Expression of long pentraxin PTX3 in human adipose tissue and its relation with cardiovascular risk factors

Atherosclerosis 202 (2009) 455–460

Expression of long pentraxin PTX3 in human adipose tissue and its relation with cardiovascular risk factors L. Alberti a , L. Gilardini a , A. Zulian a , G. Micheletto b , G. Peri c , A. Doni c , A. Mantovani c , C. Invitti a,∗ a

Unit of Metabolic Diseases and Diabetes, Istituto Auxologico Italiano, Via Ariosto 13, 20145 Milan, Italy b Department of Surgical Science, University of Milan, Italy c Research Laboratory in Immunology and Inflammation, Istituto Clinico Humanitas, Milan, Italy

Received 18 January 2008; received in revised form 15 April 2008; accepted 7 May 2008 Available online 15 May 2008

Abstract Pentraxin 3 (PTX3) is an acute phase protein strongly expressed by advanced atherosclerotic lesions. We investigated (a) PTX3 expression and secretion in subcutaneous adipose tissue (SAT) and omental visceral adipose tissue (VAT) obtained from 21 obese (37.4 ± 8.15 yr) and 10 normal weight subjects (43.7 ± 11.07 yr) and (b) the relationships of adipose PTX3 with tumour necrosis factor ␣ (TNF␣) and adiponectin expression and with cardiometabolic risk factors. Real-time PCR was used to quantify specific mRNA for PTX3, CD68 (macrophage marker), TNF␣ and adiponectin. Fresh adipose tissue was cultured and PTX3 measured in the medium. Serum insulin, glucose, HDL and LDL cholesterol, triglycerides, C-reactive protein (CRP), fibrinogen, adiponectin, TNF␣ and PTX3 were measured. PTX3 expression was similar in the two fat compartments and tended to be higher in obese than in normal weight subjects in VAT only (p = 0.05). CD68 and PTX3 expressions were correlated with each other in SAT but not in VAT. After adjustment for age and sex, VAT-PTX3 expression and release were correlated with VAT-TNF␣ expression (p < 0.01 for both) and with LDL/HDL ratio (p < 0.01 and p < 0.001). VAT-PTX3 expression was also correlated with BMI, triglycerides, CRP, fibrinogen and adiponectin (p < 0.05 for all). In the multivariate analysis with VAT-PTX3 RNA levels as dependent variable, LDL/HDL ratio and fibrinogen remained independently associated with VAT-PTX3 expression (p < 0.01 for both). These associations were not seen within SAT. Conclusions: Human adipose tissue expresses and releases PTX3 likely under TNF␣ control. VAT production of PTX3 seems to contribute to the mechanisms underlying the development of atherosclerosis. © 2008 Elsevier Ireland Ltd. All rights reserved. Keywords: Adipose tissue; PTX3; HDL; Fibrinogen; Adiponectin

1. Introduction It is well established that a chronic low-grade inflammation has an important role in the pathogenesis of metabolic and vascular diseases [1,2]. An expansion of adipose tissue appears to contribute to this subclinical inflammation due to the ability of adipose tissue to synthesize and release a variety of pro-/anti-inflammatory molecules through ∗

Corresponding author. Tel.: +39 02619112535; fax: +39 02619112541. E-mail address: [email protected] (C. Invitti).

0021-9150/$ – see front matter © 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.atherosclerosis.2008.05.015

autocrine, paracrine or endocrine effects on distal tissues [1,2]. Although the mechanism underlying this process is not completely understood, it is known that within adipose tissue different cells such as adipocytes, preadipocytes and macrophages may produce and secrete pro- and antiinflammatory proteins. Among the inflammatory proteins that have been found to be expressed by the adipose tissue, is included the Creactive protein (CRP) that belongs to the family of short pentraxins. Pentraxin 3 (PTX3) is a member of long form of pentraxin proteins, which shares a structural and functional

