- Email: [email protected]
Expression of Interleukin-12 is Increased in Psoriatic Skin
Expression of Interleukin-12 is Increased in Psoriatic Skin Nikhil Yawalkar,*† Stephan Karlen,* Robert Hunger,* Christoph U. Brand,* and Lasse R. Braathen* *Dermatological Clinic and †Institute of Immunology and Allergology, University of Bern, Inselspital, Bern, Switzerland
Although the precise underlying pathomechanisms of psoriasis have not been fully elucidated, previous reports suggest that T helper 1-type cytokines are critically involved in the pathogenesis of this disease. Interleukin12 (IL-12), a heterodimeric cytokine, has been suggested to play a major role in the development of T helper 1 cell responses. In this study, the presence of IL-12 mRNA and protein was investigated in normal human skin as well as nonlesional and lesional psoriatic skin. Messenger RNA levels were determined in biopsy specimens by a standard and a nested reverse transcriptase-polymerase chain reaction method. Additionally, IL-12 protein expression was analyzed in situ by immunohistochemistry using an antibody recognizing IL-12 p70. Whereas specific transcripts for IL-12 p35 were reproducibly detected
without any significant differences in all samples, enhanced IL-12 p40 mRNA signals were only found in lesional psoriatic skin as compared with normal and nonlesional psoriatic skin. Furthermore, immunoreactivity for IL-12 p70 was markedly increased in the psoriatic skin lesions and was predominantly expressed on mononuclear cells in the dermis. In conclusion, our data suggest a critical role for IL-12 in promoting and maintaining T cell activation and inducing T helper 1-type cytokines such as interferon-γ in psoriasis. We speculate that IL-12 might be a key cytokine in the pathogenesis of psoriasis. Key words: interleukin-12/psoriasis/nRT-PCR-immunohistochemistry. J Invest Dermatol 111:1053–1057, 1998
P
psoriatic skin using reverse transcriptase-polymerase chain reaction (RT-PCR) and immunohistochemistry.
soriasis is characterized by hyperproliferation of keratinocytes and a dense lesional infiltrate consisting mainly of macrophages, dendritic cells (DC), T cells, and neutrophils in the dermal and the epidermal compartment. Previous studies indicate that cytokines and their effects on lymphocyte activation as well as on keratinocyte growth and differentiation, are important in initiating and maintaining psoriatic skin lesions (Uyemura et al, 1993; Schlaak et al, 1994); however, the local factors leading to activation of T cells in psoriasis have not been fully elucidated so far. Interleukin-12 (IL-12) is a heterodimeric cytokine, composed of two covalently linked subunits, p35 and p40. It is predominantly produced by antigen-presenting cells such as activated monocytes/ macrophages and DC, although various other cells including polymorphonuclear leukocytes and keratinocytes have also been reported to be a source of IL-12 in vitro (Ma et al, 1997; Trinchieri, 1995). IL12 exerts pleiotrophic effects on natural killer and T cells, which mainly include induction of cytotoxicity and production of interferon (IFN)-γ. Furthermore, IL-12 plays a major role in the development of T helper 1 (Th1) cell-mediated immune responses. These biologic activities of IL-12 are confined to the p70 heterodimer, which is produced after coexpression of both the p40 and the p35 genes in the same cell (Trinchieri, 1995; Ma et al, 1997). Until today, data on in situ expression, particularly of the biologically active IL-12 p70 heterodimer, have remained sparse in humans (Turka et al, 1995). This study therefore investigated the expression of IL-12 p35 and p40 mRNA as well as the distribution of IL-12 p70 in situ in normal and
Manuscript received January 5, 1998; revised September 3, 1998; accepted for publication September 18, 1998. Reprint requests to: Dr. N. Yawalkar, Institute of Immunology and Allergology, Inselspital, 3010 Bern, Switzerland. Abbreviations: APAAP, alkaline phosphatase anti-alkaline phosphatase; DC, dendritic cells; Th, T helper.
MATERIALS AND METHODS Skin samples The study protocol was approved by the Ethical Committee of the Medical Faculty of the University of Bern. After obtaining informed consent, paired 5 mm punch biopsy specimens were taken from long-standing psoriatic lesions and adjacent nonlesional skin of 12 caucasian patients (five females, seven males, age range 20–68 y, mean 48 y). The psoriasis in these patients was mild to moderate in severity. Normal skin was obtained from 12 sex- and age-matched patients undergoing plastic reconstructive surgery. None of the patients had received any ultraviolet treatment or systemic drug therapy, nor any topical corticosteroids for at least 3 wk prior to the investigation. For immunohistochemistry and RT-PCR, biopsy specimens were snap-frozen in or without tissue embedding medium, respectively, using isopentane precooled in liquid nitrogen and stored at –70°C until use. RT-PCR analysis After homogenization of the skin biopsy specimens, total RNA was extracted from normal skin (n 5 5), nonlesional and lesional psoriatic skin (n 5 5) using a SV40 total RNA isolation kit (Promega, Madison, WI). RNA isolated from H-128 (small lung carcinoma cells, obtained from the Deutsches Krebsforschungszentrum Heidelberg, Germany) and peripheral blood mononuclear cells were chosen as negative and positive controls, respectively. The total amount of RNA was quantitated by spectrophotometry. Equal amounts of total RNA (200 ng) were reverse transcribed and cDNA was amplified using the Promega one-tube/two-enzymes Access RT-PCR system following the manufacturer’s instructions. A standard and a nested RT-PCR, as described previously (Yawalkar et al, 1996), was performed to amplify IL-12 p40- and IL-12 p35-specific messengers. The sequences of the primers used for both RT-PCR as well as the sizes of the expected amplified products are listed in Table I. The reaction was carried out in a thermocycler (GeneAmp PCR system 9600, Perkin Elmer, Foster City, CA). The standard RT-PCR consisted of 45 cycles of denaturation at 94°C for 20 s, annealing at 62°C for 20 s, and extension at 72°C for 30 s. The nested RT-PCR consisted initially of 25 cycles of denaturation at 94°C for 20 s, annealing at 62°C for 20 s, and extension at 72°C for 30 s. The ‘‘nested’’ second round of PCR was performed using an
·
0022-202X/98/$10.50 Copyright © 1998 by The Society for Investigative Dermatology, Inc.
1053
1054
YAWALKAR ET AL
THE JOURNAL OF INVESTIGATIVE DERMATOLOGY
Table I. Oligonucleotides used as primer for RT-PCR RT-PCR
mRNA
Sense primer (59-39)
Position
Standard
β-actin IL12p35 IL12p40
ATCTGGCACCAACACCTTCTACAATGAGCTGCG 294–325 CCAGGAATGTTCCCATGCCTT 297–318 GGACCAGAGCAGTGAGGTCTT 199–219
Nested
IL12p35 TCCAGACCCAGGAATGTTCCCA IL12p35 nested AACTAATGGGAGTTGCCTG IL12p40 TCACAAGGAGGCGAGGTTC IL12p40 nested TCACAAAGGAGGCGAGGTTC
290–311 518–536 283–302 283–302
Length (bp)
Anti-sense primer (59-39)
Position
CGTCATACTCCTGCTTGCTGATCCACATCTGC GGCCTGCATCAGCTCATCAAT CTCCTTGTTGTCCCCTCTGA
1100–1131 838 690–710 414 552–571 373
GGGACCTCGCTTTTTAGGAAG GGGACCTCGCTTTTTAGGAAG ATCAGAACCTAACTGCAGGG TGAACGGCATCCACCATGAC
856–876 856–876 989–1008 641–660
589 359 726 378
internal primer along with one of the original primers and was carried out for 17–35 cycles. PCR cycle, primer, and template concentrations were optimized to receive linear range of signal strength. Amplification of β-actin was used as an internal control. For each experiment, internal controls lacking template were performed and verified to be negative. In addition, amplification of total RNA in the absence of AMV reverse transcriptase was performed to check for DNA contamination and was shown to be negative. PCR products were finally analyzed by electrophoresis on 3% agarose gels, visualized by ethidium bromide staining, and the size of the amplified products compared with molecular weight markers run in parallel. The exposed films obtained from the gels were scanned and analyzed by optometric scanner and the integrated optical density in arbitrary units was determined. The levels of IL-12 p35 and p40, relative to the β-actin control, were calculated and the results were expressed as relative amounts of mRNA. Immunohistochemistry For immunostaining, monoclonal mouse antihuman IL-12 p70 antibodies (clone 20C2, IgG1 isotype) kindly donated by U. Gubler, (Hoffman-LaRoche, Nutley, NJ) were used. Immunostaining of biopsy specimens from normal skin (n 5 7) as well as nonlesional and lesional psoriatic skin (n 5 7) was performed with minor modifications according to the alkaline phosphatase anti-alkaline phosphatase (APAAP) method as described previously (Schwaller et al, 1995). Briefly, six micrometer cryostat tissue sections were fixed in a mixture of acetone/methanol/formaldehyde. Slides were rehydrated in Tris-buffered saline with 5% normal rabbit serum for 20 min and incubated with the primary antibody (30–40 µg per ml diluted in Tris-buffered saline with 0.5% casein and 5% normal rabbit serum) for 2 h, followed by a rabbit anti-mouse antibody (dilution 1:50; Z-259; DAKO, Glostrup, DK) and the APAAP complexes (dilution 1:50; D-651; DAKO). To enhance the signal, incubation with the bridging antibody and the APAAP complexes were repeated once. Finally, sections were developed in new fuchsin-naphtol (Sigma, St. Louis, MO) and counterstained with hematoxylin. Substitution of the primary antibody with isotype-matched IgG, and omission of the primary antibody served as negative controls. Evaluation of sections Sections were examined by two independent investigators. IL-12 staining was assessed on 10–15 adjacent fields (3400 magnification) of the dermis using an eyepiece graticule and is expressed as the mean number 6 SD of positive cells per field. Only cells with a nucleus were included in the countings. Statistical analyses was performed using the Wilcoxon and Mann–Whitney U test for the paired and unpaired samples, respectively.
