Expression of messenger RNAs encoding ionotropic glutamate receptors in rat brain: regulation by haloperidol

Pergamon

PII:

Neuroscience Vol. 84, No. 3, pp. 813–823, 1998 Copyright ? 1998 IBRO. Published by Elsevier Science Ltd Printed in Great Britain. All rights reserved 0306–4522/98 $19.00+0.00 S0306-4522(97)00490-9

EXPRESSION OF MESSENGER RNAS ENCODING IONOTROPIC GLUTAMATE RECEPTORS IN RAT BRAIN: REGULATION BY HALOPERIDOL S. BRENE u ,† C. MESSER and E. J. NESTLER* Laboratory of Molecular Psychiatry, Departments of Psychiatry and Pharmacology, Connecticut Mental Health Center, Yale University School of Medicine, 34 Park Street, New Haven, CT 06508, U.S.A. Abstract––In situ hybridization was used to study the regional distribution of messenger RNAs encoding ionotropic glutamate receptor subtypes in the rat brain’s dopaminergic cell body regions and their forebrain projection areas. Short oligonucleotide probes specific for the messenger RNAs encoding the flip or flop splice forms of the GluR1 and GluR2 AMPA (á-amino-3-hydroxy-5-methyl-4isoxazolepropionate) receptor subunits, or for the messenger RNAs encoding the N-methyl--aspartate R1 subunit, were used. Significant differences were seen in the relative messenger RNA levels, and the distribution of the flip and flop splice forms, of GluR1 and GluR2. In the dopaminergic cell groups of the substantia nigra pars compacta and the ventral tegmental area, the flip form of both GluR1 and GluR2 dominated over the flop form. Similarly, in the core division of the nucleus accumbens, GluR1 and GluR2 flip forms dominated over the flop forms. In contrast, in the accumbens shell, the GluR1 and GluR2 flop forms dominated over the flip forms. As a comparison to the AMPA receptor subunits, N-methyl--aspartate R1 messenger RNA was relatively evenly distributed in all the regions analysed. The results demonstrate a heterogeneous distribution of the flip and flop splice forms of GluR1 and GluR2 in the brain’s dopaminergic pathways, which could contribute to physiological differences in regulation of the pathways by glutamatergic neurotransmission. We also studied regulation of glutamate receptor subunit expression in these regions by antipsychotic drugs, based on previous reports of altered levels of subunit immunoreactivity after drug treatment. Chronic administration of the typical antipsychotic drug, haloperidol, caused a small but significant induction of GluR2 flip messenger RNA in the dorsolateral caudate–putamen. This effect was not seen after chronic administration of the atypical antipsychotic drug, clozapine. Significant drug regulation of the other glutamate receptor subunits studied was not observed. ? 1998 IBRO. Published by Elsevier Science Ltd. Key words: antipsychotic drugs, basal ganglia, glutamate receptor, nucleus accumbens, ventral tegmental area.

All clinically used antipsychotic drugs acutely block dopamine D2-like receptors in the brain. However, chronic administration of the drugs is necessary to achieve their full therapeutic effects. This suggests a role for more slowly developing adaptations in the brain’s dopaminergic and possibly other systems, in response to sustained blockade of D2-like receptors, as the mechanism of antipsychotic drug action. Regulation of gene expression is one possible mechanism by which such adapations could be achieved.17 The nature of the long-term adaptations to antipsychotic drugs that mediate their therapeutic effects, as well as some of their delayed side-effects (e.g., tardive dyskinesia), remains unknown. There has *To whom correspondence should be addressed. †Present address: Department of Neuroscience, P.O. Box 60 400, S-171 77 Stockholm, Sweden. Abbreviations: AMPA, á-amino-3-hydroxy-5-methyl-4isoxazolepropionate; GluR, glutamate receptor subunit; NMDA, N-methyl--aspartate; SSC, standard saline citrate.

been considerable focus in recent years on the brain’s glutamate systems. Glutamatergic inputs from the prefrontal cortex are known to control the activity of midbrain dopaminergic neurons.10,30,39 Glutamatergic inputs similarly exert potent effects on neurons in the striatum3,9,23,36,41,43 that receive dense dopaminergic innervation.2 Chronic administration of antipsychotic drugs has been shown to alter extracellular levels of glutamate in the striatum,33,44 as well as levels of expression of specific glutamate receptor subunits in the striatum, medial prefrontal cortex and several other brain regions.5,6,26,27 Abnormalities in dopamine–glutamate interactions have also been implicated in schizophrenia.1,4,12,21,28 Glutamate exerts its effects on the brain in large part via activation of three major classes of ionotropic receptors, á-amino-3-hydroxy-5-methyl-4isoxazolepropionate (AMPA), N-methyl--aspartate (NMDA) and kainate receptors, which are defined by selective agonists. Each of these receptors is a multimeric complex. Although numerous subunits