456

L. Alberti et al. / Atherosclerosis 202 (2009) 455–460

homology with CRP and is strongly expressed by advanced atherosclerotic lesions suggesting that it may contribute to the pathogenesis of atherosclerosis. Unlike CRP, which is mostly produced by liver, PTX3 is expressed by several cell types most prominently mononuclear cells at the site of inflammation [3]. PTX3 has been shown to be expressed and secreted only under tumour necrosis factor ␣ (TNF␣) exposure in rodent adipocytes, and to be more expressed in genetically obese or diabetic than in wild type animals [4]. The information on the possible expression of PTX3 in human adipose tissue is scarce. The only report on this issue described that PTX3 is more expressed in the subcutaneous adipose tissue (SAT) of patients with high than in those with low LDL cholesterol levels (5) supporting again a potential contribution of an inflamed adipose tissue to the pathogenesis of coronary artery disease. From the above, it should be interesting to deepen what are the relations between PTX3 produced in different adipose tissue compartments and several cardiometabolic risk factors. PTX3 interacts with several ligands, including extra cellular matrix and complement components, pathogens and growth factors, playing a role in the activation or inhibition of their biological activity [6,7]. In this context, PTX3 has been shown to bind the complement fraction C1q that is homologous to adiponectin structure, suggesting for PTX3 a possible buffering effect on the anti-inflammatory, anti-atherogenic and anti-diabetic properties of adiponectin [8,9]. To clarify the role of PTX3 in human adipose tissue, we investigated PTX3 expression and secretion in VAT and SAT of obese and normal weight subjects. In addition, we analysed the relationships of adipose tissue PTX3 mRNA levels and protein secretion with TNF␣ and adiponectin expression and with cardiometabolic risk factors.

2. Methods 2.1. Experimental subjects Samples of SAT and VAT were obtained during abdominal surgery for gastric banding or non-inflammatory pathologies such as ventral hernia, cholelithiasis and abdominal adhesions in 31 obese and 15 normal weight subjects. Fifteen of them were excluded due to a leukocytes count >10000 109 /L. Twenty-one obese and 10 normal weight subjects were enrolled in the study. Six obese subjects were on antihypertensive treatment and two on metformin for type 2 diabetes. A fasting morning blood sample was obtained from all patients for the measurement of insulin, glucose, HDL cholesterol, triglycerides, leukocytes, CRP, fibrinogen, adiponectin, TNF␣ and PTX3. Insulin resistance was estimated using the homeostasis model assessment insulin resistance (HOMA-IR: fasting insulin × fasting glucose/22.5).

The study was approved by the Ethics Committee of the Istituto Auxologico Italiano and written consent for the study was obtained from each patient. 2.2. RNA analysis of SAT and VAT Approximately 500 mg of SAT and VAT fragments was surgically obtained. After removal of blood and visible blood vessels, tissue fragment was frozen in liquid nitrogen and stored before RNA isolation. Total RNA from 100 mg of adipose tissue samples was obtained using minicolumn purification procedure (RNeasy Mini Kit, Qiagen, GmbH. D-40724 Hilden) according to manufacturer’s procedures. Concentration and quality of total RNA were evaluated by spectrophotometric determination and integrity by agarose gel analysis. From 1 ␮g of total RNA, cDNAs were reverse-transcribed with Superscript III (Invitrogen, Carlsbad, CA). Real-time PCR was used to quantify specific mRNA. For each sample, 10 ng of template was amplified in triplicate in PCR reactions on an ABI PRISM 7700 machine using Assayon-Demand Gene Expression Products (Applied Biosystems, Foster City, US). TaqMan probes (Applied Biosystems) for PTX3, TNF␣, CD68, adiponectin and the housekeeping gene ␤-glucuronidase (GUSB) mRNA were labeled with carboxyfluorescein. Analyses were performed with SDS 3 software (Applied Biosystems). The relative amount of the mRNA of interest was normalized to the amount of GUSB transcript in the samples, and data were expressed as 2−ΔCT . 2.3. RNA analysis of adipocytes ad preadipocytes cells Immediately after removal, 300 mg of SAT and VAT were minced and digested for 3 h at 37 ◦ C in presence of 150 U/ml of collagenase II. After digestion, samples were passed through a 100 ␮m Nylon membrane (BD Bioscience 1 Becton Drive Franklin Lakes, US) to collect isolated adipocytes and preadipocytes. Recovered filtrates were centrifuged at 500 × g per 10 , subsequently floating adipocytes were collected, whereas pellets containing preadipocytes were resuspended and one more time filtered with 40 ␮m Nylon membrane to eliminate all adipocytes. Adipocytes were harvested immediately in Trizol (Invitrogen Corporation, Jefferson City, US) and RNA extracted according to manufacturer’s protocol. Preadipocytes were cultured in Dulbecco’s modified eagle’s medium/F10 1:1 (Invitrogen Corporation, Jefferson City, US), 10% FBS, Hepes 15 mM (Sigma, St. Louis, US), Biotin 33 ␮M (Sigma, St. Louis, US), until 70% confluence before Trizol extraction. Three micrograms of total RNA were reverse-transcribed with M-MLV Reverse Transcriptase (Promega, Promega Corporation, Madison, WI, US) and the polymerase chain reaction was performed using the following primer human sequences: PTX3 F aatgcatctccttgcgattc; PTX3 R tgaagtgcttgtcccattcc; Adiponectin F tcggactttttccaaactgg, Adiponectin R cagtacagccgccttctagg,