RESULTS IL-12 p40 and p35 mRNA expression in normal, in nonlesional, and in lesional psoriatic skin Figure 1 shows the results of representative blots from normal skin (n 5 2), nonlesional skin (n 5 2), and lesional psoriatic skin (n 5 2) after 45 rounds of thermal cycling using a standard RT-PCR to amplify IL-12 p35 and p40. Specific transcripts for p35 (upper panel) were detected in normal (lanes 1 and 2), in nonlesional (lanes 2 and 3), and in psoriatic (lanes 4 and 5) skin. Such specific transcripts were reproducibly found in all skin specimens from normal skin (n 5 5), nonlesional skin (n 5 5), and lesional psoriatic skin (n 5 5), demonstrating that IL-12 p35 is constitutively expressed in human skin in situ. In contrast to IL-12 p35, p40 transcripts (middle panel) were only detectable in psoriatic skin. No signals were found in samples without RT reaction (lane 7). Furthermore, negative controls, including water blanks and RNA extracted from H-128 cells, revealed no amplification signals (not shown). Specific signals for both the p40 and the p35 chains were readily detected in PBMC (lane 8) that were chosen as a positive control on the basis of previous analyses. PCR amplification of β-actin mRNA after 25 cycles is shown as a
Figure 1. Access RT-PCR analysis of IL-12 p35 and p40 expression. Specific transcripts for IL-12 p35 (414 bp) and p40 (373 bp) are shown from normal skin (NS; lanes 1 and 2), nonlesional skin (NL; lanes 3 and 4), and lesional psoriatic skin (LS; lanes 5 and 6). After 45 cycles of amplification the products were analyzed by electrophoresis on 2% agarose and stained by ethidium bromide. M, 100 bp molecular weight marker. Lane 7, negative control with RNA extracted from PBMC containing no AMV-RT in the PCR mix. Lane 8, positive control with PBMC. Amplification of β-actin (838 bp) was used as a control for mRNA integrity.
positive control for equivalent loading and integrity of the RNA used in the analyses. In order to enhance the sensitivity and specificity of the reaction, a nested RT-PCR was also performed to detect IL-12 p40- and IL-12 p35-specific transcripts. As shown in Fig 2, specific transcripts for both the p35 (upper panel) and the p40 (lower panel) subunits were reproducibly detected in normal skin (lane 1), nonlesional skin (lane 2), and psoriatic skin (lane 3), respectively, in the second round of thermal cycling. The linear range of amplification in the second round of thermal cycling was between 23 and 31 cycles. The optimal number of cycles to amplify the IL-12 p40 subunit in lesional psoriatic skin (p40 LS) was 25, whereas µ29 cycles were necessary to obtain a comparable level of amplification in normal (p40 NS) and nonlesional psoriatic skin (p40 NL). The optimal number of cycles to amplify the IL-12 p35 subunit was µ27 for normal (p35 NS), nonlesional (p35 NL), and lesional psoriatic skin (p35 LS). Furthermore, transcripts of IL-12 p35, p40, and β-actin were analyzed by densitometric scanner and the relative amounts of IL-12 p35 and p40 were determined semiquantatively. The mean values 6 SD of the specimens (n 5 5) are shown in Fig 3. A significant enhancement (p , 0,05) with a mean increase of 11-fold (range 8–16) for IL-12 p40 was detected in psoriatic skin lesions as compared with normal and nonlesional psoriatic skin lesions. Furthermore, a less prominent and a statistically marginally not significant increase in IL-12 p35 expression was obtained. The biologic active IL-12 protein (p70) expression is enhanced in situ in psoriasis As shown in Fig 4(a), IL-12 p70 immunoreactivity in normal tissue was only observed on a few isolated cells in the dermis. The mean number of IL-12 positive cells per field was 1.3 6 0.5. Interestingly, no IL-12 protein was detectable in the epidermis in vivo, although these cells have been previously reported
VOL. 111, NO. 6 DECEMBER 1998
INTERLEUKIN-12 IN PSORIATIC SKIN
1055
Figure 3. Interleukin-12 p40 mRNA expression is increased in psoriatic lesions. Amplified products of IL-12 p35, p40, and β-actin from normal skin (NS, n 5 5), nonlesional skin (NL, n 5 5), and lesional psoriatic skin (LS, n 5 5) were electrophoresed on 2% agarose gel, visualized with ethidium bromide and analyzed by densitometric scanner. Semi-quantitative analysis was performed using the levels of β-actin transcripts as internal references. y-axes show the relative amount of IL-12 p35 and p40 mRNA. Scale bars: mean 6 SD. Asterisk, p , 0.05; comparing paired and unpaired samples using Wilcoxon and Mann– Whitney U test, respectively.
an isotype-matched IgG (Fig 4c). Immunoreactive IL-12 was mainly located in the papillary dermis of the psoriatic lesions (Fig 5a) and was predominantly expressed in the cytoplasm of mononuclear cells (Fig 5b). The morphology of these cells suggested that macrophages are the dominant source of IL-12. Occasionally, cells with a typical dendritic morphology were also positive for IL-12 (5c), suggesting that dermal dendritic cells may represent a further cell population capable of producing IL-12. In addition, neutrophils in the papillary dermis, which were also identified by their typical morphology, occasionally showed IL-12 immunoreactivity (Fig 4b, inset). Furthermore, in contrast to findings by Turka et al, we did not observe any significant staining of nerve fibers in any of our specimens. DISCUSSION
Figure 2. Detection of IL-12 p35 and p40 transcripts by nested RTPCR. (A) Optimal number of amplification cycles. RNA samples from normal (NS, n 5 5), nonlesional (NL, n 5 5), and lesional psoriatic skin (LS, n 5 5) were subjected to 25 cycles of RT-PCR and the resulting products to an increasing number of cycles in a nested reaction. The amplified products were electrophoresed on a 2% agarose gel, visualized with ethidium bromide, and analyzed by densitometry. The x-axis indicates the number of cycles used in the nested reaction and the y-axis shows the mean values 6 SD of the IL-12 p35 and p40 amplified products measured by densitometry analysis. (B) A representative nested RT-PCR blot from normal (lane 1), nonlesional (lane 2), and psoriatic (lane 3) skin lesions after 25 cycles of amplification for p40 and 27 cycles for p35.