813

814

S. Brene´ et al.

for each receptor type have been identified, the subunit compositions of the receptor complexes expressed in the brain in vivo remain poorly understood.16,31,34 AMPA receptors are composed of four major types of subunit, termed GluR1–4. NMDA receptors are composed of an obligatory subunit, termed NMDAR1, plus some form of an NMDAR2 subunit. Kainate receptors are composed of five major types of subunit, termed GluR5–7 and KA1–2. The diversity of NMDA and AMPA subunits is increased still further by alternative splicing. GluR1 and GluR2 each exist as two splice variants, termed flip and flop.37 In addition, both forms of GluR2 can be modified by RNA editing.35 At least eight splice variants of NMDAR1 and four of NMDAR2 are known. These various splice forms of the subunits are thought to give rise to glutamate receptors of distinct functional and regulatory properties, although this remains incompletely characterized.16,31,34 In the present study, we focused on AMPA and NMDA receptor subunits that have been shown previously to be regulated in the striatum and prefrontal cortex by chronic administration of antipsychotic drugs. In an earlier report, we found that chronic administration of the typical antipsychotic drug, haloperidol, but not the atypical antipsychotic drug, clozapine, increased levels of NMDAR1 immunoreactivity in the dorsal striatum (caudate– putamen).6 In contrast, both drugs increased levels of GluR1 immunoreactivity in the medial prefrontal cortex, whereas only clozapine increased levels of GluR2 in the ventral striatum (nucleus accumbens). While the regional distribution of splice variants of the NMDAR1 subunit has been characterized previously,22,45 the distributions of splice variants for the GluR1 and GluR2 subunits have not been reported for these particular brain regions. Therefore, as a first step, we used in situ hybridization to characterize the anatomical localization of the flip and flop forms of GluR1 and GluR2 in these forebrain regions, as well as in dopaminergic cell body regions in the midbrain. We next studied the influence of chronic administration of haloperidol or clozapine on levels of mRNA for these subunits to determine whether drug regulation of subunit immunoreactivity occurs via a pretranslational mechanism. EXPERIMENTAL PROCEDURES

Drug treatments Male Sprague–Dawley rats (initial weight 2200 g; CAMM, Wayne, NJ, U.S.A.) were used in this study. Haloperidol (target dose 1.8 mg/kg/day) and clozapine (target dose 35–40 mg/kg/day) were given orally in the drinking water for one, three or 26 weeks as described,6 conditions found to regulate glutamate receptor subunit immunoreactivity in specific brain regions. This protocol is known to result in clinically relevant plasma levels of the drugs.19,20 Control animals were given drinking water containing the acetic acid vehicle required to solubilize the drugs. The drug-treated animals gained weight normally and showed no untoward reactions. In addition, all efforts were made to

minimize animal suffering, to reduce the number of animals used, and to consider alternatives to in vivo techniques. In situ hybridization Coronal brain sections (14 mm thick) were cut on a cryostat (Zeiss) at "20)C. The sections were thawed on to glass slides. The hybridization cocktail contained 50% formamide, 4#SSC (1#SSC=0.15 M NaCl, 0.015 M sodium citrate, pH 7.0), 1#Denhardt’s solution (1% Sarcosyl, 0.02 M Na3PO4, pH 7.0, 10% dextran sulfate, 0.06 M dithiothreitol and 0.1 mg/ml sheared salmon sperm DNA). The following oligonucleotide probes were used: for GluR1 flip, 5*-CAAAGCGCTGGTCTTGTCCTTACTTCCGGA GTCCTTGCT-3* complementary to amino acids 771–783 of the mature GluR1 flip polypeptide;37 for GluR1 flop, 5*-CAAAGCGCTGGTCTTGTCCTTGGAGTCAC CTCCCC3* complementary to amino acids 772–783 of the mature GluR1 flop polypeptide;37 for GluR2 flip, 5*GAGGGCACTGGTCTTTTCCTTACTTCCCGAGTCC TTGGC-3* complementary to amino acids 775–787 of the mature Glu2 flip polypeptide;37 for GluR2 flop, 5*GAGGGCACTGGTCTTTTCCTTGGAATCACCTCCC CC-3* complementary to amino acids 776–787 of the mature Glu2 flop polypeptide;37 and for NMDAR1, 5*-TTCCTC CTCCTCCTCACTGTTCACCTTGAATCGGCCAAAG GGACT-3* complementary to amino acids 566–58029 complementary to all eight splicing forms of NMDAR1. The probes selected for GluR1 and GluR2 splice variants are the same as those used previously for studies of the distribution of these variants in the hippocampus.37 The oligonucleotide probes were 3*-end-labeled with á-[35S]dATP (NEN Du Pont, Boston, MA, U.S.A.) using terminal deoxynucleotidyl transferase (Gibco) to a specific activity of approximately 1#109 c.p.m./mg. The labeled probe was then separated from unincorporated nucleotides on a Nensorb-20 column (Du Pont, Wilmington, DE, U.S.A.) and 5#106 c.p.m. of probe was added per ml of hybridization cocktail. Each section was incubated with 0.1 ml of the hybridization cocktail containing labeled probe. Hybridization was performed for 18 h in a humidified chamber at 42)C. Following hybridization, the sections were rinsed four times for 20 min each in 0.5#SSC at 60)C. Finally, the sections were rinsed in autoclaved water for 10 s, dehydrated in alcohol and air dried. Thereafter, the slides were exposed to Hyperfilm (Amersham) for one to three weeks. For emulsion autoradiography, NTB2 nuclear track emulsion (Kodak, diluted 1:1 with water) was applied to the slides by dipping. After four to six weeks of exposure, the slides were developed for 2.5 min in D19 (Kodak), fixed for 5 min with Unifix (Kodak) and lightly counterstained with Cresyl Violet before analysis. Image analysis Optical density values from in situ hybridizations were quantified on a Macintosh-based NIH image analysis program, version 1.52. A 14C step standard was used to verify the linearity of the densitometry and to thereby ensure that the optical density values measured on the autoradiograms correspond to the relative amount of 35S-labeled glutamate receptor mRNA in the tissue sections. Statistical procedure An overall statistical test using ANOVA was used to examine group differences (P<0.05). Post tests were performed using the Bonferroni test (P<0.05) with correction for multiple comparison.

