1 and CTR0 (Fig. 1). NLRP3 and NLRP9 mRNA levels were higher in CTR1 than in CTR0, although they did not reach statistical significance (Fig. 1). Survivin expression did not change in patients with BCa when compared with both the control groups (Fig. 1).

Letters following the primer names denotes whether the primer was forward (fw) or reverse (rev).

Univariate logistic regression analysis was made for each independent variable and thereafter multivariate logistic models were built.

3.2. Stratification of patients with bladder cancer To investigate whether the expression levels of selected genes were related to histological and clinical parameters of bladder tumor, patients were stratified according to tumor stage, grade, and risk of recurrence and progression.

Table 2 Hematological and clinical parameters of subjects enrolled in the study CTR1 (n ¼ 29)

CTR0 (n ¼ 28)

BCa (n ¼ 55) Degree of bladder wall infiltration

Tumor grade Risk of recurrence and progression Age Median Range SD

62 63–81 10.2

64 47–82 12.57

65 45–84 9.46

Sex Male Female

25 4

22 6

42 13

Leukocytes (103/mmc) Median Range SD

7.02 5.06–10.74 2.38

7.64 3.55–12.28 2.77

8.15 2.21–18.99 3.47

Neutrophils (103/mmc) Median Range SD

4.61 2.49–6.3 1.78

4.28 1.82–9.02 2.49

4.85 1.04–12.59 2.15

Lymphocytes (103/mmc) Median Range SD

1.52 0.6–4.05 1.07

1.68 0.56–3.33 1.12

2.35 0.97–15.19 2.35

Monocytes (103/mmc) Median Range SD

0.57 0.14–1.33 0.229

0.555 0.31–1.71 0.428

0.545 0.25–1.15 0.221

SD ¼ standard deviation.

Ta T1 T2 Low High Low High

34 13 8 25 30 22 33

G. Poli et al. / Urologic Oncology: Seminars and Original Investigations ] (2015) 1–7

4

0

*

*** **

*

**

BCa CTR1 CTR0

- Ct

-5 -10 -15 -20

CK20

SURV

NLRP3 NLRP4 NLRP9

NAIP

Fig. 1. Expression levels expressed as ΔCt (median with range and interquartile range) of selected genes. *P o 0.05; **P o 0.01; *** P o 0.001.

3.2.1. Tumor stage CK20 gene expression was significantly up-regulated in patients with Ta, T1, and T2 category disease (Fig. 2A–C). NLRP3, NLRP4, and NLRP9 mRNA expression showed significant differences between patients with Ta category disease and CTR0 (Fig. 2A). 3.2.2. Tumor grade CK20 mRNA levels increased in both LG and HG groups (Fig. 2D and E). NLRP3, NLRP4, NLRP9, and survivin genes were overexpressed in patients with LG tumors with respect to CTR0 (Fig. 2D). NLRP3 gene overexpression was

observed in patients with HG tumors (Fig. 2E), whereas NAIP mRNA expression was significantly higher in patients with HG tumors when compared with both CTR0 and CTR1 (Fig. 2E). 3.2.3. Risk of recurrence and progression CK20 mRNA levels increased in both LR and HR groups when compared with controls (Fig. 2F and G). NLRP4 and NLRP9 genes were overexpressed in patients with LR tumors, whereas NLRP3 and NAIP genes enhanced their expression in patients with HR tumors when compared with CTR0 (Fig. 2F and G). 3.3. Logistic regression analysis 3.3.1. Patients with BCa vs. CTR0 Logistic regression analysis was performed to examine the predictive power of selected genes. In the univariate analysis, Odds ratio (OR) of CK20, NLRP3, NLRP4, NLRP9, and NAIP gene expression showed association with the disease outcome (Table 3). CK20 and NLRP4 showed high specificity and sensitivity, respectively (Table 3). Moreover, we evaluated whether inflammasome genes improved the ability of CK20 in predicting BCa. NLRP3 improved CK20’s specificity and sensitivity (55.00% vs. 52.38% and 89.8% vs. 86.27%, respectively). Similar findings were observed for NLRP9 (66.67% vs. 52.38% and 89.70% vs. 86.27%,

Fig. 2. Expression levels expressed as –ΔCt (median with range and interquartile range) of selected genes. Comparisons were made according to tumor stage, histological grade, and risk of recurrence and progression. (A) Ta, CTR1, CTR0; (B) T1, CTR1, CTR0; (C) T2, CTR1, CTR0; (D) LG, CTR1, CTR0; (E) HG, CTR1, CTR0; (F) LR, CTR1, CTR0; and (G) HR, CTR1, CTR0. *P o 0.05; **P o 0.01; ***P o 0.001.

