Expression of Natural Antimicrobials by Human Placenta and Fetal Membranes

Placenta 28 (2007) 161e169

Expression of Natural Antimicrobials by Human Placenta and Fetal Membranes A.E. King a,*, A. Paltoo a, R.W. Kelly d, J.-M. Sallenave e, A.D. Bocking a,b,c, J.R.G. Challis a,b,c a

Department of Physiology, University of Toronto, Medical Sciences Building, 1 King’s College Circle, Toronto, Ontario, Canada M5S 1A8 b Department of Obstetrics and Gynaecology, University of Toronto, Toronto, Ontario, Canada M5S 1A8 c Department of Medicine, University of Toronto, Toronto, Ontario, Canada M5S 1A8 d Medical Research Council Human Reproductive Sciences Unit, Centre for Reproductive Biology, 49 Little France Crescent, Edinburgh EH16 4SB, United Kingdom e Medical Research Council Centre for Inflammation Research, Edinburgh University Medical School, Edinburgh EH8 9AG, United Kingdom Accepted 11 January 2006

Abstract Preterm birth associated with infection is a major clinical problem. We hypothesized that this condition is associated with altered expression of natural antimicrobial molecules (b-defensins (HBD), elafin). Therefore, we examined expression of these molecules and their regulation by proinflammatory cytokines in placentae and fetal membranes from term pregnancy. HBD1e3 and elafin were localized by immunohistochemistry in fetal membranes and placenta. Real-time quantitative PCR was used to examine mRNA expression in primary trophoblast cells treated with inflammatory molecules. HBD1e3 and elafin were immunolocalized to placental and chorion trophoblast layers of fetal membranes and placenta. Immunoreactivity was also observed in amnion epithelium and decidua. No differences were noted between samples from women who were not in labour compared to those in active labour. In in vitro cultures of primary trophoblast cells, HBD2 and elafin mRNA expression was upregulated by the proinflammatory cytokine, IL-1b. These results suggest that the chorion and placental trophoblast layers may be key barriers to the progression of infection in the pregnant uterus. Natural antimicrobial expression may be altered in response to inflammatory mediator expression associated with the onset of labour and/or uterine infection, providing increased protection when the uterus may be particularly susceptible to infection. Ó 2006 Elsevier Ltd. All rights reserved. Keywords: Natural antimicrobials; Placenta; Fetal membranes; Labour; Infection

1. Introduction Successful pregnancy and subsequent delivery of a healthy infant at term is dependent on the presence of optimal uterine conditions, and particularly on the prevention of upper genital tract infection. Preterm labour is the major cause of neonatal morbidity and mortality and around 30% of preterm births are associated with uterine infection [1]. Natural antimicrobials are key molecules of the innate immune system and have anti-bacterial, anti-viral and anti-fungal * Corresponding author. Tel.: þ1 416 978 1991; fax: þ1 416 978 4940. E-mail address: [email protected] (A.E. King). 0143-4004/$ - see front matter Ó 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.placenta.2006.01.006

actions [2]. Human b-defensins (HBD) are a major group of antimicrobials that are expressed at mucosal surfaces by epithelial cells and leukocytes. HBDs are either constitutively expressed (e.g. HBD1) [3] or inducible in response to the presence of proinflammatory cytokines or bacterial products (e.g. HBD2) [4]. Further to their antimicrobial actions, HBDs have been found to have chemoattractant properties suggesting an interaction between the innate and adaptive immune systems [5]. Whey acidic peptide (WAP) motif containing proteins are a second group of molecules which have been shown to have antimicrobial properties [6,7]. This group includes secretory leukocyte protease inhibitor (SLPI) and elafin (skin derived antileukoproteinase; proteinase 3). Both of these molecules