Regional expression of AMPA receptor subunits in the brain

815

Fig. 1a. (Caption on p. 817).

RESULTS

Localization of glutamate receptor messenger RNAs in the dorsal hippocampus We first investigated levels of receptor mRNAs in the dorsal hippocampus, which have been extensively characterized previously, as a positive control for the specificity of the probes used in the present study. In situ hybridization was performed with oligonucleotide probes specific for the flip or flop forms of GluR1 and of GluR2, as well as a probe that recognizes all known splice forms of NMDAR1 (see Experimental Procedures). Consist-

ent with published reports,37 we found very high levels of mRNA for both AMPA subunits37 and NMDAR129 in this brain region. GluR1 and GluR2 flip mRNAs were expressed with high levels in the CA1–CA3 and hilar regions of the hippocampus (Fig. 1a, b). In contrast, the GluR1 and GluR2 flop mRNAs were only expressed with high levels in the CA1 and dentate gyrus, with considerably lower levels in the CA3 region (Fig. 1a, b). These data confirm earlier characterizations of the distribution of the mRNAs for GluR1 and GluR2 splice variants in the hippocampus.37 NMDAR1 mRNA was evenly distributed over all

816

S. Brene´ et al.

Fig. 1b. (Caption opposite).

hippocampal previously.29

subfields

(Fig.

1c),

as

reported

Localization of glutamate receptor messenger RNAs in the dorsal and ventral striatum In both the dorsal and ventral striatum, no general difference in the distribution of GluR1 compared to GluR2 mRNA was seen. However, the distributions of the flip and flop forms of the two subunit mRNAs were clearly different (Fig. 1a, b, Table 1). Both GluR1 and GluR2 flip were expressed at higher levels in the medial striatum and in the nucleus accumbens core compared to the lateral striatum and accumbens

shell. Conversely, GluR1 and GluR2 flop were expressed at higher levels in the lateral striatum and accumbens shell compared to the medial striatum and accumbens core. NMDAR1 mRNA was expressed at similar levels in the medial versus lateral part of the dorsal striatum, as well as in the shell versus core division of the nucleus accumbens (Fig. 1c, Table 1). Emulsion autoradiography confirmed these differences in the expression patterns of the flip and flop forms of GluR1 and GluR2. For example, Fig. 2 illustrates higher levels of expression of GluR2 flip mRNA, compared to GluR2 flop mRNA, in the nucleus accumbens core.

Regional expression of AMPA receptor subunits in the brain

817

Fig. 1c. Fig. 1. Autoradiograms of coronal sections of rat brain showing expression of glutamate receptor subunit mRNAs by in situ hybridization. (a) GluR1 flip (left) and flop (right) mRNAs. (b) GluR2 flip (left) and flop (right) mRNAs. (c) NMDAR1 (left) and tyrosine hydroxylase (right) mRNAs. Each panel shows sections (from top to bottom) at the level of the prefrontal cortex (23.2 mm bregma), dorsal and ventral striatum (21.2 mm bregma), dorsal hippocampus (2"3.8 mm bregma), and ventral midbrain containing both the substantia nigra pars compacta and ventral tegmental area (2"5.2 mm bregma). mpfc, medial prefrontal cortex; ms, medial striatum; ls, lateral striatum; nac-s, nucleus accumbens shell; nac-c, nucleus accumbens core; CA1 and CA3 refer to subfields of the hippocampus; dg, dentate gyrus of the hippocampus; SN, substantia nigra; VTA, ventral tegmental area.