to be a source of IL-12 in vitro (Trinchieri, 1995). A slightly higher, although not significant mean number (2.2 6 1.1) of IL-12 positive cells per field was found in nonlesional psoriatic skin as compared with normal skin. In contrast to normal and nonlesional psoriatic skin, IL12 expression was markedly increased in psoriatic skin lesions (Fig 4b), where the mean number of IL-12 positive cells per field was 5.4 6 2.1. The difference in the number of IL-12 positive cells as compared with normal and nonlesional psoriatic skin was significant (p , 0.05). No positive staining was seen when substituting the primary antibody with
In order to elucidate factors regulating disease promotion in psoriasis, we investigated IL-12 expression in normal skin as well as nonlesional and lesional psoriatic skin. Our data demonstrate that expression of IL-12, both at mRNA and at protein levels, is enhanced in psoriatic lesions as compared with normal and nonlesional psoriatic skin. A slight increment, especially in IL-12 protein expression, was also found in nonlesional psoriatic skin as compared with normal skin, although differences failed to reach statistical significance. Using a standard RT-PCR, messengers for the p35 subunit of IL-12 were readily detected in all samples from normal skin as well as nonlesional and lesional psoriatic skin, with some variation in the intensity of expression. This ubiquitous expression of the IL-12 p35 subunit is in accordance with previous data, which have shown a constitutive expression of p35 in various cells (Trinchieri, 1995; Ma et al, 1997). In contrast to the p35 subunit, IL-12 p40 was not detectable in normal and nonlesional psoriatic skin, even after 45 rounds of thermal cycling; however, using a more sensitive and specific nested RT-PCR, low levels of p40 were also found, indicating that both subunits are indeed constitutively expressed in human skin. The specificity of the PCR products was confirmed by sequence analysis (data not shown.) Furthermore, semiquantitative analysis of mRNA expression revealed a mean increase of 11-fold for IL-12 p40, indicating that this subunit is significantly upregulated in psoriasis. In addition, to localize the distribution of IL-12 in situ, immunohistochemistry was performed using a previously well-characterized antibody recognizing the IL-12 p70 heterodimer (Presky et al, 1998). Our findings indicate that the biologically active IL-12 p70 heterodimer is strongly expressed in psoriatic skin lesions and mainly found on mononuclear cells and some neutrophils in the upper dermis. Interestingly, we did not observe any significant staining of nerve fibers as shown by Turka et al in any of our specimens, which may be due to the different specificity of
1056
YAWALKAR ET AL
THE JOURNAL OF INVESTIGATIVE DERMATOLOGY
Figure 4. Immunostaining for IL-12 p70 in normal and psoriatic skin. IL-12 immunoreactivity is confined to isolated cells in the dermis of normal skin (a, arrow). Stronger immunoreactivity on mononuclear cells and neutrophils (arrow and inset) was detected in psoriatic lesions (b). No staining was found in the isotype-matched negative control (c). APAAP method, scale bars: 50 µm.
Figure 5. IL-12 p70 in psoriatic skin is predominantly expressed in the papillary dermis (a) and mainly on mononuclear cells (b). Occasionally, cells with a typical dendritic morphology also showed strong staining for p70 (c). Scale bars: (a) 25 µm; (b, c) 10 µm.
the antibodies used in both studies. Furthermore, our immunostaining results also indicate that keratinocytes are not a prominent source of the biologically active IL-12 p70 heterodimer in psoriasis. Although the precise pathomechanisms underlying psoriasis have not yet been fully elucidated, a large body of evidence indicates that a T cellmediated immune dysregulation plays an important role in the pathogenesis of this skin disease (Christophers, 1996; Norris et al, 1997). The appearance of monocytes/macrophages and DC together with T lymphocytes is regarded as one of the initial changes in the development of psoriatic lesions, which precedes epidermal hyperplasia (Van de Kerkhof et al, 1996). Immunohistologic analysis of psoriatic skin lesions has revealed a dense dermal infiltration of activated, predominantly CD41 T cells (Baker et al, 1984). Furthermore, in the early phase of the developing skin lesions, proliferating T cells are often seen in association with HLA-DR1 DC (Heng and Klass, 1985). Interestingly, IL-12 production by DC or macrophages is strongly upregulated by ligand-TCR and CD40–CD40 L interactions with CD41 cells (Cella et al, 1996; Kato et al, 1996; Koch et al, 1996; Shu et al, 1995). Thus, such close interactions between DC or macrophages and T cells in the inflammatory tissue could partly explain the enhanced expression of IL-12, which was mainly found
on mononuclear cells in the dermis in this study. This distribution of IL12 is in accordance with a previous report, demonstrating CD68 positive macrophages as a major source of IL-12 in atopic dermatitis (Hamid et al, 1996). In addition, morphologic features of some of the stained cells in our study suggest that dermal dendritic cells and neutrophils represent further cell populations capable of producing the biologic active p70 heterodimer in psoriatic skin lesions in situ. In this study, double immunostaining experiments to precisely identify the cell types producing IL-12 were not feasible due to various reasons as described previously (Van Noorden, 1986). The fixation process for optimal IL-12 staining led to a loss of immunoreactivity for extracellular antigens such as CD1a-c, CD14. Furthermore, double staining of intracellular antigens like CD68 was not successful, because staining of the first reaction masked any staining for IL-12 at the same site. Cytokine responses have been broadly categorized into two main types, namely Th1 and Th2 type cytokines. Lesional psoriatic skinderived T cells have been shown to predominantly secrete Th1 type cytokines such as IL-2 and INF-γ (Uyemura et al, 1993; Schlaak et al, 1994); however, production of other cytokines have also been reported, suggesting a more complex immune regulation (Vollmer et al, 1994).
VOL. 111, NO. 6 DECEMBER 1998
INF-γ in particular is thought to be of major importance and high levels of IFN-γ have been detected in psoriatic lesions (Bjerke et al, 1983; Livden et al, 1989). Injection of recombinant IFN-γ was shown to produce new skin lesions or to aggravate the disease (Fierlbeck et al, 1990; Kowalzick and Weyer, 1990; Barker et al, 1993). In view of the enhanced production of IL-12 in situ, we suggest that this cytokine plays a decisive role in the polarization of T cells by inducing secretion of IFN-γ. The production of IL-12 is regulated by both positive and negative feedback mechanisms involving IFN-γ, GM-CSF, as well as IL-4, IL-10, and TGF-β, respectively (Ma et al, 1997; Trinchieri, 1995). Because IL-12 promotes IFN-γ secretion by T cells, and IFN-γ in turn induces IL-12 production in DC/macrophages, these interactions may provide a potent positive feedback mechanism by which a cell-mediated T cell response, preferentially with a type 1 cytokine profile, is maintained in situ. In addition, IL-10, a major downregulating factor of IL-12, has recently been reported to be barely detectable in psoriasis, which could be a further reason for the upregulation of IL-12 in this skin disease (Asadullha et al, 1998). Interestingly, we did not detect any IL-12 positive cells in the epidermis in our study. Thus, one may speculate that a specific microenvironment, consisting of T cells, certain adhesion and costimulatory molecules, and in particular cytokines such as IFN-γ found in the upper dermis, is responsible for optimal production of IL-12. Predominance of a Th1 cytokine profile with a key role for IL-12 in the induction of cell-mediated autoimmune diseases has been previously demonstrated in several experimental models (Adorini et al, 1997). Recently, autoimmune mechanisms have also been implicated in the pathogenesis of psoriasis (Valdimarsson et al, 1995). Previous reports have demonstrated that T cells isolated from psoriatic lesions show monoclonality or marked oligoclonality, which strongly suggest activation by classical antigen/TCR mechanism (Lewis et al, 1993; Menssen et al, 1995). In this context, T cell activation may possibly be driven by an antigen from an infectious agent that cross-reacts with normal epidermal protein, and recent reports point to a role for streptococcal M protein, which bears some homology with epidermal keratin (Sigmundsdottir et al, 1997). Activation of T cells by superantigens has also been proposed to be of pathogenic significance (Valdimarsson et al, 1995). These assumptions are supported by the knowledge that streptococcal infections may precipitate guttate psoriasis. Interestingly, bacteria like Staphylococcus aureus and bacterial products like lipopolysaccharides and superantigens are also potent inducers of IL-12 production in monocytes/macrophages (Leung et al, 1995; Ma et al, 1997). Furthermore, bacterial superantigens have been shown to induce the skin selective homing receptor, the cutaneous lymphocyteassociated antigen, on T cells via stimulation of IL-12 production (Leung et al, 1995). Thus, upregulation of IL-12 in psoriatic lesions invite speculations that bacterial products or autoantigens may aggravate psoriasis via induction and secretion of IL-12. Subsequently, besides promoting T cell mediated inflammation, in situ IL-12 may also have a primary role in the induction of new psoriatic skin lesions. Although further studies will be required to precisely clarify the functional role of IL-12 in psoriasis, recent reports showing an improvement of psoriasis in parallel with a decrease in IL-12 p70 secretion further underline the importance of this cytokine (Asadullha et al, 1998). In conclusion, our data show an enhanced expression of IL-12 in psoriatic skin as compared with normal skin. Although the exact mechanisms of T cell activation in psoriasis are not yet known, these results suggest that upregulation of IL-12 in concert with other cytokines such as IFN-γ may play an important role in directing the differentiation of skin-infiltrating T cells, initiating and promoting a Th1 cytokine profile, and finally maintaining the inflammatory response in psoriasis.