162

A.E. King et al. / Placenta 28 (2007) 161e169

have anti-protease activity against serine proteases such as neutrophil elastase [8,9]. The anti-protease actions of SLPI and elafin are believed to be involved in the control of the inflammatory response at mucosal surfaces such as the lung [10]. In addition to this, their microbicidal actions suggest a role in innate immune defense. Natural antimicrobials are expressed throughout the nonpregnant female reproductive tract and are present in vagina, cervix, endometrium and fallopian tube [11]. Peak endometrial mRNA expression of defensins and the WAP proteins has been shown to coincide with implantation and menstruation suggesting a role of the innate immune system in the prevention of upper genital tract infection during key reproductive events [12e14]. In pregnancy, mRNA expression of defensins has been reported in placenta [15,16] while protein expression of HBD3 has been localized to both amnion and chorio-decidua [17]. HBD concentrations in amniotic fluid have not been detailed but concentrations of the related a-defensins, human neutrophil peptides (HNP) 1e3, have been reported. HNP1e3 levels are increased in amniotic fluid in association with parturition at term, preterm labour, preterm premature rupture of membranes and intra-amniotic infection [18]. Expression of elafin has been documented in amnion epithelium, chorion trophoblast and decidua [19]. SLPI is present in both amnion epithelium and decidua [20,21] with high levels also present in the cervical mucus plug at term pregnancy [22]. Reduced expression of both SLPI and elafin is associated with premature rupture of membranes [19,23]. There is little information regarding regulation of natural antimicrobial molecules in placenta and fetal membranes although HBD3 mRNA has been reported to increase in the amnion FL cell line in response to the bacterial products, lipopolysaccharide and peptidoglycan [17]. The expression and regulation of the beta-defensins and elafin in human placenta and fetal membranes have not been fully described. The current study evaluated the localization of HBD1e3 and elafin in these tissues at term pregnancy and examined their regulation in primary chorion and placental trophoblast cells. 2. Materials and methods 2.1. Tissue collection and processing Placentae and fetal membranes were collected from healthy women attending Mt. Sinai Hospital, Toronto, Ontario, Canada. All subjects provided ethical consent to the collection and use of their tissues, according to the guidelines of the Canadian Institutes for Health Research (Tricouncil Policy). This project was approved by the Mount Sinai Hospital, Toronto, Canada Review Board for Research involving Human Subjects. Tissues were obtained either following spontaneous vaginal delivery (in spontaneous labour, SL) or after elective Caesarean section (not in labour, NIL). All pregnancies had reached term (>37 weeks) and were without complications.

cotyledon tissue was collected randomly from the maternal side of the placenta, pooled and placed in a digestion solution (DMEM culture medium containing 0.125% trypsin (Sigma, St. Louis, MO) and 0.02% DNAase (Sigma)). Tissue was incubated with digestion solution for three periods of 30 min. Chorio-decidua was peeled from amnion, chopped and incubated in digestion solution (with the addition of 0.2% collagenase (Sigma)) for three periods of 60 min. At the end of each incubation cells were collected, pooled and subsequently filtered through a 200-mm filter, prior to loading onto a continuous Percoll (Sigma) gradient (5e10%, in 5% steps, 3 ml each). After centrifugation at 1200g for 20 min, cells were collected between the markers of 1.049 and 1.062 g/ml. Cells were plated in six well culture plates (Falcon, Becton Dickinson, Franklin Lakes, NJ) at a density of 3  106 cells/well.

2.3. Placental and chorion trophoblast cell culture Placental and chorion trophoblast cells were grown in DMEM containing 10% fetal calf serum (Sigma) and 1% antibioticeantimycotic solution (Sigma; penicillin, streptomycin, amphotericin B) for 72 h prior to treatment. Twenty hours prior to treatment medium was replaced with DMEM without FCS or antibiotics. Cells were treated for 24 h in the absence or presence of IL-1b (0.1, 1 and 10 ng/ml; Sigma), TNFa (1, 10, 20 ng/ml; Sigma) or LPS (0.01, 0.1, 1 mg/ml; Sigma, Escherichia coli 055:B5).

2.4. Reverse transcription/quantitative polymerase chain reaction Cells were harvested in Trizol (Invitrogen, Burlington, Ontario, Canada), RNA was extracted as detailed in the manufacturer’s protocol and DNAse treatment (Ambion, Austin, TX) was performed to remove contaminating DNA. Integrity of RNA was assessed on a 1% agarose gel. RNA purity was determined from the OD260:OD280 measurements and RNA concentrations were determined from OD260 readings. RNA (1 mg) was reverse transcribed using superscript II reverse transcriptase (Invitrogen) and random primers (Invitrogen). RNAse H (Invitrogen) was used to remove RNA present at the end of the reverse transcriptase reaction. Real-time quantitative PCR was used to measure expression of HBD1, HBD2 and elafin mRNA. PCR conditions for each primer set were optimized using a gradient PCR machine (DNA Engine DYAD, MJ Research) prior to quantitative PCR. Real-time PCR reaction mixtures contained Platinum Taq (Invitrogen), SYBR green (0.0032% v/v; Molecular Probes, Invitrogen) and specific forward and reverse primers for the gene of interest (0.2 mM; Invitrogen). PCR reactions were performed using the Rotor-Gene SG3000 system. PCR cycles consisted of an initial denaturation step at 95  C for 5 min, followed by 45 cycles (40 cycles for elafin) of denaturation at 95  C for 60 s, annealing at 65  C (63  C for HBD1) for 45 s and extension at 72  C for 60 s. At the end of each cycle, a further 15-s step (82  C, elafin; 83  C, HBD1; 84  C, HBD2) was included in order to melt any primer-dimers present and to allow measurement of fluorescence released only by the specific amplicon. Amplification of b-actin was measured in each sample and was used as a housekeeping gene for normalization. Details of forward and reverse primers and product sizes are shown in Table 1. Messenger RNA expression levels of the genes of interest and b-actin were each determined using relative quantitation by comparison to a standard curve. Standard curves were generated from serial dilutions of a reference sample and were included in each PCR run. Standards and samples were measured in duplicate and a ‘no template’ control and calibrator sample (pooled cDNA from cultured amnion epithelial and placental trophoblast cells for HBD2, elafin and b-actin; pooled cDNA from cultured placental trophoblast cells for HBD1) were included in all runs. Expression levels of the genes of interest in each sample were normalized to b-actin and are reported relative to the calibrator sample to allow for comparison between separate PCR runs.