Localization of glutamate receptor messenger RNAs in the prefontal cortex GluR1 and GluR2 flip mRNAs were expressed at relatively high levels in very superficial layers of the prefrontal cortex, at low levels in deeper layers, and

at intermediate levels in the deepest layers (Fig. 1a, b, Table 1). In contrast, the GluR1 and GluR2 flop mRNAs were evenly distributed throughout the cortical layers of this brain region. The NMDAR1 mRNA was also homogeneously distributed in the prefrontal cortex (Fig. 1c, Table 1).

818

S. Brene´ et al. Table 1. Relative levels of GluR1 flip and flop, GluR2 flip and flop, and N-methyl--aspartate R1 messenger RNA in drug-naive rats Region

GluR1 flip

GluR1 flop

GluR2 flip

GluR2 flop

NMDAR1

pfc m.str l.str acc.sh acc.co

100&3.4 78&5.6 63&3.0 71&4.0 95&4.7

100&3.7 70&3.0 82&2.7 83&3.6 54&1.6

100&1.5 68&2.2 40&1.6 61&1.8 92&1.1

100&4.3 87&2.8 94&3.0 101&3.1 76&4.2

100&6.0 79&3.0 88&2.5 88&2.8 81&4.0

Data, which are based on autoradiograms such as those shown in Fig. 1, are expressed as mean&S.E.M. of percentage in prefrontal cortex and represent results obtained from five to six rats. pfc, prefrontal cortex; m.str, medial striatum; l.str, lateral striatum; acc.sh, nucleus accumbens shell; acc.co, nucleus accumbens core.

Localization of glutamate receptor messenger RNAs in the ventral midbrain The localization of dopaminergic cell body groups in the substantia nigra pars compacta and ventral tegmental area of the ventral midbrain was confirmed by in situ hybridization with an oligonucleotide probe specific for tyrosine hydroxylase (Fig. 1c). Patterns of in situ hybridization obtained for mRNAs of specific glutamate receptor subunits were then compared to those for tyrosine hydroxylase. In the substantia nigra pars compacta and the ventral tegmental area, the flip form of both GluR1 and GluR2 predominated: levels of the flip forms were detected at low to moderate levels, whereas the flop forms were undetectable in these regions (Fig. 1a, b). These findings were confirmed by emulsion autoradiography (Fig. 3). The mRNA encoding NMDAR1 was more evenly distributed throughout the ventral midbrain, including the ventral tegmental area and substantia nigra (Fig. 1c). Regulation of glutamate receptor subunit expression by antipsychotic drugs We next studied the effect of antipsychotic drug administration on levels of expression of GluR1, GluR2 and NMDAR1 mRNAs in the medial and lateral striatum, the accumbens core and shell, and the prefrontal cortex, regions where regulation of subunit immunoreactivity was observed previously.6 The only significant effect seen was a small but statistically significant increase in levels of GluR2 flip mRNA in the dorsolateral striatum after chronic (three weeks) administration of haloperidol (Table 2). Similar up-regulation of GluR2 flip mRNA was seen after six months of haloperidol administration (data not shown), which indicates the sustained nature of this phenomenon. Haloperidol regulation of GluR2 mRNA was not observed in any other brain region analysed, nor was such regulation observed in response to chronic administration of clozapine (GluR2 flip, 102&5.4% of control&S.E.M.; GluR2 flop, 104&4.6% of control&S.E.M; n=6). Also, in the dorsolateral striatum, there was a trend for up-regulation of GluR1 flip mRNA and down-

regulation of GluR1 flop mRNA after haloperidol administration (Table 2). These effects were not seen with clozapine (not shown). In the striatum, where we previously demonstrated increased levels of NMDAR1 immunoreactivity (determined by western blot) and mRNA (determined by northern blot) after chronic haloperidol administration,6 there was a tendency for a small increase in this mRNA by in situ hybridization, but this change did not achieve statistical significance. In the prefrontal cortex, where we previously demonstrated increased levels of GluR1 immunoreactivity after both chronic haloperidol and chronic clozapine administration, there was a trend for increased levels of GluR1 flip mRNA by in situ hybridization in response to haloperidol treatment (Table 2), and perhaps a slight trend in response to clozapine treatment (GluR1 flip, 111&4.2% of control&S.E.M.; GluR1 flop, 102&4.2% of control&S.E.M; n=6). In the nucleus accumbens, where we previously demonstrated increased levels of GluR2 immunoreactivity after chronic clozapine administration, we detected no change in the levels of GluR2 mRNA, either the flip or flop form, by in situ hybridization (accumbens shell: flip, 100&5.9% of control&S.E.M.; flop, 96&2.3% of control&S.E.M.; accumbens core: flip, 100&5.2% of control&S.E.M.; flop, 93&2.9% of control&S.E.M.; n=6). To further evaluate drug regulation of subunit mRNA expression, we studied the effects of a shorter treatment period (one week) of haloperidol. This treatment paradigm failed to elicit significant changes in mRNA levels of GluR1 or GluR2 flip or flop or NMDAR1 in any brain region analysed (data not shown). DISCUSSION

