macrophages with HIV

Res. Viroi. 1993, 144, 35-40

~) INSTITUTPASTEUR/ELSEVIER Paris 1993

Expression of macrophage products after in vitro infection of human monocytes/macrophages with HIV W. Glienke (1), H. von Briesen (1), R. Esser (1, 2), S. MOiler (l, 2), R. Andreesen (2) and H. Riibsamen-Waigmann (1) a) Georg.Speyer.HaUcS]

Chemotherapeutisches Forschungsinstitut, Frankfurt am Main (Germany), and Medizinische Klinik der Universitiit Regensburg (Germany)

SUMMARY We studied the response of monocyteslmacrophages {MOIMAC) to lipopolysaccharide (LPS) and interferon-T (IFNT) stimulation with respect to the expression of macrophage-specific products, i.e. macrophage-colony-stimulating factor (M-CSFI, c-fms, c-sis, tissue factors, transforming growth factor-~ |TGF~) and interleukin-8 {IL8} after in vitro infection with HIV. The expression of IL8 was strongly elevated in HIVinfected cells, peaking at 4 h after stimulation with LPS. At that time, the uninfected control showed only weak expression of ILS. Other products, e.g. tissue factor, c-fms, M-CSF and TGFI3 were not modulated after stimulation. In contrast to IL8, the expression of c-sis was significantly lower in infected cells after stimulation with IFN~. compared to uninfected control cells. Key-words: HIV, Monocyte, Macrophage, Cytokine; IFN, LPS, Expression, IL8,

mRNA.

INTRODUCTION M o n o c y t e s / m a c r o p h a g e s ( M O / M A C ) are primary targets for HIV (Gartner et al., 1986) and likely the first cells infected with HIV causing neurologicai disorders in AIDS patients (Koenig et al., 1986). In vitro cultures offer the opportunity to study the interaction of M O / M A C with HIV. M O / M A C cultures infected with HIV1 m mn produce virus over a long period of time (von Briesen et al., 1990). In this study, a variety of genes was studied for altered expression in M O / M A C after HIV infection. These genes were chosen for their potential involvement in HIV-induced pathogenesis. Tissue factor is a transmembrane high-affinity receptor initiating the extrinsic coagulation pathway and modulating the extracellular environment (Niemetz, 1972). An alteration in this function in AIDS patients was described

Received October II, 1992.

previously (Lathey et aL, 1990). MO/MAC are important paracrine sources of growth factors during tissue repair in vivo. Platelet-derived growth factor (PDGF) coded by the proto-oncogene c-sis plays a potential role in wound healing and chronic inflammatory response CRoss, 1989). TGF~ is a peptide with the ability to stimulate and inhibit the proliferation of cells in culture (Assoian et al., 1987). Increased TGF~ expression in PBMC from HIV-infected donors was described previously (Kekow etal., 1991). M-CSF increases the survival of monocytes and supports the induction of differentiation into macrophages (Becker et al., 1987). Decreased M-CSF secretion of HIV-infected monocytes had been described (Esser et al., 1991). The M-CSF receptor, a receptor with tyrosine kinase activity, is coded by c-fms (Sherr et al., 1985). Interleukin-8 (IL8) is a protein with several mature forms. One function is to

36

W. G L I E N K E E T A L .

attract emigration of neutrophils from the blood to the tissue compartment. The accumulation of neutrophils is believed to be an important pathogenic event in the lung (Baggiolini et al., 1989).