G. Poli et al. / Urologic Oncology: Seminars and Original Investigations ] (2015) 1–7

5

Table 3 Univariate and multivariate logistic regression analyses of variables predicting the outcome of disease. Variable

OR

95% CI

Univariate logistic regression analysis CK20 1.522 1.225–1.891 SURV 1.309 0.991–1.699 NLRP3 1.847 1.173–2.907 NLRP4 1.299 1.042–1.618 NLRP9 1.413 1.128–1.770 NAIP 1.482 1.080–2.035 Multivariate logistic CK20 þ NLRP3 CK20 NLRP3 CK20 þ NLRP4 CK20 NLRP4 CK20 þ NLRP9 CK20 NLRP9 CK20 þ NAIP CK20 NAIP

P value

SP, %

SN, %

AUC

Hosmer-Lemeshow test (Pr 4 χ2)

o0.0001 0.030 0.002 0.013 0.0005 0.007

52.38 8.33 23.08 21.74 33.33 23.08

86.27 94.12 92.31 96.23 94.23 90.38

0.834 0.643 0.674 0.650 0.708 0.661

0.856 0.898 0.170 0.111 0.229 0.076

regression analysis 1.471 1.491

1.187–1.822 0.876–2.536

o0.0001

55.00

89.80

0.839

0.701

1.512 1.230

1.208–1.892 0.918–1.649

o0.0001

52.38

86.00

0.842

0.466

1.484 1.341

1.179–1.869 1.002–1.795

o0.0001

66.67

89.70

0.855

0.810

1.632 1.806

1.266–2.104 1.113–2.930

o0.0001

52.38

92.00

0.874

0.648

AUC ¼ area under the curve; SN ¼ sensitivity, SP ¼ specificity.

Table 4. CK20 (OR ¼ 1.384, 95% CI: 1.130–1.696), NLRP4 (OR ¼ 1.300, 95% CI: 1.029–1.642), NLRP9 (OR ¼ 1.390, 95% CI: 1.105–1.748), and NAIP expression levels (OR ¼ 1.687, 95% CI: 1.198–2.378) showed significant 95% CIs (Table 4). In the multivariate logistic regression analysis, the combination of variables did not improve the specificity of the univariate models, whereas sensitivity increased when NLRP4, NLRP9, and NAIP were combined with CK20.

respectively) (Table 3). Overall, these data suggested that inflammasome genes have a potential role of markers of BCa. 3.3.2. Superficial LG vs. tumor-free groups According to the grade of histological differentiation, we stratified superficial BCa group into superficial LG (TaLG and T1LG) and superficial HG (TaHG and T1HG). CK20 gene was up-regulated in superficial LG and HG groups when compared with controls (Fig. 3). Survivin, NLRP3, NLRP4, and NLRP9 mRNA levels increased in the superficial LG group (Fig. 3A). NLRP3 and NAIP genes were overexpressed in the superficial HG group when compared with CTR0 (Fig. 3B). We next performed logistic regression analysis including subjects with superficial LG tumors and tumor-free subjects (CTR0 and CTR1). Results are shown in A 0

*** *

*

*

**

0

sup LR CTR1 CTR0

-10 -15

*

**

**

** *

sup HR CTR1 CTR0

-5

- Ct

- Ct

The development of new tools for the early diagnosis and prognosis of BCa is a challenge in uro-oncologic research. Regarding this, CK20 is considered a marker of urothelial differentiation because it is highly expressed in voided urine B

***

-5

-20

4. Discussion

-10 -15

CK20

SURV NLRP3 NLRP4 NLRP9

NAIP

-20

CK20

SURV NLRP3 NLRP4 NLRP9

NAIP

Fig. 3. Expression levels expressed as ΔCt (median with range and interquartile range) of selected genes: (A) superficial low risk, CTR1, CTR0 and (B) superficial high risk, CTR1, CTR0. *P o 0.05; **P o 0.01; ***P o 0.001.