2.2. Isolation of placental and chorion trophoblast cells 2.5. Immunohistochemistry Placental (n ¼ 9) and chorio-decidual (n ¼ 10) tissues were collected from women undergoing Caesarean section (NIL) and trophoblast cells were isolated using a modification of the method described by Kliman et al. [24], and as reported previously [25]. In brief, approximately 60 g of placental

HBD1e3 and elafin were localized in placenta (NIL, n ¼ 3; SL, n ¼ 3) and fetal membranes (NIL, n ¼ 3; SL, n ¼ 3) using standard immunohistochemical procedures. Briefly, tissue sections were dewaxed in xylene and rehydrated in

A.E. King et al. / Placenta 28 (2007) 161e169

163

Table 1 Sequences and product sizes for quantitative PCR primers for natural antimicrobials and b-actin

HBD1 HBD2 Elafin b-Actin

Forward primer

Reverse primer

Product size (base pairs)

CCCAGTTCCTGAAATCCTGA GACTCAGCTCCTGGTGAAGC CGTGGTGGTGTTCCTCATC TCACCCACACTGTGCCCATCTACGA

CAGGTGCCTTGAATTTTGGT GTCGCACGTCTCTGATGAGG GACCTTTGACTGGCTCTTGC CAGCGGAACCGCTCATTGCCAATGG

215 296 179 295

descending grades of alcohol. Sections were subjected to a microwave antigen retrieval step. Sections were heated in citrate buffer (0.01 M; pH 6) for 10 min in a microwave oven and then allowed to cool for a further 20 min. Non-specific endogenous peroxidase activity was then blocked with 3% hydrogen peroxide (Calbiochem; San Diego, CA) in distilled water for 10 min at room temperature. All sections were subjected to a non-immune block (Vector Laboratories; Burlingame, CA) with the appropriate diluted serum (see Table 2) for 20 min in a humidified chamber at room temperature. Sections were incubated overnight at 4  C with 50 ml of primary antibody (see Table 2; all dilutions in non-immune blocking serum). Negative control sections were incubated with the appropriate isotype control (rabbit immunoglobulin, HBD3 and elafin; goat immunoglobulin, HBD1 and HBD2) in place of the primary antibody. The isotype control concentrations were matched to those of the primary antibodies. Additional negative control sections were also incubated with HBD2 antibody which had been preabsorbed with blocking peptide (Santa Cruz Biotechnologies, Santa Cruz, CA). Cells were then incubated with the appropriate biotinylated secondary antibody diluted in non-immune blocking serum (Table 2; Vector Laboratories), followed by an avidinebiotin peroxidase detection system (both for 60 min at room temperature; Elite ABC, Vector Laboratories). Diaminobenzidine (Sigma) was used to identify positive staining. Cells were counterstained in Mayer’s haemotoxylin (Sigma), dehydrated in ascending grades of ethanol and mounted from xylene with Permount (Fisher; Pittsburgh, PA).

2.6. Statistical analysis Statistical significance was determined by one-way ANOVA (Sigma Stat 2.03, Jandel Scientific Software, San Rafael, CA). Tukey’s test was used to assign individual differences. Where the data failed a normality test, significance was determined using a KruskalleWallis test. P < 0.05 was regarded as significant.

3. Results 3.1. Immunohistochemical localization of HBD1e3 and elafin in human placenta HBD1 (Fig. 1a, b), HBD2 (Fig. 1c, d) and HBD3 (Fig. 1e, f) were immunolocalized to the syncytiotrophoblast layer of term placental villi. HBD1 immunolocalization was variable with positive staining in only two of the six biopsies