We wish to thank J. Schwaller for technical advice concerning immunostaining of IL-12 and S. Hofer, L. Quinto, E.Seger for excellent technical help. These investigations were supported by the Swiss National Science Foundation Grant 32–48885.96, SCORE B to N.Y.
INTERLEUKIN-12 IN PSORIATIC SKIN
1057
REFERENCES Adorini L, Aloiso F, Galbiati F, et al: Targeting IL-12 the key cytokine driving Th1mediated autoimmune disease In: Adorini L (eds). IL-12. Chem Immunol, Vol. 68, Basel: Karger, 1997, pp. 175–179 Asadullha K, Sterry W, Stephanek K, Jasulatis D, Leupold M, Audring H, Volk HD, Do¨cke WD: IL-10 is a key cytokine in psoriasis. Proof of principle by IL-10 therapy: a new therapeutic approach. J Clin Invest 101:783–794, 1998 Baker BS, Swain AF, Fry L, Valdimarsson H: Epidermal T lymphocytes, HLA-DR expression in psoriasis. Br J Dermatol 110:555–564, 1984 Barker JN, Goodlad JR, Ross EL, Yu CC, Groves RW, MacDonald DM: Increased epidermal cell proliferation in normal human skin in vivo following local administration of interferon-gamma. Am J Pathol 142:1091–1097, 1993 Bjerke JR, Livden JK, Degree M, Matre R: Interferon in suction blister fluid from psoriatic lesions. Br J Dermatol 108:295–299, 1983 Cella M, Scheidegger D, Palmer-Lehmann K, Lane P, Lanzavecchia A, Alber G: Ligation of CD40 on dendritic cells triggers production of high levels of Interleukin 12 and enhances T cell stimulatory capacity: T-T help via APC activation. J Exp Med 184:747–752, 1996 Christophers E: The immunopathalogy of psoriasis. Int Arch Allergy Immunol 110:199– 206, 1996 Fierlbeck G, Rassner G, Muller C: Psoriasis induced at the injection site of recombinant interferon gamma. Arch Dermatol 126:351–355, 1990 Hamid Q, Naseer T, Minshall EM, Song YL, Boguniewicz M, Leung DY: In vivo expression of IL-12 and IL-13 in atopic dermatitis. J Allergy Clin Immunol 98:225– 231, 1996 Heng MCY, Klass SG: Cell interaction in psoriasis. Arch Dermatol 121:881–887, 1985 Kato T, Hakamada R, Yamane H, Nariuchi H: Induction of IL-12 p-40 messenger RNA expression, IL-12 macrophages via CD4O–CD40 ligand interaction. J Immunol 156:3932–3938, 1996 Koch F, Stanzl U, Jennewein P, et al: High level Il- 12 production by murine dendritic cells: upregulation via MHC class II and CD40 molecules and downregulation by IL-4 and IL-10. J Exp Med 184:741–746, 1996 Kowalzick L, Weyer U: Psoriasis induced at the injection site of recombinant interferons. Arch Dermatol 126:1515–1516, 1990 Leung DY, Gately M, Trumble A, Ferguson-Darnell B, Schlievert PM, Picker LJ: Bacterial superantigens induce T-cell expression of the skin selective homing receptor, the cutaneus lymphocyte-associated antigen, via stimulation of interleukin 12 production J Exp Med 181:747–753, 1995a Lewis HM, Baker BS, Bokth S, Powels AV, Garioch JJ, Valdimarsson H, Fry L: Restricted T-cell receptor Vβ gene usage in the skin of patients with guttate and chronic plaque psoriasis. Br J Dermatol 129:514–520, 1993 Livden JK, Nilsen R, Bjerke JR, Matre R: In situ localization of interferons in psoriatic lesions. Arch Dermatol Res 281:392–397, 1989 Ma X, Aste-Amezaga M, Gri G, Gerosa F, Trinchieri G: Immunomodulatory functions and molecular regulation of IL-12. In: Adorini L (eds). IL-12. Chem Immunol, Vol. 68, Basel: Karger, 1997, pp 1–22 Menssen A, Trommler P, Vollmer S, et al: Evidence for an antigen-specific cellular immune response in skin lesions of patients with psoriasis vulgaris J Immunol 155:4078– 4083, 1995 Norris DA, Travers JB, Leung DYM: Lymphocyte activation in the pathogenesis of Psoriasis. J Invest Dermatol 109:1–3, 1997 Presky DH, Minetti LJ, Gillessen S, et al: Analysis of the multiple interactions between IL-12 and the high affinity IL-12 receptor complex. J Immunol 160:2174–2179, 1998 Schlaak JF, Buslau M, Jochum W, et al: T cells involved in psoriasis belong to the Thelper 1 subset. J Invest Dermatol 102:145–149, 1994 Schwaller J, Tobler A, Niklaus G, Hurwitz N, Hennig I, Fey MF, Borisch B: Interleukin12 expression in human lymphomas and nonneoplastic lymphoid disorders. Blood 85:2182–2188, 1995 Shu U, Kiniwa M, Wu CY, et al: Activated T cells induce interleukin-12 production by monocytes via CD4O–CD40 ligand interaction. Eur J Immunol 25:1125–1128, 1995 Sigmundsdottir H, Sigurgeirsson B, Troye-Blomberg M, Good MF, Valdimarsson H, Jonsdottir I: Circulating T cells of patients with active psoriasis respond to streptococcal M-peptides sharing sequences with human epidermal keratins. Scand J Immunol 45:688–697, 1997 Trinchieri G: Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annu Rev Immunol 13:251–276, 1995 Turka LA, Goodman RE, Rutkowski JL, et al: Interleukin 12: a potential link between nerve cells and the immune response in inflammatory disorders. Mol Med 1:690– 699, 1995 Uyemura K, Yamamamura M, Fiveson DF, Modlin RL, Nickoloff BJ: The cytokine network in lesional and lesion-free psoriatic skin is characterized by a T-helper type 1 cell-mediated response. J Invest Dermatol 101:701–705, 1993 Valdimarsson H, Baker BS, Jonsdottri I, Powles A, Fry L: Psoriasis: A T-cell mediated autoimmune disease induced by streptococcal superantigens? Immunol Today 16:145– 149, 1995 Van de Kerkhof PCM, Gerritsen MJP, de Jong EMGJ: Transition from symptomless to lesional psoriatic skin. Clin Exp Dermatol 21:325–329, 1996 Van Noorden S: Tissue preperation and immunostaining techniques for light microscopy. In: Polak MJ, Van Noorden S (eds). Immunocytochemistry, Modern Methods and Applications. Bristol: John Wright, 1986, pp. 26–53 Vollmer S, Menssen A, Trommler P, Schendel D, Prinz JCT: lymphocytes derived from skin lesions of patients with psoriasis vulgaris express a novel cytokine pattern that is distinct from that of T helper type 1 and T helper type 2 cells. Eur J Immunol 24:2377–2382, 1994 Yawalkar N, Limat A, Brand CU, Braathen LR: Constitutive expression of both subunits of interleukin-12 in human keratinocytes. J Invest Dermatol 106:80–83, 1996
Although the precise underlying pathomechanisms of psoriasis have not been fully elucidated, previous reports suggest that T helper 1-type cytokines are critically involved in the pathogenesis of this disease. Interleukin12 (IL-12), a heterodimeric cytokine, has been suggested to play a major role in the development of T helper 1 cell responses. In this study, the presence of IL-12 mRNA and protein was investigated in normal human skin as well as nonlesional and lesional psoriatic skin. Messenger RNA levels were determined in biopsy specimens by a standard and a nested reverse transcriptase-polymerase chain reaction method. Additionally, IL-12 protein expression was analyzed in situ by immunohistochemistry using an antibody recognizing IL-12 p70. Whereas specific transcripts for IL-12 p35 were reproducibly detected
without any significant differences in all samples, enhanced IL-12 p40 mRNA signals were only found in lesional psoriatic skin as compared with normal and nonlesional psoriatic skin. Furthermore, immunoreactivity for IL-12 p70 was markedly increased in the psoriatic skin lesions and was predominantly expressed on mononuclear cells in the dermis. In conclusion, our data suggest a critical role for IL-12 in promoting and maintaining T cell activation and inducing T helper 1-type cytokines such as interferon-γ in psoriasis. We speculate that IL-12 might be a key cytokine in the pathogenesis of psoriasis. Key words: interleukin-12/psoriasis/nRT-PCR-immunohistochemistry. J Invest Dermatol 111:1053–1057, 1998
P
psoriatic skin using reverse transcriptase-polymerase chain reaction (RT-PCR) and immunohistochemistry.