L. Alberti et al. / Atherosclerosis 202 (2009) 455–460

457

Actin F cactcttccagccttccttcc; Actin R cggactcgtcatactcctgct; CD90 Fgacccgtgagacaaagaagc R ccagtcacagggacatgaaa.

ture medium to investigate the associations between PTX3 expression in the two fat depots and adiponectin release.

2.4. Biochemical measurements

2.7. Statistical analysis

Circulating levels of glucose, cholesterol, triglycerides and leukocytes were measured using an automated analyser (Roche Diagnostic, Manheim, Germany). Insulin was measured by chemiluminescent immunometric assay (Diagnostic Products Corporation, Los Angeles, US) with a sensitivity of 2 ␮U/ml and intra-assay and inter-assay coefficients of variation of 3.3% and 4.1%, respectively. CRP was determined using immunoturbidimetric assay (Roche Diagnostic, Manheim, Germany) with a sensitivity of 0.042 mg/dl and intra-assay and inter-assay coefficients of variation for a value of 0.33 mg/L of 2.5% and 4.6%, respectively. Fibrinogen was measured in citrate plasma with a clotrate assay using the ACL 200/IL instrument (Instrumentation Laboratory, Milan, Italy). Adiponectin was determined by an enzyme-linked immunosorbent assay (B- Bridge International Inc., San Jose, CA, US) with a sensitivity of 0.37 ng/ml and intra-assay and inter-assay coefficients of variation of 3.3% and 7.4%, respectively. PTX3 was determined using a sandwich ELISA as previously described [10].

Variables that were not normally distributed were log transformed. To examine the differences between subjects, a two samples t-test was used. Pearson correlation analysis was used to analyse bivariate relationships. Multiple regression analysis was performed using variables statistically significant at the 5% level in univariate analysis. Data were expressed as mean ± S.D. A p value <0.05 was considered statistically significant. All analyses were performed using SPSS version 14.01 (Statistical Package for Social Science Inc., Chicago, US).

3. Results Clinical and biochemical characteristics of subjects participating in the study are shown in Table 1. Obese subjects were younger and had a higher proportion of women than normal weight subjects. Fasting glucose and insulin, triglycerides and inflammatory markers were higher in obese than in normal weight subjects. 3.1. PTX3 expression in isolated human adipocytes and preadipocytes

2.5. Measurement of PTX3 interaction with adiponectin Binding of PTX3 to adiponectin was performed essentially as previously described [11]. Briefly, 96-well plates (Nunc, Roskilde, Denmark) were coated overnight with 1–10 ␮g of purified adiponectin (human adiponectin recombinant protein, BioVendor, Heidelberg, Germany) and blocked with 0.5% dry milk in PBS (2 h at room temperature) before incubation (30 min at 37 ◦ C) with 100 ␮l of biotin-conjugated PTX3 (50–100 nM considering a molecular weight of 45 kDa for the PTX3 monomer) in PBS containing 0.05% Tween 20 (PBST). After washing, plates were incubated with HRP-labeled avidin (Bio-spa, Milan, Italy), and absorbance values were read at 405 nm after addition of the chromogen substrate ABTS (Kirkegaard and Perry, Gaithersburg, MD). 2.6. Adipose tissue release of PTX3 To demonstrate that the presence of the PTX3 mRNA is followed by an effective protein production, we measured the 24 h PTX3 release from 10 samples of adipose tissue. About 2 g of fresh adipose tissue were minced, harvested in 2 ml of Dulbecco modified eagle medium/F12 1:1 and placed for 24 h at 37 ◦ C in 5% CO2 . After this time, the medium was recovered for the determination of PTX3 concentrations. Values were normalized for DNA content. Adiponectin concentrations were also measured in the cul-