Given the importance of glutamate as the main excitatory neurotransmitter in the brain, and the complexity of the subtypes and splice variants of glutamate receptors, it is important to map the distribution of these various subunits to better understand glutamatergic neurotransmission. In this study, we used probes specific for the flip and flop splice forms of the two major AMPA receptor subunits in

Regional expression of AMPA receptor subunits in the brain

819

Fig. 2. Emulsion autoradiograms of the nucleus accumbens core showing the cellular distribution of GluR2 flip and flop mRNAs. (A, B) Dark-field autoradiograms illustrate the distribution of cells expressing GluR2 flip (A) and flop (B) mRNAs. (C, D) Higher magnification autoradiograms in bright field of the distribution of GluR2 flip (C) and flop (D) mRNAs in the same sections as shown in A and B. The asterisks mark the anterior commissure, close to the accumbens core region, at the same position in the two magnifications. Note the higher intensity of labeling in the accumbens core for GluR2 flip mRNA (A, C) as compared to GluR2 flop mRNA (B, D). Scale bars=125 mm.

Fig. 3. Emulsion autoradiograms of the ventral tegmental area showing the cellular distribution of GluR2 flip and flop and tyrosine hydroxylase mRNAs. Bright-field autoradiograms are shown. Scale bar=125 mm.

the brain, GluR1 and GluR2, to analyse their respective distribution, particularly in brain regions implicated in antipsychotic drug action. While the regional distribution of GluR1 and GluR2 has been described previously,25,32 the pattern of expression of the flip and flop splice variants of the subunits has remained unknown in these brain regions. We also used a pan probe that detects all known splice forms of

NMDAR1, the major NMDA receptor subunit in the brain, for comparison. Dramatic differences in expression patterns for the flip and flop forms of GluR1 and GluR2 mRNAs were apparent in several brain regions studied. In the ventral midbrain, the flip forms of GluR1 and GluR2 dominated over the flop forms, which were not detectable. In contrast, NMDAR1 mRNA was

820

S. Brene´ et al. Table 2. Regulation of glutamate receptor subunit messenger RNA levels by chronic haloperidol administration Region

Glu1 flip

Glu1 flop

Glu2 flip

Glu2 flop

NMDAR1

m.str l.str acc.sh acc.co pfc

105&7.4 117&7.6 106&8.1 109&6.9 116&5.4

100&4.0 88&2.6 91&4.3 102&3.9 105&3.8

102&3.0 117&1.8* 100&5.9 100&5.2 105&2.1

100&1.7 98&0.9 96&2.3 93&2.9 101&2.4

105&2.9 110&1.4 99&2.3 106&1.9 101&1.9

Data are expressed as percentage of control&S.E.M. (n=5 or 6). See the footnote to Table 1 for abbreviations.

expressed at a relatively high level throughout the ventral midbrain. The flip forms of GluR1 and GluR2 mRNAs also dominated over the flop forms in the nucleus accumbens core, whereas the flop forms dominated over the flip forms in the accumbens shell. The core and shell divisions of the nucleus accumbens have been differentiated based on the distribution of a number of neuropeptides, different efferent projections13–15,42 and different functional responses under a variety of conditions.18,24,38 The differing levels of AMPA receptor splice variants offer a further distinguishing feature of these divisions. In the hippocampus, the flip forms of GluR1 and GluR2 mRNAs were expressed at highest levels in the CA1–CA3 pyramidal cell subfields and at slightly lower levels in the dentate gyrus. In contrast, the flop forms were expressed at highest levels in the dentate gyrus and CA1 region, and at considerably lower levels in the CA3 and hilar regions. These data from the hippocampus confirm earlier findings of the distribution of mRNA encoding these splice forms of AMPA receptor subunits.37 These hippocampal data thereby provided an important control for the specificity of our in situ hybridization procedure. The region-specific expression of the flip and flop splice forms of GluR1 and GluR2 could result in important differences in the actions of glutamate in these various brain regions. This is based on results from in vitro expression systems, wherein AMPA receptors with dominating flip forms have been shown to exhibit a greater electrophysiological response to glutamate compared to receptors with dominating flop forms.37 Extrapolating to the in vivo situation, the higher levels of the flip variants in the core versus the shell division of the nucleus accumbens might be expected to result in a greater response to AMPA receptor stimulation in the core. Indeed, microinjections of AMPA into the accumbens core are more potent than injections into the shell region in eliciting stimulation of locomotor activity.18 Further studies are needed to confirm the contribution of differential expression of AMPA receptor splice variants to differential functional responses in these two divisions of the nucleus accumbens.