soriasis is characterized by hyperproliferation of keratinocytes and a dense lesional infiltrate consisting mainly of macrophages, dendritic cells (DC), T cells, and neutrophils in the dermal and the epidermal compartment. Previous studies indicate that cytokines and their effects on lymphocyte activation as well as on keratinocyte growth and differentiation, are important in initiating and maintaining psoriatic skin lesions (Uyemura et al, 1993; Schlaak et al, 1994); however, the local factors leading to activation of T cells in psoriasis have not been fully elucidated so far. Interleukin-12 (IL-12) is a heterodimeric cytokine, composed of two covalently linked subunits, p35 and p40. It is predominantly produced by antigen-presenting cells such as activated monocytes/ macrophages and DC, although various other cells including polymorphonuclear leukocytes and keratinocytes have also been reported to be a source of IL-12 in vitro (Ma et al, 1997; Trinchieri, 1995). IL12 exerts pleiotrophic effects on natural killer and T cells, which mainly include induction of cytotoxicity and production of interferon (IFN)-γ. Furthermore, IL-12 plays a major role in the development of T helper 1 (Th1) cell-mediated immune responses. These biologic activities of IL-12 are confined to the p70 heterodimer, which is produced after coexpression of both the p40 and the p35 genes in the same cell (Trinchieri, 1995; Ma et al, 1997). Until today, data on in situ expression, particularly of the biologically active IL-12 p70 heterodimer, have remained sparse in humans (Turka et al, 1995). This study therefore investigated the expression of IL-12 p35 and p40 mRNA as well as the distribution of IL-12 p70 in situ in normal and
Manuscript received January 5, 1998; revised September 3, 1998; accepted for publication September 18, 1998. Reprint requests to: Dr. N. Yawalkar, Institute of Immunology and Allergology, Inselspital, 3010 Bern, Switzerland. Abbreviations: APAAP, alkaline phosphatase anti-alkaline phosphatase; DC, dendritic cells; Th, T helper.
MATERIALS AND METHODS Skin samples The study protocol was approved by the Ethical Committee of the Medical Faculty of the University of Bern. After obtaining informed consent, paired 5 mm punch biopsy specimens were taken from long-standing psoriatic lesions and adjacent nonlesional skin of 12 caucasian patients (five females, seven males, age range 20–68 y, mean 48 y). The psoriasis in these patients was mild to moderate in severity. Normal skin was obtained from 12 sex- and age-matched patients undergoing plastic reconstructive surgery. None of the patients had received any ultraviolet treatment or systemic drug therapy, nor any topical corticosteroids for at least 3 wk prior to the investigation. For immunohistochemistry and RT-PCR, biopsy specimens were snap-frozen in or without tissue embedding medium, respectively, using isopentane precooled in liquid nitrogen and stored at –70°C until use. RT-PCR analysis After homogenization of the skin biopsy specimens, total RNA was extracted from normal skin (n 5 5), nonlesional and lesional psoriatic skin (n 5 5) using a SV40 total RNA isolation kit (Promega, Madison, WI). RNA isolated from H-128 (small lung carcinoma cells, obtained from the Deutsches Krebsforschungszentrum Heidelberg, Germany) and peripheral blood mononuclear cells were chosen as negative and positive controls, respectively. The total amount of RNA was quantitated by spectrophotometry. Equal amounts of total RNA (200 ng) were reverse transcribed and cDNA was amplified using the Promega one-tube/two-enzymes Access RT-PCR system following the manufacturer’s instructions. A standard and a nested RT-PCR, as described previously (Yawalkar et al, 1996), was performed to amplify IL-12 p40- and IL-12 p35-specific messengers. The sequences of the primers used for both RT-PCR as well as the sizes of the expected amplified products are listed in Table I. The reaction was carried out in a thermocycler (GeneAmp PCR system 9600, Perkin Elmer, Foster City, CA). The standard RT-PCR consisted of 45 cycles of denaturation at 94°C for 20 s, annealing at 62°C for 20 s, and extension at 72°C for 30 s. The nested RT-PCR consisted initially of 25 cycles of denaturation at 94°C for 20 s, annealing at 62°C for 20 s, and extension at 72°C for 30 s. The ‘‘nested’’ second round of PCR was performed using an
·
0022-202X/98/$10.50 Copyright © 1998 by The Society for Investigative Dermatology, Inc.
1053
1054
YAWALKAR ET AL
THE JOURNAL OF INVESTIGATIVE DERMATOLOGY
Table I. Oligonucleotides used as primer for RT-PCR RT-PCR
mRNA
Sense primer (59-39)
Position
Standard
β-actin IL12p35 IL12p40
ATCTGGCACCAACACCTTCTACAATGAGCTGCG 294–325 CCAGGAATGTTCCCATGCCTT 297–318 GGACCAGAGCAGTGAGGTCTT 199–219
Nested
IL12p35 TCCAGACCCAGGAATGTTCCCA IL12p35 nested AACTAATGGGAGTTGCCTG IL12p40 TCACAAGGAGGCGAGGTTC IL12p40 nested TCACAAAGGAGGCGAGGTTC
290–311 518–536 283–302 283–302
Length (bp)
Anti-sense primer (59-39)
Position
CGTCATACTCCTGCTTGCTGATCCACATCTGC GGCCTGCATCAGCTCATCAAT CTCCTTGTTGTCCCCTCTGA
1100–1131 838 690–710 414 552–571 373
GGGACCTCGCTTTTTAGGAAG GGGACCTCGCTTTTTAGGAAG ATCAGAACCTAACTGCAGGG TGAACGGCATCCACCATGAC
856–876 856–876 989–1008 641–660
589 359 726 378
internal primer along with one of the original primers and was carried out for 17–35 cycles. PCR cycle, primer, and template concentrations were optimized to receive linear range of signal strength. Amplification of β-actin was used as an internal control. For each experiment, internal controls lacking template were performed and verified to be negative. In addition, amplification of total RNA in the absence of AMV reverse transcriptase was performed to check for DNA contamination and was shown to be negative. PCR products were finally analyzed by electrophoresis on 3% agarose gels, visualized by ethidium bromide staining, and the size of the amplified products compared with molecular weight markers run in parallel. The exposed films obtained from the gels were scanned and analyzed by optometric scanner and the integrated optical density in arbitrary units was determined. The levels of IL-12 p35 and p40, relative to the β-actin control, were calculated and the results were expressed as relative amounts of mRNA. Immunohistochemistry For immunostaining, monoclonal mouse antihuman IL-12 p70 antibodies (clone 20C2, IgG1 isotype) kindly donated by U. Gubler, (Hoffman-LaRoche, Nutley, NJ) were used. Immunostaining of biopsy specimens from normal skin (n 5 7) as well as nonlesional and lesional psoriatic skin (n 5 7) was performed with minor modifications according to the alkaline phosphatase anti-alkaline phosphatase (APAAP) method as described previously (Schwaller et al, 1995). Briefly, six micrometer cryostat tissue sections were fixed in a mixture of acetone/methanol/formaldehyde. Slides were rehydrated in Tris-buffered saline with 5% normal rabbit serum for 20 min and incubated with the primary antibody (30–40 µg per ml diluted in Tris-buffered saline with 0.5% casein and 5% normal rabbit serum) for 2 h, followed by a rabbit anti-mouse antibody (dilution 1:50; Z-259; DAKO, Glostrup, DK) and the APAAP complexes (dilution 1:50; D-651; DAKO). To enhance the signal, incubation with the bridging antibody and the APAAP complexes were repeated once. Finally, sections were developed in new fuchsin-naphtol (Sigma, St. Louis, MO) and counterstained with hematoxylin. Substitution of the primary antibody with isotype-matched IgG, and omission of the primary antibody served as negative controls. Evaluation of sections Sections were examined by two independent investigators. IL-12 staining was assessed on 10–15 adjacent fields (3400 magnification) of the dermis using an eyepiece graticule and is expressed as the mean number 6 SD of positive cells per field. Only cells with a nucleus were included in the countings. Statistical analyses was performed using the Wilcoxon and Mann–Whitney U test for the paired and unpaired samples, respectively.