examined. Elafin (Fig. 1g, h) was also present in the syncytiotrophoblast layer. HBD3 and elafin immunoreactivity was also present in the endothelial cells of blood vessels. Localization of each of the natural antimicrobials was similar in tissues collected from women who were not in labour (Fig. 1a, c, e, g) compared to those who had undergone spontaneous vaginal deliveries (Fig. 1b, d, f, h). Staining was absent from negative control sections (insets). 3.2. Immunohistochemical localization of HBD1e3 and elafin in human fetal membranes HBD1 (Fig. 2a, b), HBD2 (Fig. 2c, d), HBD3 (Fig. 2e, f) and elafin (Fig. 2g, h) were each immunolocalized to the chorion trophoblast layer of term fetal membranes. There was also immunostaining present in the amnion epithelium and decidua for each of the antimicrobials. HBD3 immunoreactivity was also present in fibroblast cells in the amnion mesenchyme (Fig. 2e, f). There were no obvious differences in the staining pattern between tissues from patients not in labour (Fig. 2a, c, e, g) or in spontaneous labour (Fig. 2b, d, f, h). Staining was absent from negative control sections (insets). 3.3. Regulation of HBD1, HBD2 and elafin in primary placental trophoblast cells Expression of HBD1, HBD2 and elafin mRNA was detected in cultured primary placental trophoblast cells by real-time quantitative RT-PCR. HBD2 and elafin mRNA expression increased in response to treatment with IL-1b by 104- (Fig. 3c; P < 0.05) and 27-fold (Fig. 3e; P < 0.03), respectively. There was a trend towards increased expression of HBD2 (Fig. 3d) and elafin (Fig. 3f) mRNA with increasing concentrations of TNFa although this did not reach significance. There was no change in elafin expression levels in response to treatment with LPS (data not shown). HBD1

Table 2 Details of immunohistochemical protocols used for immunolocalization of natural antimicrobials in human placenta and fetal membranes Non-immune block (in PBS)

Primary antibody

HBD1 HBD2 HBD3

Rabbit serum (1.5% v/v) Rabbit serum (1.5% v/v) Goat serum (1.5% v/v)

Elafin

Goat serum (20% v/v)

Goat anti-human HBD1 (N20; Santa Cruz) Goat anti-human HBD2 (C17; Santa Cruz) Rabbit anti-human HBD3 (Novus Biologicals, Littleton, CO) Rabbit anti-human elafin

FM ¼ fetal membranes; Pla ¼ placenta.

Primary antibody dilution

Biotinylated secondary antibody (all 0.5% v/v)

FM 1:600, Pla 1:100 FM 1:400, Pla 1:200 FM 1:3000, Pla 1:2000

Rabbit anti-goat IgG Rabbit anti-goat IgG Goat anti-rabbit IgG

FM 1:800, Pla 1:200

Goat anti-rabbit IgG

164

A.E. King et al. / Placenta 28 (2007) 161e169

Fig. 1. Immunohistochemical localization of HBD1e3 and elafin in human placenta from Caesarean section (not in labour) and spontaneous vaginal deliveries. Immunoreactivity for each antimicrobial is present in the syncytiotrophoblast layer. HBD1 expression was variable with only two of six biopsies expressing the protein. Elafin and HBD3 immunostaining was also present in endothelium. Insets show negative controls where the primary antibody was replaced with an equal concentration of an isotype control (note absence of staining). a, HBD1, not in labour. b, HBD1, spontaneous labour. c, HBD2, not in labour. d, HBD2, spontaneous labour. e, HBD3, not in labour. f, HBD3, spontaneous labour. g, elafin, not in labour. h, elafin, spontaneous labour. Scale bar, 100 mm.

A.E. King et al. / Placenta 28 (2007) 161e169

165

Fig. 2. Immunohistochemical localization of HBD1e3 and elafin in human fetal membranes from Caesarean section (not in labour) and spontaneous vaginal deliveries. Immunoreactivity for each antimicrobial is present in the chorion trophoblast layer. Additional immunostaining for each of the antimicrobials was present in the amnion epithelium and decidua of some samples. HBD3 immunoreactivity was also present in fibroblasts present in the amnion mesenchyme. Insets show negative controls where the primary antibody was replaced with an equal concentration of an isotype control (note absence of staining). a, HBD1, not in labour. b, HBD1, spontaneous labour. c, HBD2, not in labour. d, HBD2, spontaneous labour. e, HBD3, not in labour. f, HBD3, spontaneous labour. g, elafin, not in labour. h, elafin, spontaneous labour. Scale bar, 100 mm.

166

A.E. King et al. / Placenta 28 (2007) 161e169

Fig. 3. Regulation of natural antimicrobial mRNA expression in primary placental trophoblast cells. Data are presented as mean  S.E.M. Cells were treated with IL-1b (0.1, 1, 10 ng/ml) or TNFa (1, 10, 20 ng/ml). a, HBD1 mRNA expression, IL-1b dose response. n ¼ 5. b, HBD1 mRNA expression, TNFa dose response. n ¼ 4. c, HBD2 mRNA expression, IL-1b dose response. n ¼ 5. a: P < 0.05. d, HBD2 mRNA expression, TNFa dose response. n ¼ 4. e, elafin mRNA expression, IL-1b dose response. n ¼ 6. ab: P < 0.03. f, elafin mRNA expression, TNFa dose response. n ¼ 4.