G. Poli et al. / Urologic Oncology: Seminars and Original Investigations ] (2015) 1–7

6

Table 4 Univariate and multivariate logistic regression analyses for variables predicting accuracy of superficial low grade bladder cancer diagnosis. Variable

OR

Univariate logistic regression analysis CK20 1.384 SURV 1.200 NLRP3 1.546 NLRP4 1.300 NLRP9 1.390 NAIP 1.687 Multivariate logistic regression analysis CK20 þ NLRP4 CK20 1.379 NLRP4 1.316 CK20 þ NLRP9 CK20 1.331 NLRP9 1.435 CK20 þ NAIP CK20 1.324 NAIP 1.514

95% CI

P value

SP

SN

AUC

Hosmer-Lemeshow test (Pr 4 χ2)

1.130–1.696 0.994–1.448 0.981–2.438 1.029–1.642 1.105–1.748 1.198–2.378

0.0003 0.051 0.039 0.017 0.001 0.001

86.67 96.15 98.15 94.12 91.84 96.30

31.58 13.04 0 9.09 27.27 23.81

0.789 0.648 0.653 0.671 0.708 0.705

0.171 0.824 0.888 0.156 0.217 0.836

1.117–1.701 0.980–1.766

0.0002

91.11

36.84

0.818

0.342

1.073–1.652 1.047–1.968

o0.0001

91.11

42.11

0.805

0.518

1.073–1.633 1.030–2.226

0.0001

91.11

44.44

0.820

0.747

AUC ¼ area under the curve; SN ¼ sensitivity; SP ¼ specificity.

from patients with BCa [22]. Another candidate marker for human BCa is survivin mRNA, which varies between LG and HG tumors in urine sediments [9,23]. The cancer microenvironment is composed of inflammatory and immunocompetent cells [11]. Among these, NLR and TLR proteins are key components of the inflammasome, the molecular platform where production and maturation of proinflammatory IL-1β takes place [24]. Although several studies delved into TLR expression in BCa [25], this is the first to characterize the contribution of NLR transcripts (NLRP3, NLRP4, NLRP9, and NAIP) in urine sediments of patients with BCa. In the present study, the expression of selected NLRs, CK20, and survivin genes was evaluated in urine sediments of patients harboring BCa, healthy controls (CTR0), and tumor-free subjects with bladder inflammation (CTR1). We observed an enhanced expression of NLRP3, NLRP4, NLRP9, and NAIP in patients with BCa with respect to CTR0 (Fig. 1). CK20 was overexpressed in patients with BCa when compared with both CTR0 and CTR1 (Fig. 1), and this increase was maintained after patient stratification according to tumor stage, grade, and risk of recurrence and progression (Fig. 2). The potential role of inflammasomes in the early development of BCa was suggested by the up-regulation of NLRP3, NLRP4, and NLRP9 in Ta category tumors (Fig. 2A). High levels of NLRP3, NLRP4, NLRP9, and survivin mRNAs were observed in patients with LG tumors (Fig. 2D). Moreover, survivin, NLRP4, and NLRP9 genes were up-regulated in patients with superficial LG tumors (Fig. 3A). Earlier-stage tumors present pronounced levels of inflammation: this could be due to a reaction of the innate immunity against tumorigenesis [16,26]. This condition is progressively lost after tumor establishment [11]. Accordingly, we demonstrated that the increased expression of NLRP4 and NLRP9