RESULTS IL-12 p40 and p35 mRNA expression in normal, in nonlesional, and in lesional psoriatic skin Figure 1 shows the results of representative blots from normal skin (n 5 2), nonlesional skin (n 5 2), and lesional psoriatic skin (n 5 2) after 45 rounds of thermal cycling using a standard RT-PCR to amplify IL-12 p35 and p40. Specific transcripts for p35 (upper panel) were detected in normal (lanes 1 and 2), in nonlesional (lanes 2 and 3), and in psoriatic (lanes 4 and 5) skin. Such specific transcripts were reproducibly found in all skin specimens from normal skin (n 5 5), nonlesional skin (n 5 5), and lesional psoriatic skin (n 5 5), demonstrating that IL-12 p35 is constitutively expressed in human skin in situ. In contrast to IL-12 p35, p40 transcripts (middle panel) were only detectable in psoriatic skin. No signals were found in samples without RT reaction (lane 7). Furthermore, negative controls, including water blanks and RNA extracted from H-128 cells, revealed no amplification signals (not shown). Specific signals for both the p40 and the p35 chains were readily detected in PBMC (lane 8) that were chosen as a positive control on the basis of previous analyses. PCR amplification of β-actin mRNA after 25 cycles is shown as a
Figure 1. Access RT-PCR analysis of IL-12 p35 and p40 expression. Specific transcripts for IL-12 p35 (414 bp) and p40 (373 bp) are shown from normal skin (NS; lanes 1 and 2), nonlesional skin (NL; lanes 3 and 4), and lesional psoriatic skin (LS; lanes 5 and 6). After 45 cycles of amplification the products were analyzed by electrophoresis on 2% agarose and stained by ethidium bromide. M, 100 bp molecular weight marker. Lane 7, negative control with RNA extracted from PBMC containing no AMV-RT in the PCR mix. Lane 8, positive control with PBMC. Amplification of β-actin (838 bp) was used as a control for mRNA integrity.
positive control for equivalent loading and integrity of the RNA used in the analyses. In order to enhance the sensitivity and specificity of the reaction, a nested RT-PCR was also performed to detect IL-12 p40- and IL-12 p35-specific transcripts. As shown in Fig 2, specific transcripts for both the p35 (upper panel) and the p40 (lower panel) subunits were reproducibly detected in normal skin (lane 1), nonlesional skin (lane 2), and psoriatic skin (lane 3), respectively, in the second round of thermal cycling. The linear range of amplification in the second round of thermal cycling was between 23 and 31 cycles. The optimal number of cycles to amplify the IL-12 p40 subunit in lesional psoriatic skin (p40 LS) was 25, whereas µ29 cycles were necessary to obtain a comparable level of amplification in normal (p40 NS) and nonlesional psoriatic skin (p40 NL). The optimal number of cycles to amplify the IL-12 p35 subunit was µ27 for normal (p35 NS), nonlesional (p35 NL), and lesional psoriatic skin (p35 LS). Furthermore, transcripts of IL-12 p35, p40, and β-actin were analyzed by densitometric scanner and the relative amounts of IL-12 p35 and p40 were determined semiquantatively. The mean values 6 SD of the specimens (n 5 5) are shown in Fig 3. A significant enhancement (p , 0,05) with a mean increase of 11-fold (range 8–16) for IL-12 p40 was detected in psoriatic skin lesions as compared with normal and nonlesional psoriatic skin lesions. Furthermore, a less prominent and a statistically marginally not significant increase in IL-12 p35 expression was obtained. The biologic active IL-12 protein (p70) expression is enhanced in situ in psoriasis As shown in Fig 4(a), IL-12 p70 immunoreactivity in normal tissue was only observed on a few isolated cells in the dermis. The mean number of IL-12 positive cells per field was 1.3 6 0.5. Interestingly, no IL-12 protein was detectable in the epidermis in vivo, although these cells have been previously reported
VOL. 111, NO. 6 DECEMBER 1998
INTERLEUKIN-12 IN PSORIATIC SKIN
1055
Figure 3. Interleukin-12 p40 mRNA expression is increased in psoriatic lesions. Amplified products of IL-12 p35, p40, and β-actin from normal skin (NS, n 5 5), nonlesional skin (NL, n 5 5), and lesional psoriatic skin (LS, n 5 5) were electrophoresed on 2% agarose gel, visualized with ethidium bromide and analyzed by densitometric scanner. Semi-quantitative analysis was performed using the levels of β-actin transcripts as internal references. y-axes show the relative amount of IL-12 p35 and p40 mRNA. Scale bars: mean 6 SD. Asterisk, p , 0.05; comparing paired and unpaired samples using Wilcoxon and Mann– Whitney U test, respectively.
an isotype-matched IgG (Fig 4c). Immunoreactive IL-12 was mainly located in the papillary dermis of the psoriatic lesions (Fig 5a) and was predominantly expressed in the cytoplasm of mononuclear cells (Fig 5b). The morphology of these cells suggested that macrophages are the dominant source of IL-12. Occasionally, cells with a typical dendritic morphology were also positive for IL-12 (5c), suggesting that dermal dendritic cells may represent a further cell population capable of producing IL-12. In addition, neutrophils in the papillary dermis, which were also identified by their typical morphology, occasionally showed IL-12 immunoreactivity (Fig 4b, inset). Furthermore, in contrast to findings by Turka et al, we did not observe any significant staining of nerve fibers in any of our specimens. DISCUSSION
Figure 2. Detection of IL-12 p35 and p40 transcripts by nested RTPCR. (A) Optimal number of amplification cycles. RNA samples from normal (NS, n 5 5), nonlesional (NL, n 5 5), and lesional psoriatic skin (LS, n 5 5) were subjected to 25 cycles of RT-PCR and the resulting products to an increasing number of cycles in a nested reaction. The amplified products were electrophoresed on a 2% agarose gel, visualized with ethidium bromide, and analyzed by densitometry. The x-axis indicates the number of cycles used in the nested reaction and the y-axis shows the mean values 6 SD of the IL-12 p35 and p40 amplified products measured by densitometry analysis. (B) A representative nested RT-PCR blot from normal (lane 1), nonlesional (lane 2), and psoriatic (lane 3) skin lesions after 25 cycles of amplification for p40 and 27 cycles for p35.
