Expression of novel splice variants of the G protein subunit, Goα, is tissue-specific and age-dependent in the rat

Gene 296 (2002) 249–255 www.elsevier.com/locate/gene

Expression of novel splice variants of the G protein subunit, Goa, is tissue-specific and age-dependent in the rat Jong Hyeon Yoo a,1, Young-Sang Yang a,1, Ilkuen Choi a, Yu Shangguan a, Il Song a, Richard R. Neubig b, John W. Wiley a,* a

Department of Internal Medicine, Gastrointestinal Peptide Research Center, University of Michigan, Ann Arbor, MI 48109-0368, USA b Department of Pharmacology, University of Michigan, Ann Arbor, MI 48109-0368, USA Received 8 June 2002; received in revised form 15 July 2002; accepted 29 July 2002 Received by J.L. Slightom

Abstract Heterotrimeric G proteins play an essential role in coupling numerous surface membrane receptors to intracellular signal transduction pathways. Relatively little is known about the splice variants of G proteins, including whether they undergo differential expression as a function of aging. We screened for splice variants of the a subunit of the dominant inhibitory G protein family member Go in a variety of tissues from rat and examined the expression of these splice variants during development. The splice variants were characterized using specific primers for Goa1 and Goa2 in conjunction with reverse transcription–polymerase chain reaction, and subsequently sequenced. Goa1 expression dominated over Goa2 in all neuronal tissues screened, including cerebral cortex, pituitary, spinal cord, colon myenteric plexus, dorsal root ganglion, and prenatal cortex. The sequence data of Goa1 supports the presence of three splice variants: Goa1a, Goa1b, Goa1c. The Goa1a variant was reported previously [J. Biol. Chem. 262 (1987) 14241], whereas Goa1b and Goa1c represent novel variants. The Goa1b splice variant demonstrates a 94 bp deletion using a cryptic donor site in exon 10. The Goa1c variant demonstrates a complete deletion of exon 10. A protein product with a molecular weight of ,34 kDa consistent with that expected for Goa1c was identified using Western blot analysis and two-dimensional gel electrophoresis. The expression of Goa1a decreased postnatally, supporting a potential physiological role during fetal development, whereas Goa1c expression increased postnatally. The age-dependent and tissue-specific expression of the Goa1 splice variants presage a broader functional role than has been observed historically with Go. q 2002 Published by Elsevier Science B.V. Keywords: Exon/intron; Alternative splicing; a subunit; Development; C-terminal region

1. Introduction Guanine nucleotide-binding (G) proteins play an essential role in the signal transduction of numerous extracellular ligands that bind to specific cell surface receptors. The protein Go is the most abundant G protein in the mammalian nervous system (Offermanns, 2001). Studies in Goa-deficient mice and primary neurons in culture indicate that Goa plays an important role in the regulation of neuronal

Abbreviations: bp, base pair(s); cDNA, DNA complementary to RNA; mRNA, messenger RNA; nt, nucleotide(s); RT–PCR, reverse transcription–polymerase chain reaction; DRG, dorsal root ganglion; CNS, central nervous system; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; 2D, two-dimensional; MW, molecular weight * Corresponding author. Department of Internal Medicine, General Clinical Research Center, A7119 UH, University of Michigan, Ann Arbor, MI 48109-0108, USA. Tel.: 11-734-936-8080; fax: 11-734-936-4024. E-mail address: [email protected] (J.W. Wiley). 1 These authors contributed equally to this study. 0378-1119/02/$ - see front matter q 2002 Published by Elsevier Science B.V. PII: S 0378-111 9(02)00866-1

calcium signaling (Zamponi and Snutch, 1998), as well as in pain perception and motor behavior (Jiang et al., 1998). One gene codes for the Goa subunit, which gives rise in brain to two known mRNA splice variants, Goa1 and Goa2 (Strathmann et al., 1990; Hsu et al., 1990; Murtagh et al., 1994). Protein characterization studies support the existence of at least four Goa isoforms, GoaA, -B, -C, and the less well-described GoaD (McIntire et al., 1998; Kobayashi et al., 1989; Spicher et al., 1991; Nurnberg et al., 1994). Immunological evidence and peptide mapping suggest that GoaB and GoaD are protein products of the Goa2 mRNA, whereas GoaA and GoaC are translated from the Goa1 mRNA (Inanobe et al., 1990; Shibasaki et al., 1991; Spicher et al., 1991). Several groups have described a GoaC-like protein that is abundantly expressed in the cerebral cortex (Scherer et al., 1987; Granneman and Kapatos, 1990; Li et al., 1995). Attempts to clarify how GoaC differs from the immunologically related GoaA have led to different conclusions. For example, it has been suggested that GoaC differs from GoaA at the N-terminus and that it exists as an unmyristoylated