mRNA expression was not altered significantly in the presence of either inflammatory cytokine (Fig. 3a, b). HBD1 and HBD2 mRNA expression were undetectable under basal conditions in several cell culture preparations. As a result of this, it was not possible to determine the effects of LPS on the expression of these molecules. 3.4. Regulation of HBD1, HBD2 and elafin in primary chorion trophoblast cells HBD2 mRNA expression in cultured primary chorion trophoblast cells was increased by 18-fold in response to treatment with IL-1b (Fig. 4c; P < 0.02) but elafin expression was not altered (Fig. 4e). TNFa (Fig. 4d, HBD2; Fig. 4f, elafin) and LPS (data not shown) had no significant effect on either HBD2 or elafin mRNA expression in chorion trophoblast

cells. HBD1 mRNA expression was not altered by treatment with IL-1b (Fig. 4a). The absence of HBD1 mRNA expression in several cell culture preparations meant that it was not possible to determine the effects of TNFa or LPS. 4. Discussion We have found that the chorion and placental trophoblast cells are major sources of endogenous antimicrobial molecules during human pregnancy. HBD1e3, along with elafin, an antiprotease and antimicrobial molecule, are expressed by both trophoblast layers at term suggesting that these molecules may have an important role in the protection of the uterus from infection. Additionally, the amnion epithelium and decidua expressed these antimicrobials. Previously, both amnion and chorion have been shown to have an inhibitory effect on

A.E. King et al. / Placenta 28 (2007) 161e169

167

Fig. 4. Regulation of natural antimicrobial mRNA expression in primary chorion trophoblast cells. Data are presented as mean  S.E.M. Cells were treated with IL1b (0.1, 1, 10 ng/ml) or TNFa (1, 10, 20 ng/ml). a, HBD1 mRNA expression, IL-1b dose response. n ¼ 4. b, HBD1 mRNA expression, TNFa dose response. c, HBD2 mRNA expression, IL-1b dose response. n ¼ 5. a: P < 0.02. d, HBD2 mRNA expression, TNFa dose response. n ¼ 4. e, elafin mRNA expression, IL-1b dose response. n ¼ 6. f, elafin mRNA expression, TNFa dose response. n ¼ 5.

the growth of several strains of bacteria and this was suggested to be due, in part, to the production of endogenous antimicrobials by these tissues [26]. The current data are consistent with previous studies which have suggested that both HBD1 and three are expressed at the mRNA level in placenta [15,16] and that HBD3 protein is present in the fetal membranes [17]. The WAP proteins, SLPI and elafin, are present in amnion and chorio-decidua [19e21]. While there are no previous data regarding elafin expression in placenta, SLPI has not been detected [20]. It is currently unclear whether there are changes to antimicrobial expression in the uterus with advancing gestation or in relation to placental pathophysiology. Parturition is widely regarded as an inflammatory event with increasing levels of proinflammatory cytokines and prostaglandins in amniotic fluid and infiltration of leukocytes into uterine tissues at the onset of labour [27,28]. In particular, mRNA

expression and amniotic fluid concentrations of the proinflammatory cytokines, IL-1b and TNFa, are upregulated at parturition [29e31]. Previous studies have shown that several antimicrobials, including HBD2 and elafin, are upregulated by inflammatory cytokines (such as IL-1b) both in cells derived from reproductive tissues [13,14,32] and in other systems such as lung [4,33]. Studies of natural antimicrobial expression in the non-pregnant endometrium show that peak expression of these molecules coincides with implantation and menstruation, both key reproductive events which have an associated inflammatory response [12e14]. The current data suggest that this is also the case during parturition with both HBD2 and elafin mRNA expression increasing in response to treatment with IL-1b in primary trophoblast cell cultures. There is also a trend towards increased expression of HBD2 and elafin mRNA in placental trophoblast cells in the presence of TNFa, although this effect