To assess the expression of PTX3 mRNA in adipose tissue, we performed RT-PCR on isolated adipocytes and preadipocytes derived from SAT and VAT of three obese (47.0 ± 4.2 yr, BMI 40.7 ± 0.35 kg/m2 , males) and three normal weight subjects (42.0 ± 4.2 yr, BMI 23.1 ± .2.3 kg/m2 ). Table 1 Clinical and biochemical characteristics of 31 subjects participating in the study

Age (years) Sex (%F) Weight (kg) Height (cm) BMI (kg/m2 ) Systolic BP (mmHg) Diastolic BP (mmHg) Fasting glucose (mg/dl) Fasting insulin (␮U/ml) HDL cholesterol (mg/dl) LDL cholesterol (mg/dl) LDL/HDL ratio Triglycerides (mg/dl) Fibrinogen (mg/dl) CRP (mg/dl) Leukocytes (109 /L)

Obese subjects n = 21

Normal weight subjects n = 10

p

37.4 ± 8.15 69% 107.2 ± 15.38 165.7 ± 7.62 38.8 ± 4.48 126.4 ± 13.73 77.5 ± 6.3 97.2 ± 19.85 20.2 ± 26.67 47.5 ± 12.86 143.1 ± 39.16 3.1 ± 0.9 161.2 ± 65.63 341.3 ± 89.47 3.3 ± 4.71 8.0 ± 1.43

43.7 ± 11.07 20% 69.8 ± 5.80 172.3 ± 6.21 23.8 ± 1.69 118.0 ± 10.02 73.5 ± 7.47 85.5 ± 8.28 7.5 ± 5.52 49.8 ± 13.21 126.8 ± 41.04 2.7 ± 1.2 94.2 ± 27.73 252.2 ± 37.45 0.1 ± 0.14 5.8 ± 1.03

0.05 0.01 0.0001 0.01 0.0001 0.05 NS 0.05 0.05 NS NS NS 0.01 0.01 0.05 0.0001

Data are expressed as mean ±S.D., percentage; BP: blood pressure; CRP: C-reactive protein.

458

L. Alberti et al. / Atherosclerosis 202 (2009) 455–460

Fig. 1. RT-PCR (reverse transcription PCR) of PTX3, adiponectin, CD90 [25] and actin on mRNA of preadipocytes (panel A) and adipocytes (panel B) obtained from subcutaneous (S) and omental (V) adipose tissue of obese and normal weight subjects. mRNA levels were normalized for actin expression. RT-PCR of adiponectin and CD90 were performed to control the quality of adipocytes and preadipocyte separation, respectively.

As shown in Fig. 1, PTX3 was expressed in preadipocytes and at lower levels in adipocytes. There were no evident differences between obese and normal weight subjects and between SAT and VAT. 3.2. PTX3 and CD68 expression in whole adipose tissue Macrophages may express PTX3 and are adipose tissue components, thus we investigated the contribution of macrophages in adipose tissue PTX3 expression by analysing the expression of a specific macrophage marker, the CD68. In the whole group of subjects, CD68 was more expressed in VAT than in SAT (relative expression 6.7 ± 6.8 vs 4.5 ± 5.3, p < 0.05). This finding was also true within the group of obese and normal weight subjects. CD68 was more expressed in obese than in normal weight subjects (relative expression 5.9 ± 5.8 vs 1.7 ± 1.4, p < 0.05 in SAT and 8.2 ± 7.95 vs 4.6 ± 1.55, p = 0.06 in VAT). Accordingly, CD68 expression was correlated with BMI in both tissue compartments (r = 0.545 p < 0.01 in SAT and r = 0.421, p < 0.05 in VAT). PTX3 expression did not follow the pattern of CD68 as it was similar in SAT and VAT in the whole group of subjects as well as in the two groups separately and tended to be higher in obese than in normal weight subjects in VAT only (relative expression 0.12 ± 0.22 vs 0.09 ± 0.13, p = 0.05). PTX3 expression was correlated with CD68 expression in SAT (r = 0.372, p < 0.001) but not in VAT. No sex-related differences were noted in PTX3 expression.