MATERIALS AND METHODS Virus

For preparing stock virus, human monocytes were infected with the monocytotropic isolate HIVID~7m (Rtibsamen-Waigmann et al., 1989). After 14-21 days of infection, supernatants from these cultures were examined for HIV by reverse transcriptase (RT) assay (RfibsamenWaigmann et al., 1986). Supernatants from uninfected macrophages were also prepared for mock infection. The supernatants were centrifuged at 1,400 g for 10 min and frozen as aliquots at - 8 0 ° C until further use. Preparation and cultivation o f human M O / M A C

Human mononuclear cells (MNC) from HIVseronegative donors were prepared by separation on a Ficoll gradient ; 3 x 106 cells/ml were seeded into 50 mi flasks (Greiner, Germany) in RPMI-1640 supplemented with 5x 10 -5 M 2-mercaptoethanol, 100 U/ml penicillin, 100mg/ml streptomycin, 2 x l 0 - S M L-glutamine, 1 x l0 -5 M sodium pyruvate and 5 % pooled human AB serum. On day l after isolation, the cells were infected with HIV or mock-infected, respectively. On day 3, nonadherent cells were washed off. The virus production of these cultures was monitored by RT assay. Fourteen days after infection, MO/MAC were stimulated with 100 ng/ml LPS (from Salmonella abortus equi, kindly provided by Dr. C. Galanos, Freiburg, Germany) or 200 U/ml r-interferon-3, (rIFN~,) (Thomae, Biberach/Riss, Germany). Unstimulated MO/MAC were cultured with fresh supplemented RPMI medium for 6 h. R N A analysis and hybridization probes

Total cellular RNA was obtained by 4 M guanidine isothiocyanate lysis and 5.7 M CsC1 gradien t centrifugation in a modification of the procedure described previously (Chirgwin et al., 1979). Twenty micrograms of total RNA were fractionated by electrophoresis on a formaldehyde 1.2 % agarose gel and blotted onto an "ImmobilonN" membrane (Millipore, Eschbom, Germany). Blots were prehybridized overnight and then hybridized with 32p-labelled probes in 50 % formamide, 6 x S S P E , 5xDenhardt's solution, 100 ~g/ml denatured herring sperm DNA and 10 % (w/v) dextran sulphate. The blots

CSF IFN IL LPS MNC

= colony-stimulatingfactor. = =

interferon. interleukin. = lipopolysaccharide.

= mononuclear ceil.

were washed under the following conditions: 2 x 20 min, IxSSPE, 0.1xSDS, 25"C; 2x20min, 0.1xSSPE, 0.1xSDS, 55°C after hybridizing with cDNA or 2 x 2 0 m i n , 5xSSPE, 0.1xSDS, 25°C; 2 x 2 0 m i n , 2xSSPE, 0.1 xSDS, 50"C after hybridizing with oligonucleotides. The blots were then dried and exposed to "Hyperfilm-MP" (Amersham, Sweden) with an intensifying screen at -70°C. For reprobing, the blots were washed at 90°C in Tris EDTA pH 6 for 15 min. The probes used in this study were: a) tissue factor 641 bp EcoRI fragment from lambda CF2 plasmid provided by Dr. Edgington, Department of Immunology, La Jolla, CA, USA; b) c-sis 2.6-kb XhoI fragment from pSl-plasmid (ATCC no. 57050, Rockville, MD, USA; c) TGF[3 oligonucleotide CCGACCTTCACCTAGGTGCTCGGGTTCCCGATGG TACGGTTGAAG ; d) M-CSF oligonucleotide CCCAAT CATGTGGCTACAGTACTCCGACACCTCCTC; e) c-fms 1.23-kb EcoRI fragment from pcfms 104 (ATCC no. 59292, Rockville, MD, USA; 0 IL8-plasmid kindly provided by Dr. Lindley, Sandoz, Austria; g) [3-actin oligonucleotide AAGGGTGTAACGCAACTAAG. Scanning densitometry was performed with the "ImageQuantSystem" (Molecular Dynamics, CA, USA). RESULTS After infection with H I V I , the monocytes were cultivated 14 days until they had differentiated into macrophages and achieved the production of high RT activity ( - 1 × 106 cpm/ml) in cell culture supernatants. In such HIV-infected M O / M A C cultures, multinucleated giant cells had developed (fig. 1). Tissue factor is normally not expressed constitutively or only at a low level. After stimulation with IFN-f for 2, 4 and 6 h, an increased expression of tissue factor m R N A in infected and uninfected cells was found (fig. 2). This expression was similar in infected and uninfected cells and was also seen after LPS stimulation (data not shown). When RNA from the same cells was hybridized with the c-sis probe, uninfected cells were found to express c-sis m R N A after stimulation, but HIVinfected cells had a decreased response after stimulation. The uniform loading is demonstrated with the expression of [3-actin (fig. 3a). Densitometric evaluation of the c-sis message in infected ceils showed only 1/3 of the expression found in control cells (fig. 3b). TGF[3 m R N A in M O / M A C is expressed constitutively and protein synthesis is regulated posttranscriptionally (Assoian et al., 1987). Stimulation