168

A.E. King et al. / Placenta 28 (2007) 161e169

was not significant at the concentrations tested. The highest concentration of TNFa (20 ng/ml) used is comparable to concentrations released by cultured placental cells from women at term and preterm labour [34]. These results suggest that elafin and HBD2 may be upregulated in the uterus around the time of labour in response to increasing levels of inflammatory cytokines. This would provide enhanced microbicidal activity at a time when the reproductive tract is likely to be particularly susceptible to infection. HBD1 is regarded as a constitutively expressed antimicrobial and is unaffected by the presence of inflammatory mediators [3]. Our results are in agreement with this thesis. It will be important to confirm that changes to natural antimicrobial protein expression are consistent with these changes to mRNA expression. Uterine infection is a major cause of preterm labour and is associated with around 30% of preterm deliveries [1]. Infection can occur at several sites within the uterus including between the chorion and amnion (chorioamnionitis) or, less commonly, within the placenta [35]. Inflammatory events within the uterus are particularly pronounced in cases of preterm labour associated with infection and there are much greater increases in inflammatory cytokine production than at term labour [27]. In addition to suggesting that there may be increased expression of antimicrobials at term labour, the cell culture data from these experiments also indicate that expression of these molecules is likely to be upregulated in response to inflammatory cytokine production as a result of uterine infection. Increased activation of the innate immune system may act to limit the spread of infection. Previous studies investigating the effects of the bacterial product, LPS, on natural antimicrobial expression in in vitro culture systems have provided contradictory findings. Several studies, including one using a vaginal epithelial cell line, have found that HBD2 expression is increased by LPS treatment [36,37]. Others have shown that LPS itself had little effect on HBD2 but that the presence of pathogenic bacteria did increase HBD2 levels [4]. In the current study, treatment of primary trophoblast cell cultures with LPS did not have any significant effect on the expression of HBD1, HBD2 or elafin. It is likely that the effects of LPS may be dependent on dose, time and the cell type investigated and it is unclear if cultured primary trophoblast cells express signaling molecules necessary for LPS detection, e.g. toll-like receptor 4, CD14 and LPS binding protein. However, TLR4 is expressed in trophoblast in vivo [38,39] and trophoblast cells have been shown to respond to LPS in vitro [40,41]. The placental and chorion trophoblast layers are key barriers to the progression of infection from the maternal blood and lower genital tract, respectively. The expression of molecules of the innate immune system by the trophoblast layers is likely to be crucial to the prevention and limitation of uterine infection. Toll-like receptors (TLR) are a family of pattern recognition receptors that respond to the presence of pathogen derived products (e.g. LPS, lipoteichoic acid) by activating the proinflammatory transcription factor, NFkB, resulting in the increased production of inflammatory molecules including cytokines, prostaglandins and natural antimicrobials. These upstream signaling receptors, responsible in part for the

control of antimicrobial expression, have been identified in both the chorion and placental trophoblast layers [38,39]. These studies, along with our current data, suggest that several components of the innate immune system are present in the uterus during pregnancy. The chorion trophoblast layer is likely to have a particularly critical role in preventing infection ascending from the vagina crossing the fetal membranes and reaching the amniotic fluid and fetus. It is interesting to note that studies examining the role of prostaglandin dehydrogenase, the enzyme responsible for the metabolism of PGE2 and PGF2a, have shown that there is a reduction in the number of chorion trophoblast cells in fetal membranes in cases of chorioamnionitis [42]. The loss of cells, which are a key source of antimicrobials, is likely to exacerbate infection. However, it remains unclear whether there are changes to expression of natural antimicrobial expression in placenta and fetal membranes at preterm labour or in the presence of uterine infection. Both the HBDs and elafin are multi-functional, having roles separate from their antimicrobial activity. HBDs have been shown to have chemoattractant activity and are involved in linking the innate and adaptive immune systems. For example, HBD2 is reported to attract immature dendritic cells via an interaction with the CCR6 receptor [5]. Elafin is an anti-protease molecule and has an inhibitory effect on neutrophil elastase [8]. It has also been shown to have chemotactic activity, both in vivo and in vitro, on neutrophils and macrophages [43,44]. Both elafin and SLPI have been shown to have reduced expression in the uterus in cases of premature rupture of membranes suggesting an important role in the regulation of protease activity within the fetal membranes [19,23]. In summary, we have demonstrated that the fetal membranes and placenta are key sources of natural antimicrobials in the uterus at term. The expression of selective natural antimicrobials can be upregulated in these tissues in response to inflammatory cytokines suggesting that they may be important during the process of parturition and in the event of uterine infection that would lead to preterm labour. Acknowledgements We are grateful to Dr. Liljiana Petrovic for her involvement in patient recruitment and tissue collection. AEK is supported by a Canadian Institutes of Health Research (CIHR) postdoctoral fellowship. This work was supported by the CIHR (ADB, JRGC). References [1] Challis JRG, Matthews SG, Gibb W, Lye SJ. Endocrine and paracrine regulation of birth at term and preterm. Endocr Rev 2000;21:514e50. [2] Hancock RE, Diamond G. The role of cationic antimicrobial peptides in innate host defences. Trends Microbiol 2000;8:402e10. [3] Krisanaprakornkit S, Weinberg A, Perez CN, Dale BA. Expression of the peptide antibiotic human beta-defensin 1 in cultured gingival epithelial cells and gingival tissue. Infect Immun 1998;66:4222e8. [4] Harder J, Meyer-Hoffert U, Teran LM, Schwichtenberg L, Bartels J, Maune S, et al. Mucoid Pseudomonas aeruginosa, TNF-alpha, and

A.E. King et al. / Placenta 28 (2007) 161e169

[5]

[6]

[7]

[8]

[9]

[10] [11] [12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22] [23]

[24]