to be a source of IL-12 in vitro (Trinchieri, 1995). A slightly higher, although not significant mean number (2.2 6 1.1) of IL-12 positive cells per field was found in nonlesional psoriatic skin as compared with normal skin. In contrast to normal and nonlesional psoriatic skin, IL12 expression was markedly increased in psoriatic skin lesions (Fig 4b), where the mean number of IL-12 positive cells per field was 5.4 6 2.1. The difference in the number of IL-12 positive cells as compared with normal and nonlesional psoriatic skin was significant (p , 0.05). No positive staining was seen when substituting the primary antibody with
In order to elucidate factors regulating disease promotion in psoriasis, we investigated IL-12 expression in normal skin as well as nonlesional and lesional psoriatic skin. Our data demonstrate that expression of IL-12, both at mRNA and at protein levels, is enhanced in psoriatic lesions as compared with normal and nonlesional psoriatic skin. A slight increment, especially in IL-12 protein expression, was also found in nonlesional psoriatic skin as compared with normal skin, although differences failed to reach statistical significance. Using a standard RT-PCR, messengers for the p35 subunit of IL-12 were readily detected in all samples from normal skin as well as nonlesional and lesional psoriatic skin, with some variation in the intensity of expression. This ubiquitous expression of the IL-12 p35 subunit is in accordance with previous data, which have shown a constitutive expression of p35 in various cells (Trinchieri, 1995; Ma et al, 1997). In contrast to the p35 subunit, IL-12 p40 was not detectable in normal and nonlesional psoriatic skin, even after 45 rounds of thermal cycling; however, using a more sensitive and specific nested RT-PCR, low levels of p40 were also found, indicating that both subunits are indeed constitutively expressed in human skin. The specificity of the PCR products was confirmed by sequence analysis (data not shown.) Furthermore, semiquantitative analysis of mRNA expression revealed a mean increase of 11-fold for IL-12 p40, indicating that this subunit is significantly upregulated in psoriasis. In addition, to localize the distribution of IL-12 in situ, immunohistochemistry was performed using a previously well-characterized antibody recognizing the IL-12 p70 heterodimer (Presky et al, 1998). Our findings indicate that the biologically active IL-12 p70 heterodimer is strongly expressed in psoriatic skin lesions and mainly found on mononuclear cells and some neutrophils in the upper dermis. Interestingly, we did not observe any significant staining of nerve fibers as shown by Turka et al in any of our specimens, which may be due to the different specificity of
1056
YAWALKAR ET AL
THE JOURNAL OF INVESTIGATIVE DERMATOLOGY
Figure 4. Immunostaining for IL-12 p70 in normal and psoriatic skin. IL-12 immunoreactivity is confined to isolated cells in the dermis of normal skin (a, arrow). Stronger immunoreactivity on mononuclear cells and neutrophils (arrow and inset) was detected in psoriatic lesions (b). No staining was found in the isotype-matched negative control (c). APAAP method, scale bars: 50 µm.
Figure 5. IL-12 p70 in psoriatic skin is predominantly expressed in the papillary dermis (a) and mainly on mononuclear cells (b). Occasionally, cells with a typical dendritic morphology also showed strong staining for p70 (c). Scale bars: (a) 25 µm; (b, c) 10 µm.
the antibodies used in both studies. Furthermore, our immunostaining results also indicate that keratinocytes are not a prominent source of the biologically active IL-12 p70 heterodimer in psoriasis. Although the precise pathomechanisms underlying psoriasis have not yet been fully elucidated, a large body of evidence indicates that a T cellmediated immune dysregulation plays an important role in the pathogenesis of this skin disease (Christophers, 1996; Norris et al, 1997). The appearance of monocytes/macrophages and DC together with T lymphocytes is regarded as one of the initial changes in the development of psoriatic lesions, which precedes epidermal hyperplasia (Van de Kerkhof et al, 1996). Immunohistologic analysis of psoriatic skin lesions has revealed a dense dermal infiltration of activated, predominantly CD41 T cells (Baker et al, 1984). Furthermore, in the early phase of the developing skin lesions, proliferating T cells are often seen in association with HLA-DR1 DC (Heng and Klass, 1985). Interestingly, IL-12 production by DC or macrophages is strongly upregulated by ligand-TCR and CD40–CD40 L interactions with CD41 cells (Cella et al, 1996; Kato et al, 1996; Koch et al, 1996; Shu et al, 1995). Thus, such close interactions between DC or macrophages and T cells in the inflammatory tissue could partly explain the enhanced expression of IL-12, which was mainly found
on mononuclear cells in the dermis in this study. This distribution of IL12 is in accordance with a previous report, demonstrating CD68 positive macrophages as a major source of IL-12 in atopic dermatitis (Hamid et al, 1996). In addition, morphologic features of some of the stained cells in our study suggest that dermal dendritic cells and neutrophils represent further cell populations capable of producing the biologic active p70 heterodimer in psoriatic skin lesions in situ. In this study, double immunostaining experiments to precisely identify the cell types producing IL-12 were not feasible due to various reasons as described previously (Van Noorden, 1986). The fixation process for optimal IL-12 staining led to a loss of immunoreactivity for extracellular antigens such as CD1a-c, CD14. Furthermore, double staining of intracellular antigens like CD68 was not successful, because staining of the first reaction masked any staining for IL-12 at the same site. Cytokine responses have been broadly categorized into two main types, namely Th1 and Th2 type cytokines. Lesional psoriatic skinderived T cells have been shown to predominantly secrete Th1 type cytokines such as IL-2 and INF-γ (Uyemura et al, 1993; Schlaak et al, 1994); however, production of other cytokines have also been reported, suggesting a more complex immune regulation (Vollmer et al, 1994).
VOL. 111, NO. 6 DECEMBER 1998
INF-γ in particular is thought to be of major importance and high levels of IFN-γ have been detected in psoriatic lesions (Bjerke et al, 1983; Livden et al, 1989). Injection of recombinant IFN-γ was shown to produce new skin lesions or to aggravate the disease (Fierlbeck et al, 1990; Kowalzick and Weyer, 1990; Barker et al, 1993). In view of the enhanced production of IL-12 in situ, we suggest that this cytokine plays a decisive role in the polarization of T cells by inducing secretion of IFN-γ. The production of IL-12 is regulated by both positive and negative feedback mechanisms involving IFN-γ, GM-CSF, as well as IL-4, IL-10, and TGF-β, respectively (Ma et al, 1997; Trinchieri, 1995). Because IL-12 promotes IFN-γ secretion by T cells, and IFN-γ in turn induces IL-12 production in DC/macrophages, these interactions may provide a potent positive feedback mechanism by which a cell-mediated T cell response, preferentially with a type 1 cytokine profile, is maintained in situ. In addition, IL-10, a major downregulating factor of IL-12, has recently been reported to be barely detectable in psoriasis, which could be a further reason for the upregulation of IL-12 in this skin disease (Asadullha et al, 1998). Interestingly, we did not detect any IL-12 positive cells in the epidermis in our study. Thus, one may speculate that a specific microenvironment, consisting of T cells, certain adhesion and costimulatory molecules, and in particular cytokines such as IFN-γ found in the upper dermis, is responsible for optimal production of IL-12. Predominance of a Th1 cytokine profile with a key role for IL-12 in the induction of cell-mediated autoimmune diseases has been previously demonstrated in several experimental models (Adorini et al, 1997). Recently, autoimmune mechanisms have also been implicated in the pathogenesis of psoriasis (Valdimarsson et al, 1995). Previous reports have demonstrated that T cells isolated from psoriatic lesions show monoclonality or marked oligoclonality, which strongly suggest activation by classical antigen/TCR mechanism (Lewis et al, 1993; Menssen et al, 1995). In this context, T cell activation may possibly be driven by an antigen from an infectious agent that cross-reacts with normal epidermal protein, and recent reports point to a role for streptococcal M protein, which bears some homology with epidermal keratin (Sigmundsdottir et al, 1997). Activation of T cells by superantigens has also been proposed to be of pathogenic significance (Valdimarsson et al, 1995). These assumptions are supported by the knowledge that streptococcal infections may precipitate guttate psoriasis. Interestingly, bacteria like Staphylococcus aureus and bacterial products like lipopolysaccharides and superantigens are also potent inducers of IL-12 production in monocytes/macrophages (Leung et al, 1995; Ma et al, 1997). Furthermore, bacterial superantigens have been shown to induce the skin selective homing receptor, the cutaneous lymphocyteassociated antigen, on T cells via stimulation of IL-12 production (Leung et al, 1995). Thus, upregulation of IL-12 in psoriatic lesions invite speculations that bacterial products or autoantigens may aggravate psoriasis via induction and secretion of IL-12. Subsequently, besides promoting T cell mediated inflammation, in situ IL-12 may also have a primary role in the induction of new psoriatic skin lesions. Although further studies will be required to precisely clarify the functional role of IL-12 in psoriasis, recent reports showing an improvement of psoriasis in parallel with a decrease in IL-12 p70 secretion further underline the importance of this cytokine (Asadullha et al, 1998). In conclusion, our data show an enhanced expression of IL-12 in psoriatic skin as compared with normal skin. Although the exact mechanisms of T cell activation in psoriasis are not yet known, these results suggest that upregulation of IL-12 in concert with other cytokines such as IFN-γ may play an important role in directing the differentiation of skin-infiltrating T cells, initiating and promoting a Th1 cytokine profile, and finally maintaining the inflammatory response in psoriasis.