Based on our previous study, in which we demonstrated regulation of glutamate receptor expression by antipsychotic drug treatments by western blotting,6 we were also interested in the present study to determine whether such regulation could be demonstrated at the mRNA level. Our findings indicated very different effects on subunit mRNA compared to subunit immunoreactivity. The only statistically significant effect demonstrated in the present study was up-regulation of GluR2 flip mRNA in the dorsolateral striatum, thus confirming the results of a recent report of glutamate receptor mRNA expression after chronic administration of haloperidol.5 There was also a trend for up-regulation of GluR1 flip mRNA and down-regulation of GluR1 flop mRNA within this same brain region. In our previous study, no effect of haloperidol was seen on levels of GluR1 or GluR2 immunoreactivity in gross dissections of the caudate–putamen. The failure to observe such regulation could be explained by the better resolution of in situ hybridization, where we distinguished between the medial, lateral and dorsal portions of the caudate–putamen. Furthermore, in situ hybridization enabled characterization of drug effects on individual splice variants of GluR1 and GluR2, which could not be distinguished with the antibodies used in the previous study. If the observed alterations in subunit mRNA do result in equivalent alterations in subunit protein, our results indicate that the AMPA receptor complex in neurons of the dorsolateral striatum may be substantially altered after chronic haloperidol exposure. The dorsolateral striatum is suggested to be the brain region most involved in the development of extrapyramidal sideeffects to typical antipsychotic drugs like haloperidol. It is possible that the inferred alterations in AMPA receptor subunit composition in this brain region might be one factor in the development of some of these side-effects. It should be noted in this regard that chronic administration of the atypical antipsychotic drug, clozapine, which does not produce extrapyramidal side-effects, also did not result in altered levels of AMPA receptor subunit expression. We failed to detect by in situ hybridization drug regulation of the mRNAs of glutamate receptor subunits that did show clear regulation by western

Regional expression of AMPA receptor subunits in the brain

blotting. Chronic haloperidol adminstration was found to produce a 40% increase in levels of NMDAR1 immunoreactivity in the caudate– putamen and a 40% increase in levels of GluR1 immunoreactivity in the prefrontal cortex.6 In the present study, we detected trends for regulation of these two subunits, but these effects were very small and did not achieve statistical significance. Furthermore, we did not detect a change in GluR2 flip or flop mRNA expression in the nucleus accumbens after chronic clozapine administration, where a 32% increase in subunit immunoreactivity was demonstrated previously.6 We also did not detect significant increases in levels of these subunits after shorter treatment periods, which argues against the possibility that larger increases in mRNA levels occur earlier in the treatment, and lead to increases in protein levels during later phases of treatment, at which time mRNA levels have largely normalized. Rather, our results would support one of two possibilities. That relatively small changes in subunit mRNA can give rise to larger and more significant changes in subunit protein, which could occur depending on the relative stability of the mRNA and protein. Another possibility is that drug regulation of subunit protein occurs at a post-transcriptional level. Indeed, there are precedents for this mode of regulation. Administration of ovarian steroids increases levels of NMDAR1 immunoreactivity in the CA1 region of the hippocampus without altering levels of NMDAR1 mRNA.11 Similarly, chronic administration of ethanol increases levels of NMDAR1 immunoreactivity, but not mRNA, in the hippocampus,7,40 and chronic exposure to NMDA

821

antagonists up-regulates NMDAR1 immunoreactivity, but not mRNA levels, in cultured cortical neurons.8 CONCLUSIONS

Results from the present in situ hybridization experiments demonstrate a clear differential distribution of the flip and flop splice variants of the GluR1 and GluR2 AMPA receptor subunits in the brain’s dopaminergic pathways. Based on the known differences in the electrophysiological properties of AMPA receptors composed of the flip and flop forms, the present data provide a histological basis for differential effects of AMPA receptor stimulation in these brain regions. In addition, we found splice variant-specific regulation of GluR2, and possibly of GluR1, in the dorsolateral striatum after chronic haloperidol administration, which could contribute to the drug’s effects on striatal function. In contrast, we could not demonstrate significant antipsychotic drug regulation of several subunits in specific brain regions wherein regulation of subunit immunoreactivity has been observed previously. Such regulation may occur at a post-transcriptional level. Acknowledgements—This work was supported by U.S.P.H.S. grants MH25642 and DA07359, and by the Abraham Ribicoff Research Facilities, Connecticut Mental Health Center, State of Connecticut Department of Mental Health and Addiction Services. S.B. was supported in part by the Swedish Medical Research Council and Fernstro¨ms stiftelse.

REFERENCES

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12.