3.3. Relationships between adipose PTX3 and cardiometabolic risk factors In the whole group of obese and normal weight subjects, adipose PTX3 expression was correlated with that of TNF␣ (r = 0.537 p < 0.01 in VAT and r = 0.491 p < 0.01 in SAT). VAT-TNF␣ expression was also correlated with PTX3 release from VAT (r = 0.773, p < 0.01) while this relation was absent in SAT. PTX3 expression was not associated with that of adiponectin in both fat compartments. VAT-PTX3 expression was negatively, though not significantly related to adiponectin release from VAT (r = −0.307, NS). This inverse relation was absent in SAT. After adjustment for age and sex, PTX3 expression in VAT was correlated with BMI and HDL cholesterol (HDL), LDL/HDL ratio, triglycerides, CRP, fibrinogen and

Table 2 Univariate correlations of PTX3 expression in VAT with cardiometabolic risk factors

HDL cholesterol LDL/HDL ratio log-triglycerides log-C-reactive protein Fibrinogen Adiponectin BMI

r

p

−0.521 0.471 0.420 0.475 0.446 −0.451 0.365

0.01 0.01 0.05 0.05 0.05 0.05 0.05

L. Alberti et al. / Atherosclerosis 202 (2009) 455–460

Fig. 2. Dose-related binding of PTX3 to adiponectin. C1q (homologous to adiponectin structure) was used as positive control. Results are expressed as optical density (OD) at 450 nm and are representative of one out of three experiments performed.

adiponectin but not with LDL cholesterol, fasting glucose and insulin and blood pressure (Table 2). HDL levels were correlated with VAT-TNF␣ expression (r = −0.383, p < 0.05) and serum adiponectin (r = 0.418, p < 0.05). In a multivariate analysis with VAT-PTX3 RNA levels as dependent variable and VAT-TNF␣ expression, BMI, sex, age, HDL, triglycerides, adiponectin, CRP and fibrinogen as independent variables, HDL and fibrinogen remained independently related to VAT-PTX3 expression (β = −0.701, p < 0.01 and β = 0.616, p < 0.01, respectively). The same results were obtained when entering LDL/HDL ratio instead of HDL among the independent variables (β = 0.521, p < 0.05). After adjustment for BMI and age, subjects with low HDL showed higher VAT-PTX3 expression than those with normal HDL values (relative expression 0.60 ± 0.25 vs 0.04 ± 0.03, p < 0.05). This difference was absent in SAT. The in vitro binding experiment performed to investigate if PTX3 is able to buffer adiponectin effects, did not demonstrate a physical interaction between the two proteins (Fig. 2).

4. Discussion In the present paper, we demonstrated that (a) PTX3 is expressed by human preadipocytes and mature adipocytes in VAT and in SAT, (b) in VAT, PTX3 expression is largely independent of macrophage infiltration that, on the contrary, seems to contribute substantially to the PTX3 expression in SAT, (c) in whole VAT, PTX3 expression and release are directly related to TNF␣ expression in the same tissue, (d) in VAT only, PTX3 expression is associated with obesity and with several cardiovascular risk factors and is significantly higher in subjects with low HDL values than in those with normal levels, (e) PTX3 does not impair adiponectin effects