IL-1beta, but not IL-6, induce human beta-defensin-2 in respiratory epithelia. Am J Respir Cell Mol Biol 2000;22:714e21. Yang D, Chertov O, Bykovskaia SN, Chen Q, Buffo MJ, Shogan J, et al. Beta-defensins: linking innate and adaptive immunity through dendritic and T cell CCR6. Science 1999;286:525e8. Hiemstra PS, Maassen RJ, Stolk J, Heinzel-Wieland R, Steffens GJ, Dijkman JH. Antibacterial activity of antileukoprotease. Infect Immun 1996;64:4520e4. Simpson AJ, Maxwell AI, Govan JR, Haslett C, Sallenave JM. Elafin (elastase-specific inhibitor) has anti-microbial activity against gram-positive and gram-negative respiratory pathogens. FEBS Lett 1999;452:309e13. Sallenave JM, Ryle AP. Purification and characterization of elastasespecific inhibitor. Sequence homology with mucus proteinase inhibitor. Biol Chem Hoppe Seyler 1991;372:13e21. Thompson RC, Ohlsson K. Isolation, properties, and complete amino acid sequence of human secretory leukocyte protease inhibitor, a potent inhibitor of leukocyte elastase. Proc Natl Acad Sci U S A 1986;83:6692e6. Williams SE, Brown TI, Roghanian A, Sallenave JM. SLPI and elafin: one glove, many fingers. Clin Sci (Lond) 2006;110:21e35. King AE, Critchley HOD, Kelly RW. Innate immune defences in the human endometrium. Reprod Biol Endocrinol 2003;1:116. Fleming DC, King AE, Williams AR, Critchley HOD, Kelly RW. Hormonal contraception can suppress natural antimicrobial gene transcription in human endometrium. Fertil Steril 2003;79:856e63. King AE, Critchley HOD, Sallenave JM, Kelly RW. Elafin in human endometrium: an antiprotease and antimicrobial molecule expressed during menstruation. J Clin Endocrinol Metab 2003;88:4426e31. King AE, Fleming DC, Critchley HOD, Kelly RW. Differential expression of the natural antimicrobials, beta-defensins 3 and 4, in human endometrium. J Reprod Immunol 2003;59:1e16. Jia HP, Schutte BC, Schudy A, Linzmeier R, Guthmiller JM, Johnson GK, et al. Discovery of new human beta-defensins using a genomics-based approach. Gene 2001;263:211e8. Zhao C, Wang I, Lehrer RI. Widespread expression of beta-defensin hBD-1 in human secretory glands and epithelial cells. FEBS Lett 1996;396:319e22. Buhimschi IA, Jabr M, Buhimschi CS, Petkova AP, Weiner CP, Saed GM. The novel antimicrobial peptide beta3-defensin is produced by the amnion: a possible role of the fetal membranes in innate immunity of the amniotic cavity. Am J Obstet Gynecol 2004;191:1678e87. Espinoza J, Chaiworapongsa T, Romero R, Edwin S, Rathnasabapathy C, Gomez R, et al. Antimicrobial peptides in amniotic fluid: defensins, calprotectin and bacterial/permeability-increasing protein in patients with microbial invasion of the amniotic cavity, intra-amniotic inflammation, preterm labor and premature rupture of membranes. J Matern Fetal Neonatal Med 2003;13:2e21. Tromp G, Kuivaniemi H, Romero R, Chaiworapongsa T, Kim YM, Kim MR, et al. Genome-wide expression profiling of fetal membranes reveals a deficient expression of proteinase inhibitor 3 in premature rupture of membranes. Am J Obstet Gynecol 2004;191:1331e8. Denison FC, Kelly RW, Calder AA, Riley SC. Secretory leukocyte protease inhibitor concentration increases in amniotic fluid with the onset of labour in women: characterization of sites of release within the uterus. J Endocrinol 1999;161:299e306. Zhang Q, Shimoya K, Moriyama A, Yamanaka K, Nakajima A, Nobunaga T, et al. Production of secretory leukocyte protease inhibitor by human amniotic membranes and regulation of its concentration in amniotic fluid. Mol Hum Reprod 2001;7:573e9. Hein M, Valore EV, Helmig RB, Uldbjerg N, Ganz T. Antimicrobial factors in the cervical mucus plug. Am J Obstet Gynecol 2002;187:137e44. Helmig BR, Romero R, Espinoza J, Chaiworapongsa T, Bujold E, Gomez R, et al. Neutrophil elastase and secretory leukocyte protease inhibitor in prelabor rupture of membranes, parturition and intra-amniotic infection. J Matern Fetal Neonatal Med 2002;12:237e46. Kliman HJ, Nestler JE, Sermasi E, Sanger JM, Strauss 3rd JF. Purification, characterization, and in vitro differentiation of cytotrophoblasts from human term placentae. Endocrinology 1986;118:1567e82.