Akbarian S., Sucher N. J., Bradley D., Tafazzoli A., Trinh D., Hetrick W. P., Potkin S. G., Sandman C. A., Bunney W. E. Jr and Jones E. G. (1996) Selective alterations in gene expression for NMDA receptor subunits in prefrontal cortex of schizophrenics. J. Neurosci. 16, 19–30. Bjo¨rklund A. and Lindvall O. (1984) Catecholaminergic brain stem regulatory systems. In Handbook of Chemical Neuroanatomy (eds Bjo¨rklund A. and Ho¨kfelt T.), Vol. 2, pp. 55–122. Elsevier, New York. Calabresi P., Pisani A., Mercuri N. B. and Bernardi G. (1996) The corticostriatal projection: from synaptic plasticity to dysfunctions of the basal ganglia. Trends Neurosci. 19, 19–24. Carlsson M. and Carlsson A. (1990) Interactions between glutamatergic and monoaminergic systems within the basal ganglia—implications for schizophrenia and Parkinson’s disease. Trends Neurosci. 13, 272–276. Eastwood S. L., Porter R. H. and Harrison P. J. (1996) The effect of chronic haloperidol treatment on glutamate receptor subunit (GluR1, GluR2, KA1, KA2, NR1) mRNAs and glutamate binding protein mRNA in rat forebrain. Neurosci. Lett. 212, 163–166. Fitzgerald L. W., Deutch A. Y., Gasic G., Heinemann S. F. and Nestler E. J. (1995) Regulation of cortical and subcortical glutamate receptor subunit expression by antipsychotic drugs. J. Neurosci. 15, 2453–2461. Follesa P. and Ticku M. K. (1995) Chronic ethanol treatment differentially regulates NMDA receptor subunit mRNA expression in rat brain. Molec. Brain Res. 29, 99–106. Follesa P. and Ticku M. K. (1996) NMDA receptor upregulation: molecular studies in cultured mouse cortical neurons after chronic antagonist exposure. J. Neurosci. 16, 2172–2178. Garcia-Munoz M., Young S. J. and Groves P. M. (1991) Terminal excitability of the corticostriatal pathway. II. Regulation by glutamate receptor stimulation. Brain Res. 551, 207–215. Gariano R. F. and Groves P. M. (1988) Burst firing induced in midbrain dopamine neurons by stimulation of the medial prefrontal and anterior cingulate cortices. Brain Res. 462, 194–198. Gazzaley A. H., Weiland N. G., McEwen B. S. and Morrison J. H. (1996) Differential regulation of NMDAR1 mRNA and protein by estradiol in the rat hippocampus. J. Neurosci. 16, 6830–6838. Grace A. A. (1993) Cortical regulation of subcortical dopamine systems and its possible relevance to schizophrenia. J. neural Transm.—Gen. Sect. 91, 111–134.

822 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36.

37. 38. 39. 40. 41. 42.