MO/MAC= PDGF = RT = TGF =

monocyte/macrophage. platelet-derived growth factor. reverse transcriptase.

transforming growth factor.

E X P R E S S I O N OF M A C R O P H A G E P R O D U C T S A F T E R H I V I N F E C T I O N

Fig. 1. Human macrophage culture 14 days after infection with HIVlm,Tm. Eosine-thiazine staining, Dade "DiffQuick". x 120.

Oh

IPN-gamma HIV-I

:

+

2h -

+

-

4h

6h

+.-

+

-

2,2 l t b -

.+~

+; .~ ' + : : i

,

~ , ;

i

i"

'''

Fig. 2. Northern blot hybridization of tissue factor expression in HIV-infected ( + ) and uninfected ( - ) macrophages. The cells were stimulated with IFN-f (200 U/ml) for 0, 2, 4 and 6 h.

37

38

W. GLIENKE E T AL.

Extinction 0,35 0,3 o.2s o.2-

0,15 0,1 0.0~

0

4

2

hours 1

uninfected MAC

I

HIV-1 Infected MAC

Fig. 3. Expression of c-sis. Northern blot hybridization of Hie-infected (+) and uninfected ( - ) , macrophages. The ceils were stimulated with IFN~, (200 U/ml) for 0, 2, 4 and 6 h (a). Scanning densitometric evaluation of c-sis Northern blot Co).

with LPS gave no difference in mRNA expression (fig. 4), irrespective of infection with HIVI. Similarly, M-CSF mRNA expression was found to be equal in infected and uninfected macrophages. Biologically active, secreted and membrane-bound forms of M-CSF are transcribed from a single gene which is alternatively spliced (Sherr, 1990). These various transcripts were also found to be equally expressed under all conditions studied (data not

shown). In line with this result, the expression of c-fms, the M-CSF-receptor coding gene, was likewise unaltered in infected cells (fig. 5). The most remarkable result was found for IL8: when the same blot used for c-fms analysis was rehybridized with IL8, a strong response of HIVinfected cells upon stimulation could be demonstrated. The expression of IL8 mRNA was sharply elevated compared to that in uninfected cells (fig. 6).

EXPRESSION OF MACROPHAGE PRODUCTS AFTER HIV INFECTION

,'2: ::-.. ,~

39

:

Fig. 4. Northern blot hybridization of TGF~ expression in HIV-infected (+) and uninfected ( - ) macrophages. The cells were stimulated with LPS (100 ng/ml) for 0, 2, 4 and 6 h.

Fig. 5. Northern blot hybridization of c-fins expression in HIV-infected (+) and uninfected ( - ) macrophages. The cells were stimulated with LPS (100 ng/ml) for 0, 2, 4 and 6 h.

Fig. 6. Northern blot hybridization of IL8 expression in HIV-infected (+) and uninfected ( - ) macrophages. The cells were stimulated with LPS (100 ng/ml) for 0, 2, 4 and 6 h.