459

though its VAT expression has a negative association with serum adiponectin levels. This is the first report demonstrating that human adipocytes from different tissue compartments are able to express a long pentraxin. The results of this study suggest that PTX3 production is regulated in human adipose tissue as in mice 3T3-F442A adipocytes where PTX3 gene expression and protein secretion are induced upon exposure to TNF␣ in a dose-dependent manner [4]. Human adipose tissue is well known to produce several adipokines promoting the development of atherosclerosis and cardiovascular diseases. The main responsible component of the adipose tissue seems to be macrophages recruited in response to the enlargement of adipocytes [12]. However, some evidences suggest that isolated adipocytes may produce atherogenic proteins such as TNF␣, MCP-1, IL-6, IL-8 [13]. Our results increase the evidence that adipocytes themselves, besides macrophages, may secrete inflammatory proteins. In particular, VAT adipocytes appeared to contribute to PTX3 production more than SAT adipocytes because, in VAT, differently from what was observed in SAT, PTX3 mRNA levels were not correlated with macrophage infiltration. In VAT the relation between macrophage infiltration and PTX3 expression might have been hidden by the contribution of different cells in expressing PTX3. A further demonstration that PTX3 is not exclusively produced by macrophages comes from the evidence that PTX3 and CD68 follow different patterns of expression in the two adipose tissue compartments. In particular, in obese compared to normal weight subjects the expression of CD68 was higher in both fat compartments while that of PTX3 was higher in VAT only. Supporting the concept that VAT depot is more proinflammatory than SAT depot [14], in the present study PTX3 expression was associated with atherogenic factors exclusively in VAT. In agreement with what was reported in mice [4], whole VAT expression of PTX3 was related to BMI and tended to be higher in obese than in normal weight subjects. This finding is also in accord with the demonstration that the short pentraxin, CRP is more expressed in adipose tissue from obese than from lean subjects [15]. Obesity however, exhibited a lower correlation with VAT-PTX3 expression than lipids, CRP, fibrinogen and adiponectin all of which are involved in the promotion of atherosclerosis. In particular, VAT-PTX3 expression was negatively and independently related to HDL that is strongly inversely associated with the risk of coronary heart diseases [16]. HDL has well-known anti-atherogenic properties that have been largely ascribed to its role on reverse cholesterol transport, but it is also thought to inhibit LDL oxidation, improve endothelial function and have antithrombotic and anti-inflammatory effects [17]. Human adipocytes possess HDL receptors whose binding is inhibited by LDL cholesterol [18]. It is therefore conceivable that high HDL or low LDL/HDL values negatively influence PTX3 expression in adipose tissue. Relationships between cholesterol and PTX3 expression have been shown in other tissues such as human primary smooth

460

L. Alberti et al. / Atherosclerosis 202 (2009) 455–460

muscle cells where oxidized LDL induce a dose- and timedependent expression of PTX3 [19]. Moreover, in human endothelial cells, both a statin and adiponectin inhibit resistininduced expression of adhesion molecules and PTX3 [20]. Another indirect proof of the possible interrelation between cholesterol and adipose PTX3 is the demonstration that subjects with high LDL cholesterol have higher SAT PTX3 expression compared to those with normal LDL values [5]. Alternatively, the negative (not significant) association observed between VAT-PTX3 expression and adiponectin release from VAT, might suggest that the inverse correlation of VAT-PTX3 expression with HDL reflects a local inhibitory effect of PTX3 on the secretion of adiponectin, which in turn may influence plasma lipoprotein levels by altering levels and activity of key enzymes responsible for the catabolism of triglyceride-rich lipoproteins and HDL [21]. On the contrary, the hypothesized effect of PTX3 in sequestrating adiponectin is excluded by our results. In this study, VAT-PTX3 expression was also positively and independently related to another well-know risk factor for cardiovascular diseases such as fibrinogen, which is considered a possible mediator of the effects of traditional and non-traditional (CRP) risk factors for cardiovascular diseases [22,23]. We have no clear explanation for this finding that however, might suggest that the thrombogenic effect of PTX3 which has been shown to potentiate the tissue factor expression in monocytes and endothelial cells goes beyond this effect [24]. In conclusion, we demonstrated that human adipose tissue expresses and releases PTX3 likely under TNF␣ control, and that VAT-PTX3 expression is strongly and independently related to HDL and fibrinogen. These results add other elements for the mechanisms underlying the role of PTX3 in the development of atherosclerosis. Further investigation is needed to understand the involvement of adipose PTX3 in promoting cardiovascular diseases. References [1] Goossens GH. The role of adipose tissue dysfunction in the pathogenesis of obesity-related insulin resistance. Physiol Behav 2008;94:206– 18. [2] Tilg H, Moschen AR. Adipocytokines: mediators linking adipose tissue, inflammation and immunity. Nat Rev Immunol 2006;10: 772–83. [3] Presta M, Camozzi M, Salvatori G, Rusnati M. Role of the soluble pattern recognition receptor PTX3 in vascular biology. J Cell Mol Med 2007;11:723–8. [4] Abderrahim-Ferkoune A, Bezy O, Chiellini C, et al. Characterization of the long pentraxin PTX3 as a TNF␣-induced secreted protein of adipose cells. J Lipid Res 2003;44:994–1000. [5] Bosutti A, Grassi G, Zanetti M, et al. Relation between the plasma levels of LDL-cholesterol and the expression of the early marker of inflammation long pentraxin PTX3 and the stress response gene p66(ShcA) in pacemaker-implanted patients. Clin Exp Med 2007;7:16–23.