250

J.H. Yoo et al. / Gene 296 (2002) 249–255

Fig. 1. Locations of oligonucleotide primers used for PCR.

form of the protein. Others have observed identical Ntermini in GoaA, -B, and -C, but a difference in a region of the C-terminus between GoaA and GoaC, analogous to the difference between GoaA and GoaB (McIntire et al., 1998). The structural difference is localized to a part of the protein that would predict different interactions of GoaA and GoaC with receptors or effectors. GoaA and GoaC protein do not differ significantly in mass, despite different mobilities on urea/sodium dodecyl sulfate (SDS)–polyacrylamide gel electrophoresis. Little is known about the expression of Goa splice variants, including whether expression changes during development or whether expression is tissue-specific. In preliminary studies examining the tissue-specific expression of splice variants of Goa during development, we observed two potentially novel splice variants of Goa1 (Song et al., 2000). It is noteworthy that the Goa1 mRNA and its protein products appear to be the most abundant forms of Go expressed in brain cortex. The goals of the current study were fourfold: (1) confirm the existence of novel splice variants of Goa1 based on RT– PCR analysis; (2) assess the expression of the splice variants during development; (3) determine if the expression of the splice variants is tissue-specific, and (4) assess whether putative splice variants of Goa1 can be distinguished on Western blot analysis and 2-D gel electrophoresis.

2. Materials and methods 2.1. PCR cloning of gene splice variants PCR cloning was performed with total RNA (10 mg) from

an adult rat brain and a fetal rat brain cDNA library (Clontech) using strategically designed oligonucleotide primers (Fig. 1 and Table 1), as previously reported (Song et al., 1993). Internal primers GOA13 and GO11 were used for PCR, using the first PCR product as the template with the Goa1 primers GO and GO1BA. The resulting PCR bands were subcloned into M13mp18 and sequenced by dideoxy chain termination method (Sanger et al., 1977). Oligonucleotide primers for sequencing and for PCR (Table 1) were synthesized on a DNA synthesizer (Applied Biosystems-380B). Nucleotide sequences were analysed using the Genetics Computer Group program (Biotechnology Center, University of Wisconsin, Madison, WI). 2.2. Two-dimensional gel electrophoresis and Western blot analysis Lysate for protein expression of Goa1 isoforms was prepared from an adult rat brain, as previously reported (Hall et al., 2001). Two-dimensional gel electrophoresis was performed according to the method of O’Farrell (1975) by Kendrick Labs Inc. (Madison, WI) as follows: isoelectric focusing (IEF) was carried out in a glass tube of 2.0 mm inner diameter using 2% pH 3.5–10 (LKB/Pharmacia) for 9600 V-h. Tropomyosin (1 mg), an IEF internal standard, was added to the sample. This protein migrates as a doublet with a lower polypeptide spot of MW 33,000 and pI 5.2. The pH gradient plot was determined with a surface pH electrode. After equilibration for 10 min in a buffer containing 10% glycerol, 50 mM dithiothreitol, 2.3% SDS, and 0.0625 M Tris (pH 6.8), the tube gel was sealed to the top of a stacking gel overlaid on a 10% acrylamide slab gel (0.75 mm). SDS slab gel electrophoresis was carried

Table 1 Sequence of oligonucleotide primers used for PCR a Name

Orientation

Location

Specific

Sequence (5 0 ! 3 0 )