DISCUSSION Reduced tissue factor expression of LPSstimulated monocytes isolated from AIDS patients was described previously. This difference in regulation of tissue factor mRNA could not be explained by HIV infection of monocytes, since only a minimal number of monocytes from AIDS patients harboured detectable HIV (Lathey et al., 1990). Our in vitro experiments shown here confirmed this conclusion. They did not reveal a depression in tissue factor mRNA (fig. 2) nor impair procoagulatory activity determined by clotting assay (our own unpublished data) of HIV-infected macrophages after stimulation. In contrast to tissue factor, in vitro HIV-infected macrophages showed a depressed response of expressing c-sis mRNA after stimulation (fig. 3). Due to the physiological function of PDGF in recruiting and activating mesenchymal and inflammatory cells,

this may have negative effects upon the defence against bacterial infections or upon wound healing. A sharply elevated response of HIV-infected macrophages was found for IL8 mRNA. This is in accordance with elevated IL8 protein secretion of in vitro infected M O / M A C described previously (Esser et al., 1991). Elevated IL8 protein was demonstrated in serum of juvenile and adult HIV-positive patients (Moore et al., 1992). It may he responsible for activated phagocytosis of granulocytes found in HIVinfected individuals (Schafer et al., personal communication). We have demonstrated the influence of an infection with HIV upon the response of M O / M A C to LPS or IFN't. This could happen through the induction of other cytokines capable of down- or upregulating certain m a c r o p h a g e products. Alternatively, HIV-encoded genes like tat could he implicated in the alteration of the macrophage

40

W. G L I E N K E E T A L .

response (Arya et al., 1985). In any case, our data demonstrate that HIV infection changes only a few specific pathways of gene expression. The mechanism of these changes remains to be studied.

Acknowledgements We thank Dr. Kiihnelfor providingsyntheticoligonucleotides. The Georg-Speyer-Hausis supported by the Bundesministerium fiir Gesundheitand the HessischeMinisterium fiir Wissenschaft und Kunst. Supported by the Bundesministerium fiir Forschung und Technologie(BGA III-004-89/FVP 4).

Facteurs produits par les macrophages apr~s infection in vitro de monocytes/macrophages humains par le VIH Nous avons ~tudi~ la r6ponse des monocytes/macrophages ( M O / M A C ) au lipopolyoside (LPS) et/t la stimulation par l'interferon-,t" (IFNT) en ce qui concerne l'expression des facteurs produits sp~cifiquement par le macrophage, c'est-h-dire le facteur stimulant les colonies de macrophages (M-CSF), les facteurs c-fms et c-sis, les facteurs tissulaires, le facteur de croissance transformant [3 (TGF[3) et l'interleukine-8 (IL8), apr6s infection in vitro par le virus de l'immunod~ficience humaine. L'IL8 est produite/l un niveau tr~s 61ev~ par les cellules infect~es par le VIH, avec un pic 4 h apr~s la stimulation par le LPS. Au m~me moment, les cellules t6moins non infect6es produisent une faible quantit6 d'ILS. La production d'autres facteurs, par exemple du facteur tissulaire ARNm, du c-fms, du M-CSF ou du TGF[3, n'est pas modifi6e par le LPS ou I'IFN-I'. A l'inverse de ce qui est observ6 pour I'IL8, la production du facteur c-sis est significativement diminu6e dans les cellules infect6es apr6s stimulation par I'IFN'r, par rapport A la production par les cellules non infect6es. Mots-cl~s: VIH, Macrophage, Monocyte, Cytokine; LPS, IFN, Expression, IL8, ARNm.