169

[25] Sun K, Yang K, Challis JR. Differential regulation of 11 beta-hydroxysteroid dehydrogenase type 1 and 2 by nitric oxide in cultured human placental trophoblast and chorionic cell preparation. Endocrinology 1997;138:4912e20. [26] Kjaergaard N, Hein M, Hyttel L, Helmig RB, Schonheyder HC, Uldbjerg N, et al. Antibacterial properties of human amnion and chorion in vitro. Eur J Obstet Gynecol Reprod Biol 2001;94:224e9. [27] Keelan JA, Blumenstein M, Helliwell RJ, Sato TA, Marvin KW, Mitchell MD. Cytokines, prostaglandins and parturitionda review. Placenta 2003;24(Suppl. A):S33e46. [28] Kelly RW. Pregnancy maintenance and parturition: the role of prostaglandin in manipulating the immune and inflammatory response. Endocr Rev 1994;15:684e706. [29] Dudley DJ, Collmer D, Mitchell MD, Trautman MS. Inflammatory cytokine mRNA in human gestational tissues: implications for term and preterm labor. J Soc Gynecol Invest 1996;3:328e35. [30] Romero R, Mazor M, Sepulveda W, Avila C, Copeland D, Williams J. Tumor necrosis factor in preterm and term labor. Am J Obstet Gynecol 1992;166:1576e87. [31] Romero R, Parvizi ST, Oyarzun E, Mazor M, Wu YK, Avila C, et al. Amniotic fluid interleukin-1 in spontaneous labor at term. J Reprod Med 1990;35:235e8. [32] King AE, Fleming DC, Critchley HOD, Kelly RW. Regulation of natural antibiotic expression by inflammatory mediators and mimics of infection in human endometrial epithelial cells. Mol Hum Reprod 2002;8:341e9. [33] Sallenave JM, Shulmann J, Crossley J, Jordana M, Gauldie J. Regulation of secretory leukocyte proteinase inhibitor (SLPI) and elastase-specific inhibitor (ESI/elafin) in human airway epithelial cells by cytokines and neutrophilic enzymes. Am J Respir Cell Mol Biol 1994;11:733e41. [34] Steinborn A, Gunes H, Roddiger S, Halberstadt E. Elevated placental cytokine release, a process associated with preterm labor in the absence of intrauterine infection. Obstet Gynecol 1996;88:534e9. [35] Goldenberg RL, Hauth JC, Andrews WW. Intrauterine infection and preterm delivery. N Engl J Med 2000;342:1500e7. [36] Becker MN, Diamond G, Verghese MW, Randell SH. CD14-dependent lipopolysaccharide-induced beta-defensin-2 expression in human tracheobronchial epithelium. J Biol Chem 2000;275:29731e6. [37] Pivarcsi A, Nagy I, Koreck A, Kis K, Kenderessy-Szabo A, Szell M, et al. Microbial compounds induce the expression of pro-inflammatory cytokines, chemokines and human beta-defensin-2 in vaginal epithelial cells. Microbes Infect 2005;7:1117e27. [38] Holmlund U, Cebers G, Dahlfors AR, Sandstedt B, Bremme K, Ekstrom ES, et al. Expression and regulation of the pattern recognition receptors Toll-like receptor-2 and Toll-like receptor-4 in the human placenta. Immunology 2002;107:145e51. [39] Kim YM, Romero R, Chaiworapongsa T, Kim GJ, Kim MR, Kuivaniemi H, et al. Toll-like receptor-2 and -4 in the chorioamniotic membranes in spontaneous labor at term and in preterm parturition that are associated with chorioamnionitis. Am J Obstet Gynecol 2004;191:1346e55. [40] Okada T, Matsuzaki N, Sawai K, Nobunaga T, Shimoya K, Suzuki K, et al. Chorioamnionitis reduces placental endocrine functions: the role of bacterial lipopolysaccharide and superoxide anion. J Endocrinol 1997;155:401e10. [41] Shimoya K, Moriyama A, Matsuzaki N, Ogata I, Koyama M, Azuma C, et al. Human placental cells show enhanced production of interleukin (IL)-8 in response to lipopolysaccharide (LPS), IL-1 and tumour necrosis factor (TNF)-alpha, but not to IL-6. Mol Hum Reprod 1999;5:885. [42] van Meir CA, Matthews SG, Keirse MJ, Ramirez MM, Bocking A, Challis JRG. 15-Hydroxyprostaglandin dehydrogenase: implications in preterm labor with and without ascending infection. J Clin Endocrinol Metab 1997;82:969e76. [43] Sallenave JM, Cunningham GA, James RM, McLachlan G, Haslett C. Regulation of pulmonary and systemic bacterial lipopolysaccharide responses in transgenic mice expressing human elafin. Infect Immun 2003;71:3766e74. [44] Simpson AJ, Cunningham GA, Porteous DJ, Haslett C, Sallenave JM. Regulation of adenovirus-mediated elafin transgene expression by bacterial lipopolysaccharide. Hum Gene Ther 2001;12:1395e406.