S. Brene´ et al. Groenewegen H. J., Meridith G. E., Berendse H. W., Voorn P. and Wolters J. G. (1989) The compartmental organization of the ventral striatum in the rat. In Neural Basis for Disorders in Movement (eds Grossman A. R. and Sambrook M. A.), pp. 45–54. Libbey, London. Groenewegen H. J. and Russchen F. T. (1984) Organization of the efferent projections of the nucleus accumbens to pallidal, hypothalamic, and mesencephalic structures: a tracing and immunohistochemical study in the cat. J. comp. Neurol. 223, 347–367. Heimer L., Zahm D. S., Churchill L., Kalivas P. W. and Wohltmann C. (1991) Specificity in the projection patterns of accumbal core and shell in the rat. Neuroscience 41, 89–125. Hollmann M. and Heinemann S. (1994) Cloned glutamate receptors. A. Rev. Neurosci. 17, 31–108. Hyman S. E. and Nestler E. J. (1996) Initiation and adaptation: a paradigm for understanding psychotropic drug action. Am. J. Psychiat. 153, 151–162. Johnson K., Churchill L., Klitenick M. A., Hooks M. S. and Kalivas P. W. (1996) Involvement of the ventral tegmental area in locomotion elicited from the nucleus accumbens or ventral pallidum. J. Pharmac. exp. Ther. 277, 1122–1131. Kosten T. A., Decaprio J. L. and Nestler E. J. (1996) Long-term haloperidol administration enhances and short-term administration attenuates the behavioral effects of cocaine in a place conditioning procedure. Psychopharmacology 128, 304–312. Kosten T. A. and Nestler E. J. (1994) Clozapine attenuates cocaine conditioned place preference. Life Sci. 55, PL9–PL14. Krystal J. H., Karper L. P., Seibyl J. P., Freeman G. K., Delaney R., Bremner J. D., Heninger G. R., Bowers M. B. Jr and Charney D. S. (1994) Subanesthetic effects of the noncompetitive NMDA antagonist, ketamine, in humans. Psychotomimetic, perceptual, cognitive, and neuroendocrine responses. Archs gen. Psychiat. 51, 199–214. Laurie D. J., Putzke J., Zieglgansberger W., Seeburg P. H. and Tolle T. R. (1995) The distribution of splice variants of the NMDAR1 subunit mRNA in adult rat brain. Molec. Brain Res. 32, 94–108. Liste I., Rozas G., Guerra M. J. and Labandeira-Garcia J. L. (1995) Cortical stimulation induces Fos expression in striatal neurons via NMDA glutamate and dopamine receptors. Brain Res. 700, 1–12. Maldonado-Irizarry C. S., Swanson C. J. and Kelley A. E. (1995) Glutamate receptors in the nucleus accumbens shell control feeding behavior via the lateral hypothalamus. J. Neurosci. 15, 6779–6788. Martin L. J., Blackstone C. D., Levey A. I., Huganir R. L. and Price D. L. (1993) AMPA glutamate receptor subunits are differentially distributed in rat brain. Neuroscience 53, 327–358. Meador-Woodruff J. F., King R. E., Damask S. P. and Bovenkerk K. A. (1996) Differential regulation of hippocampal AMPA and kainate receptor subunit expression by haloperidol and clozapine. Molec. Psychiat. 1, 41–53. Meshul C. K., Bunker G. L., Mason J. N., Allen C. and Janowsky A. (1996) Effects of subchronic clozapine and haloperidol on striatal glutamatergic synapses. J. Neurochem. 67, 1965–1973. Moghaddam B. (1994) Recent basic findings in support of excitatory amino acid hypotheses of schizophrenia. Prog. Neuropsychopharmac. biol. Psychiat. 18, 859–870. Moriyoshi K., Masu M., Ishii T., Shigemoto R., Mizuno N. and Nakanishi S. (1991) Molecular cloning and characterization of the rat NMDA receptor [see comments]. Nature 354, 31–37. Murase S., Grenhoff J., Chouvet G., Gonon F. G. and Svensson T. H. (1993) Prefrontal cortex regulates burst firing and transmitter release in rat mesolimbic dopamine neurons studied in vivo. Neurosci. Lett. 157, 53–56. Nakanishi S. (1992) Molecular diversity of glutamate receptors and implications for brain function [Review]. Science 258, 597–603. Sato K., Kiyama H. and Tohyama M. (1993) The differential expression patterns of messenger RNAs encoding non-N-methyl--aspartate glutamate receptor subunits (GluR1–4) in the rat brain. Neuroscience 52, 515–539. See R. E. and Lynch A. M. (1995) Chronic haloperidol potentiates stimulated glutamate release in caudate putamen, but not prefrontal cortex. NeuroReport 6, 1795–1798. Seeburg P. H. (1993) The TiPS/TINS lecture: the molecular biology of mammalian glutamate receptor channels. Trends pharmac. Sci. 14, 297–303. Seeburg P. H. (1996) The role of RNA editing in controlling glutamate receptor channel properties. J. Neurochem. 66, 1–5. Somers D. L. and Beckstead R. M. (1990) Striatal preprotachykinin and preproenkephalin mRNA levels and the levels of nigral substance P and pallidal Met5-enkephalin depend on corticostriatal axons that use the excitatory amino acid neurotransmitters aspartate and glutamate: quantitative radioimmunocytochemical and in situ hybridization evidence. Molec. Brain Res. 8, 143–158. Sommer B., Keinanen K., Verdoorn T. A., Wisden W., Burnashev N., Herb A., Kohler M., Takagi T., Sakmann B. and Seeburg P. H. (1990) Flip and flop: a cell-specific functional switch in glutamate-operated channels of the CNS. Science 249, 1580–1585. Sorg B. A., Guminski B. J., Hooks M. S. and Kalivas P. W. (1995) Cocaine alters glutamic acid decarboxylase differentially in the nucleus accumbens core and shell. Molec. Brain Res. 29, 381–386. Taber M. T., Das S. and Fibiger H. C. (1995) Cortical regulation of subcortical dopamine release: mediation via the ventral tegmental area. J. Neurochem. 65, 1407–1410. Trevisan L., Fitzgerald L. W., Brose N., Gasic G. P., Heinemann S. F., Duman R. S. and Nestler E. J. (1994) Chronic ingestion of ethanol up-regulates NMDAR1 receptor subunit immunoreactivity in rat hippocampus. J. Neurochem. 62, 1635–1638. Uhl G. R., Navia B. and Douglas J. (1988) Differential expression of preproenkephalin and preprodynorphin mRNAs in striatal neurons: high levels of preproenkephalin expression depend on cerebral cortical afferents. J. Neurosci. 8, 4755–4764. Voorn P., Gerfen C. R. and Groenewegen H. J. (1989) Compartmental organization of the ventral striatum of the rat: immunohistochemical distribution of enkephalin, substance P, dopamine, and calcium-binding protein. J. comp. Neurol. 289, 189–201.

Regional expression of AMPA receptor subunits in the brain 43.

823

Wullner U., Standaert D. G., Testa C. M., Landwehrmeyer G. B., Catania M. V., Penney J. B. Jr and Young A. B. (1994) Glutamate receptor expression in rat striatum: effect of deafferentation. Brain Res. 647, 209–219. 44. Yamamoto B. K. and Cooperman M. A. (1994) Differential effects of chronic antipsychotic drug treatment on extracellular glutamate and dopamine concentrations. J. Neurosci. 14, 4159–4166. 45. Zukin R. S. and Bennett M. V. (1995) Alternatively spliced isoforms of the NMDARI receptor subunit. Trends Neurosci. 18, 306–313. (Accepted 24 September 1997)