References Arya, S.K., Guo, C., Josephs, S.F. & Wong-Staal, F. (1985), Trans-activator gene of human T-lymphotropic virus type III (HTLV-III). Science, 299, 69-73. Assoian, R.K., Fleurdelys, B.E., Stevenson, H.E., Miller, P.J., Madtes, D.K., Ralnes, E.W., Ross, R. & Sporn, M.B. (1987), Expression and secretion of type beta transforming growth factor by activated human macrophages. Proc. nat. Acad. Sci. (Wash.), 84, 6020-6024. Baggiolini, M., Walz, A. & Kunkei, S.L. (1989), Neutrophil-activ.ating peptide-1/interleukin 8, a novel

cytokine that activates neutrophils. J. Clin. Invest., 84, 1045-1049. Becker, S., Warren, M.K. & Haskill, S. (1987), Colonystimulating-factor-induced monocyte survival and differentiation into macrophages in serum-free cultures. J. ImmunoL, 139, 3703. Von Briesen, H., Andreesen, R., Esser, R., Brugger, W., Meichsner, C., Becker, K. & Riibsamen-Walgmann, H. (1990), Infection of monocytes/macrophages by HIV in vitro. Res. Virol., 141, 225-231. Chirgwin, J., Przybyla, A.E., MacDonald, R.J. & Rutter, W.J. (1979), Isolation of biologically active ribonucleic acid from sources enriched in ribonucleases. Biochemistry, 15, 5294-5299. Esser, R., von Briesen, H., Brugger, W., Ceska, M., Glienke, W., Mfiller, S., Rehm, A., RiibsamenWalgmann, H. & Andreesen, R. (1991), Secretory repertoire of HIV-infected human monocytes/macrophages. Pathobiology, 59, 219-222. Garmer, S., Markovits, P., Markovitz, D.M., Kaplan, M.H., Gallo, R.C. & Popovic, M. (1986), The role of mononuclear phagocytes in HTLV-III/LAV infection. Science, 233, 215-219. Kekow, J., Wachsman, W., McCutchan, J.A., Cronin, M., Carson, D.A. & Lotz, M. (1990), Transforming growth factor-J3 and noncytopathic mechanisms of immunodeficiency in H1V infection. Proc. nat. Acad. Sci. (Wash.), 87, 8321-8325. Koenig, S., Gendelman, H.E., Orenstein, J.M., Dal Canto, M.C., Pezeshkpour, G.M., Yungbluth, M., Janotta, F., Aksamit, A., Martin, M.A. & Fauci, A.S. (1986), Detection of AIDS virus in macrophages in brain tissue from AIDS patients with encephalopathy. Science, 233, 1089-1093. Lathey, J.L., Agosti, J.M., Nelson, J.A., Corey, L., Gregory, S.A., Morrissey, J.H., Edgington, T.S. & Oldstone, M.B.A. (1990), A selective defect in tissue factor mRNA expression in monocytes from AIDS patients. Clin. Immunol. lmmunopath., 54, 1-13. Moore, C., Nelson, R., Trudeau, W., Lockey, R., Matsumoto, T., Lockey, R., Day, N. & Good, R. (1992), Detection of circulating Interleukin-8 (IL8) in the serum of children infected with human immunodeficiency virus (HIV). Abstract of VIII International Conference on AIDS/Amsterdam 1992. Niemetz, J. (1972), Coagulant activity of leukocytes. Tissue factor activity. J. Clin. Invest., 51, 307-313. Ross, R. (1989), Platelet-derived growth factor. Lancet, I, 27. Riibsamen-Waigmann, H., Becker, W.B., Helm, E.B., Brodt, R., Fischer, H., Henco, K. & Brede, H.D. (1986), Isolation of variants of lymphocytopathic retroviruses from the peripheral blood and cerebrospinal fluid of patients with ARC or AIDS. J. med. Virol., 19, 335-344. Riibsamen-Waigmann, H., Willems, W.R., Bertram, U. & yon Briesen, H. (1989), Reversal of HIV phenotype to fulminant replication on macrophages in pjerinatal transmission. Lancet, II, 1155-1156. Sherr, C.J., Rettenmier, C.W., Sacca, R., Roussel, M.F., Look, A.T. & Stanley, E.R. (1985), The c-fins protooncogene product is related to the receptor for the mononuclear phagocyte growth factor, CSF-I. Cell, 41,665. Sherr, C.J. (1990), Colony-s0mulating factor-1 receptor. Blood, 75, 1, 1-12.