was peculiar of low malignant potential tumors. On the contrary, NAIP mRNA level was significantly higher in patients with HG tumors than in CTR0 and CTR1 (Fig. 2E) and in HR tumors more than in CTR0 (Fig. 2G). NAIP/NLR is localized predominantly to the urothelium [27], and it is a neuronal apoptosis inhibitory protein with a caspase activating and recruitment domain (CARD) 4 (NLRC4) inflammasome complexes [28]. NAIP belongs to the inhibitors of apoptosis family involved in the prediction of prognosis in human BCa [29]. In particular, overexpression of several members of the inhibitors of apoptosis family highly correlates with cancer progression, suggesting their association with a poor prognosis [29,30]. Our study first demonstrates the increased expression of NAIP gene in HG BCa tumors, highlighting its fundamental role in BCa progression. Logistic regression was performed to verify whether the mRNA expression of selected variables in BCa and healthy controls could predict histological outcome. As expected, the univariate analysis highlighted the highest specificity of CK20 (52.38%). Remarkably, the NLRP4 inflammasome gene outperformed CK20 regarding sensitivity (96.23%), and this is one of the major strengths of the present study (Table 3). When variables were combined together in the multivariate analysis, the most specific (66.67%) and sensitive (92%) model was obtained by combining CK20 with NLRP9 and with NAIP, respectively (Table 3). NLRP3, NLRP4, NLRP9, and NAIP reached significant 95% CIs, outperforming sensitivity of CK20 alone. Logistic models were next used to evaluate the ability of selected genes in predicting superficial LR BCa. Here NLRs outperformed CK20 regarding specificity (NLRP3, 98.15%) (Table 4). The combination of CK20 with NLRP4, NLRP9, and NAIP improved sensitivity of CK20 (þ5.26%, þ10.53%, and þ12.86%, respectively) (Table 4).

G. Poli et al. / Urologic Oncology: Seminars and Original Investigations ] (2015) 1–7

Overall, our results confirmed the relevance of inflammasome genes as a potential tool for diagnosis of BCa. Although the aim of our study was the evaluation of mRNA levels of selected genes, we sought to identify a molecular panel that may integrate VUC, the noninvasive diagnostic tool for BCa, with low sensitivity for LG tumors. The main limitation of our study is the inability of the selected NLRP genes to discriminate the BCa group from the CTR1 group (Fig. 1). This could be mainly because of the presence of subjects with inflammatory conditions in both groups. Moreover, larger cohorts of patients need to be investigated to confirm the role of the inflammasome in BCa. 5. Conclusions The inflammasome represents a key element during tumor initiation. Our study shows that NLR genes could be a useful tool for the early diagnosis of BCa together with CK20. We did not validate these genes as biomarkers, but in the future, a multimarker panel of inflammation-related molecules could provide new insights into the diagnosis of BCa. References [1] Ferlay J, Steliarova-Foucher E, Lortet-Tieulent J, Rosso S, Coebergh JWW, Comber H, et al. Cancer incidence and mortality patterns in Europe. Estimates for 40 countries in 2012. Eur J Cancer 2013; 49:1374–403. [2] Têtu B. Diagnosis of urothelial carcinoma from urine. Mod Pathol 2009;22:S53–9. [3] Ye F, Wang L, Castillo-Martin M, McBride R, Galsky MD, Zhu J, et al. Biomarkers for bladder cancer management: present and future. Am J Clin Exp Urol 2014;2:1–14. [4] Vrooman OPJ, Witjes JA. Urinary markers in bladder cancer. Eur Urol 2008;53:909–16. [5] Miettinen M. Keratin 20: immunohistochemical marker for gastrointestinal, urothelial, and Merkel cell carcinomas. Mod Pathol 1995;8:384–8. [6] Moll R, Löwe A, Laufer J, Franke WW. Cytokeratin 20 in human carcinomas. A new histodiagnostic marker detected by monoclonal antibodies. Am J Pathol 1992;140:427–47. [7] Guo B, Luo C, Xun C, Xie J, Wu X, Pu J. Quantitative detection of cytokeratin 20 mRNA in urine samples as diagnostic tools for bladder cancer by real-time PCR. Exp Oncol 2009;31:43–7. [8] Yildiz IZ, Recavarren R, Armah HB, Bastacky S, Dhir R, Parwani AV. Utility of a dual immunostain cocktail comprising of p53 and CK20 to aid in the diagnosis of non-neoplastic and neoplastic bladder biopsies. Diagn Pathol 2009;4:35. [9] Pina-Cabral L, Santos L, Mesquita B, Amaro T, Magalhães S, Criado B. Detection of survivin mRNA in urine of patients with superficial urothelial cell carcinomas. Clin Transl Oncol 2007;9:731–6. [10] Hanahan D, Coussens LM. Accessories to the crime: functions of cells recruited to the tumor microenvironment. Cancer Cell 2012;21:309–22. [11] Zitvogel L, Kepp O, Galluzzi L, Kroemer G. Inflammasomes in carcinogenesis and anticancer immune responses. Nat Immunol 2012;13:343–51.