[6] Rusnati M, Camozzi M, Moroni E, et al. Selective recognition of fibroblast growth factor-2 by the long pentraxin PTX3 inhibits angiogenesis. Blood 2004;104:92–9. [7] Mantovani A, Garlanda C, Doni A, Bottazzi B. Pentraxins in innate immunity: from C-reactive protein to the long pentraxin PTX3. J Clin Immunol 2008;28:1–13. [8] Bottazzi B, Vouret-Craviari V, Bastone A, et al. Multimer formation and ligand recognition by the long pentraxin PTX3. Similarities and differences with the short pentraxins C-reactive protein and serum amyloid P component. J Biol Chem 1997;272:32817–23. [9] Berg AH, Combs TP, Scherer PE. ACRP30/adiponectin: an adipokine regulating glucose and lipid metabolism. Trends Endocrinol Metab 2002;13:84–9. [10] Muller B, Peri G, Doni A, et al. Circulating levels of the long pentraxin PTX3 correlate with severity of infection in critically ill patients. Crit Care Med 2001;29:1404–7. [11] Jeannin P, Bottazzi B, Sironi M, et al. Complexity and complementarity of outer membrane protein A recognition by cellular and humoral innate immunity receptors. Immunity 2005;22:551–60. [12] Weisberg SP, McCann D, Desai M, et al. Obesity is associated with macrophage accumulation in adipose tissue. J Clin Invest 2003;112:1796–808. [13] Bruun JM, Lihn AS, Pedersen SB, Richelsen B. Monocyte chemoattractant protein-1 release is higher in visceral than subcutaneous human adipose tissue (AT): implication of macrophages resident in the AT. J Clin Endocrinol Metab 2005;90:2282–9. [14] Harman-Boehm I, Bluher M, Redel H, et al. Macrophage infiltration into omental versus subcutaneous fat across different populations: effect of regional adiposity and the comorbidities of obesity. J Clin Endocrinol Metab 2007;92:2240–7. [15] Anty R, Bekri S, Luciani N, et al. The inflammatory C-reactive protein is increased in both liver and adipose tissue in severely obese patients independently from metabolic syndrome, type 2 diabetes, and NASH. Am J Gastroenterol 2006;101:1824–33. [16] Barter PJ, Puranik R, Rye KA. New insights into the role of HDL as an anti-inflammatory agent in the prevention of cardiovascular disease. Curr Cardiol Rep 2007;9:493–8. [17] Link JJ, Rohatgi A, de Lemos JA. HDL cholesterol: physiology, pathophysiology. Curr Probl Cardiol 2007;32:268–314. [18] Fong BS, Rodrigues PO, Salter AM, et al. Characterization of high density lipoprotein binding to human adipocyte plasma membranes. J Clin Invest 1985;75:1804–12. [19] Klouche M, Peri G, Knabbe C, et al. Modified atherogenic lipoproteins induce expression of pentraxin-3 by human vascular smooth muscle cells. Atherosclerosis 2004;175:221–8. [20] Kawanami D, Maemura K, Takeda N, et al. Direct reciprocal effects of resistin and adiponectin on vascular endothelial cells: a new insight into adipocytokine-endothelial cell interactions. Biochem Biophys Res Commun 2004;314:415–9. [21] Lara-Castro C, Fu Y, Chung BH, Garvey WT. Adiponectin and the metabolic syndrome: mechanisms mediating risk for metabolic and cardiovascular disease. Curr Opin Lipidol 2007;18:263–70. [22] Kannel WB. Overview of hemostatic factors involved in atherosclerotic cardiovascular disease. Lipids 2005;40:1215–20. [23] Kaptoge S, Kaptoge S, White IR, et al. 07 Associations of plasma fibrinogen levels with established cardiovascular disease risk factors, inflammatory markers, and other characteristics: individual participant meta-analysis of 154,211 adults in 31 prospective studies. Am J Epidemiol 2007;166:867–9. [24] Napoleone E, di Santo A, Peri G, et al. The long pentraxin PTX3 upregulates tissue factor in activated monocytes: another link between inflammation and clotting activation. J Leukoc Biol 2004;76:203–9. [25] Strem BM, Hicok KC, Zhu M, et al. Multipotential differentiation of adipose tissue-derived stem cells. Keio J Med 2005;54(3):132–41.