We wish to thank J. Schwaller for technical advice concerning immunostaining of IL-12 and S. Hofer, L. Quinto, E.Seger for excellent technical help. These investigations were supported by the Swiss National Science Foundation Grant 32–48885.96, SCORE B to N.Y.
INTERLEUKIN-12 IN PSORIATIC SKIN
1057
REFERENCES Adorini L, Aloiso F, Galbiati F, et al: Targeting IL-12 the key cytokine driving Th1mediated autoimmune disease In: Adorini L (eds). IL-12. Chem Immunol, Vol. 68, Basel: Karger, 1997, pp. 175–179 Asadullha K, Sterry W, Stephanek K, Jasulatis D, Leupold M, Audring H, Volk HD, Do¨cke WD: IL-10 is a key cytokine in psoriasis. Proof of principle by IL-10 therapy: a new therapeutic approach. J Clin Invest 101:783–794, 1998 Baker BS, Swain AF, Fry L, Valdimarsson H: Epidermal T lymphocytes, HLA-DR expression in psoriasis. Br J Dermatol 110:555–564, 1984 Barker JN, Goodlad JR, Ross EL, Yu CC, Groves RW, MacDonald DM: Increased epidermal cell proliferation in normal human skin in vivo following local administration of interferon-gamma. Am J Pathol 142:1091–1097, 1993 Bjerke JR, Livden JK, Degree M, Matre R: Interferon in suction blister fluid from psoriatic lesions. Br J Dermatol 108:295–299, 1983 Cella M, Scheidegger D, Palmer-Lehmann K, Lane P, Lanzavecchia A, Alber G: Ligation of CD40 on dendritic cells triggers production of high levels of Interleukin 12 and enhances T cell stimulatory capacity: T-T help via APC activation. J Exp Med 184:747–752, 1996 Christophers E: The immunopathalogy of psoriasis. Int Arch Allergy Immunol 110:199– 206, 1996 Fierlbeck G, Rassner G, Muller C: Psoriasis induced at the injection site of recombinant interferon gamma. Arch Dermatol 126:351–355, 1990 Hamid Q, Naseer T, Minshall EM, Song YL, Boguniewicz M, Leung DY: In vivo expression of IL-12 and IL-13 in atopic dermatitis. J Allergy Clin Immunol 98:225– 231, 1996 Heng MCY, Klass SG: Cell interaction in psoriasis. Arch Dermatol 121:881–887, 1985 Kato T, Hakamada R, Yamane H, Nariuchi H: Induction of IL-12 p-40 messenger RNA expression, IL-12 macrophages via CD4O–CD40 ligand interaction. J Immunol 156:3932–3938, 1996 Koch F, Stanzl U, Jennewein P, et al: High level Il- 12 production by murine dendritic cells: upregulation via MHC class II and CD40 molecules and downregulation by IL-4 and IL-10. J Exp Med 184:741–746, 1996 Kowalzick L, Weyer U: Psoriasis induced at the injection site of recombinant interferons. Arch Dermatol 126:1515–1516, 1990 Leung DY, Gately M, Trumble A, Ferguson-Darnell B, Schlievert PM, Picker LJ: Bacterial superantigens induce T-cell expression of the skin selective homing receptor, the cutaneus lymphocyte-associated antigen, via stimulation of interleukin 12 production J Exp Med 181:747–753, 1995a Lewis HM, Baker BS, Bokth S, Powels AV, Garioch JJ, Valdimarsson H, Fry L: Restricted T-cell receptor Vβ gene usage in the skin of patients with guttate and chronic plaque psoriasis. Br J Dermatol 129:514–520, 1993 Livden JK, Nilsen R, Bjerke JR, Matre R: In situ localization of interferons in psoriatic lesions. Arch Dermatol Res 281:392–397, 1989 Ma X, Aste-Amezaga M, Gri G, Gerosa F, Trinchieri G: Immunomodulatory functions and molecular regulation of IL-12. In: Adorini L (eds). IL-12. Chem Immunol, Vol. 68, Basel: Karger, 1997, pp 1–22 Menssen A, Trommler P, Vollmer S, et al: Evidence for an antigen-specific cellular immune response in skin lesions of patients with psoriasis vulgaris J Immunol 155:4078– 4083, 1995 Norris DA, Travers JB, Leung DYM: Lymphocyte activation in the pathogenesis of Psoriasis. J Invest Dermatol 109:1–3, 1997 Presky DH, Minetti LJ, Gillessen S, et al: Analysis of the multiple interactions between IL-12 and the high affinity IL-12 receptor complex. J Immunol 160:2174–2179, 1998 Schlaak JF, Buslau M, Jochum W, et al: T cells involved in psoriasis belong to the Thelper 1 subset. J Invest Dermatol 102:145–149, 1994 Schwaller J, Tobler A, Niklaus G, Hurwitz N, Hennig I, Fey MF, Borisch B: Interleukin12 expression in human lymphomas and nonneoplastic lymphoid disorders. Blood 85:2182–2188, 1995 Shu U, Kiniwa M, Wu CY, et al: Activated T cells induce interleukin-12 production by monocytes via CD4O–CD40 ligand interaction. Eur J Immunol 25:1125–1128, 1995 Sigmundsdottir H, Sigurgeirsson B, Troye-Blomberg M, Good MF, Valdimarsson H, Jonsdottir I: Circulating T cells of patients with active psoriasis respond to streptococcal M-peptides sharing sequences with human epidermal keratins. Scand J Immunol 45:688–697, 1997 Trinchieri G: Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annu Rev Immunol 13:251–276, 1995 Turka LA, Goodman RE, Rutkowski JL, et al: Interleukin 12: a potential link between nerve cells and the immune response in inflammatory disorders. Mol Med 1:690– 699, 1995 Uyemura K, Yamamamura M, Fiveson DF, Modlin RL, Nickoloff BJ: The cytokine network in lesional and lesion-free psoriatic skin is characterized by a T-helper type 1 cell-mediated response. J Invest Dermatol 101:701–705, 1993 Valdimarsson H, Baker BS, Jonsdottri I, Powles A, Fry L: Psoriasis: A T-cell mediated autoimmune disease induced by streptococcal superantigens? Immunol Today 16:145– 149, 1995 Van de Kerkhof PCM, Gerritsen MJP, de Jong EMGJ: Transition from symptomless to lesional psoriatic skin. Clin Exp Dermatol 21:325–329, 1996 Van Noorden S: Tissue preperation and immunostaining techniques for light microscopy. In: Polak MJ, Van Noorden S (eds). Immunocytochemistry, Modern Methods and Applications. Bristol: John Wright, 1986, pp. 26–53 Vollmer S, Menssen A, Trommler P, Schendel D, Prinz JCT: lymphocytes derived from skin lesions of patients with psoriasis vulgaris express a novel cytokine pattern that is distinct from that of T helper type 1 and T helper type 2 cells. Eur J Immunol 24:2377–2382, 1994 Yawalkar N, Limat A, Brand CU, Braathen LR: Constitutive expression of both subunits of interleukin-12 in human keratinocytes. J Invest Dermatol 106:80–83, 1996