7

[12] Ahirwar DK, Agrahari A, Mandhani A, Mittal RD. Cytokine gene polymorphisms are associated with risk of urinary bladder cancer and recurrence after BCG immunotherapy. Biomarkers 2009; 14:213. [13] Guirado M, Gil H, Saenz-Lopez P, Reinboth J, Garrido F, Cozar JM, et al. Association between C13ORF31, NOD2, RIPK2 and TLR10 polymorphisms and urothelial bladder cancer. Hum Immunol 2012; 73:668–72. [14] Motta V, Soares F, Sun T, Philpott DJ. NOD-like receptors: versatile cytosolic sentinels. Physiol Rev 2015;95:149–78. [15] Henao-Mejia J, Elinav E, Strowig T, Flavell RA. Inflammasomes: far beyond inflammation. Nat Immunol 2012;13:321–4. [16] Verma D, Bivik C, Farahani E, Synnerstad I, Fredrikson M, Enerbäck C, et al. Inflammasome polymorphisms confer susceptibility to sporadic malignant melanoma. Pigment Cell Melanoma Res 2012;25: 506–13. [17] Voronov E, Dotan S, Krelin Y, Song X, Elkabets M, Carmi Y, et al. Unique versus redundant functions of IL-1α and IL-1β in the tumor microenvironment. Front Immunol 2013;4:177. [18] Ungerbäck J, Belenki D, Jawad ul-Hassan A, Fredrikson M, Fransén K, Elander N, et al. Genetic variation and alterations of genes involved in NFκB/TNFAIP3- and NLRP3-inflammasome signaling affect susceptibility and outcome of colorectal cancer. Carcinogenesis 2012;33:2126–34. [19] UICC International Union Against Cancer. TNM classification of malignant tumors. Sobin LH, Gospodariwicz M, Wittekind C, editors. TNM classification of malignant tumors. Wiley-Blackwell, 2009;262–5. [20] MacLennan GT, Kirkali Z, Cheng L. Histologic grading of noninvasive papillary urothelial neoplasms. Eur Urol 2007;51:889–98. [21] Babjuk M, Böhle A, Burger M, Compérat E, Kaasinen E, Palou J, et al. EAU guidelines on non-muscle-invasive bladder cancer. Eur Urol 2011;59:584–94. [22] Southgate J, Harnden P, Trejdosiewicz LK. Cytokeratin expression patterns in normal and malignant urothelium: a review of the biological and diagnostic implications. Histol Histopathol 1999;14: 657–64. [23] Sun Y, He H, Ma Q, Wang XY, Yang L, He DL. Clinical evaluation of BTAstat, NMP22, HA, survivin, CD44v6, vEGF and VUC in bladder cancer diagnosis. Zhonghua Yi Xue Za Zhi 2005;85:2507–12. [24] Fridman WH, Pages F, Sautes-Fridman C, Galon J. The immune contexture in human tumours: impact on clinical outcome. Nat Rev Cancer 2013;12:298–306. [25] Olbert PJ, Kesch C, Henrici M, Subtil FS, Honacker A, Hegele A, et al. TLR4- and TLR9-dependent effects on cytokines, cell viability, and invasion in human bladder cancer cells. Urol Oncol 2015;33:e19–27. [26] Hagerling C, Casbon AJ, Werb Z. Balancing the innate immune system in tumor development. Trends Cell Biol 2015;25:214–20. [27] Hughes FM Jr, Vivar NP, Kennis JG, Pratt-Thomas JD, Lowe DW, Shaner BE, et al. Inflammasomes are important mediators of cyclophosphamide-induced bladder inflammation. Am J Physiol Renal Physiol 2014;306:F299–308. [28] Lage SL, Longo C, Branco LM, da Costa TB, Buzzo Cde L, Bortoluci KR. Emerging concepts about NAIP/NLRC4 inflammasomes. Front Immunol 2014;5:309. [29] Chen X, Wang T, Yang D, Wang J, Li X, He Z, et al. Expression of the IAP protein family acts cooperatively to predict prognosis in human bladder cancer patients. Oncol Lett 2013;5:1278–84. [30] Vucic D, Fairbrother WJ. The inhibitor of apoptosis proteins as therapeutic targets in cancer. Clin Cancer Res 2007;13:5995–6000.