GO GO1B GO2B GOM GO1A GO2C GO1BA GO11 GOA13

Sense Antisense Antisense Sense Antisense Antisense Antisense Antisense Sense

Exon 1 Exon 11 Exon 11 Exon 5/6 Exon 10/11 Exon 10/11 Exon 11 Exon 11 Exon 6

Goa1, Goa2 Goa1 Goa2 Goa1, Goa2 Goa1 Goa2 Goa1 Goa1 Goal, Goa2

GGCAGGGAAGGGGCCACCATGGG CAACAGCAAAGAGTCCATGAAGCAG CCTCAGTGCACAGAGCATCGAGTGG CAGGCTGTTTGATGTTGGGGGCCAG TGAAGCAGTCAAATAGGTTGCTA GCAGAGCTCTGGGTCCAGGGGAGAAG AACATCAACAGCAAAGAGTCCATGAAG CATCAACAGCAAAGAGTCCATGAAGCAG CCAGGTGCTCCACGAGGACGAAACCAC

a

Primers GO, GOM, GO2C, GO11 and GOA13 possess a SalI site at their 5 0 end. Primer GO1A possesses an EcoRI site at its 5 0 end.

J.H. Yoo et al. / Gene 296 (2002) 249–255

out for 4 h at 12.5 mA per gel. After electrophoresis, the gel was placed in a transfer buffer (12.5 mM Tris (pH 8.8), 86 mM glycine, 10% MeOH) and transblotted onto PVDF paper overnight at 200 mA and 100 V per two gels. The following proteins (Sigma Chemical Co., St. Louis, MO) were added as MW standards to a well in the agarose that sealed the tube gel to the slab gel: myosin (220,000), phosphorylase A (94,000), catalase (60,000), actin (43,000), carbonic anhydrase (29,000) and lysozyme (14,000). The

251

blots were stained with Coomassie Brilliant Blue R-250 and scanned on a desktop scanner. The blots were then blocked for 2 h in 5% Carnation nonfat dry milk (NFDM) in Tween-20 Tris-buffered saline (TTBS) and rinsed in TTBS. One blot was incubated in primary antibody K-20 (Santa Cruz Biotechnology), directed to the mid-portion of Goa1 in exon 4; KMVCDVVSRMEDTEPFSAEL, diluted 1:3000 in 2% NFDM in TTBS overnight, and rinsed three times for 10 min in TTBS. The other blot was incubated in

Fig. 2. PCR cloning and the nucleotide sequence of rat Goa1 splice variants. (A) The cloned PCR bands. The resulting PCR bands of a fetal rat brain cDNA library and an adult rat brain obtained from primers GOA13 and GO11 using the PCR products of primers GO and GO1BA were subcloned into the M13 vector. The PCR band a was identical to the previously reported sequence of Goa1 (Jones and Reed, 1987). The PCR bands b and c were novel splice variants designated Goa1b and Goa1c, respectively. (B) Gene splice junctions by identified sequencing. Asterisks indicate the nucleotide sequence of junction sites for each exon (shaded rectangles) and nucleotide numbers are based on Goa1 (GenBank accession no. M17526). (C) The nucleotide sequence and deduced amino acid sequence of rat Goa1 splice variants. The nucleotide sequence is numbered on the left and amino acids are designated with single-letter symbols below each triplet codon. Goa1b results from use of a cryptic donor site at nt 304 in exon 10, causing a deletion of 94 bp shown in italics at nt 304–397. The other splice variant, Goa1c, loses exon 10 and contains exon 11. Underlined asterisks indicate the stop codon. The Goa1b and Goa1c sequences have been deposited in the GenBank database under accession numbers AF413211 and AF413212, respectively.

252

J.H. Yoo et al. / Gene 296 (2002) 249–255

primary antibody NEI-803 (NEN Life Science Products Inc.), directed to the C-terminal sequence from rat Gia3; KNNLKECGLY, diluted 1:1000 in 2% NFDM in TTBS overnight, and rinsed three times for 10 min in TTBS. We used NEI-803 because it also recognizes Goa1 protein (Kinoshita et al., 2001). Both blots were incubated in the secondary antibody (horseradish peroxidase-linked antirabbit donkey IgG, NA934, Amersham Pharmacia Biotech), diluted 1:2000 in 2% NFDM for 2 h, and rinsed three times for 10 min in TTBS. The blots were visualized by enhanced chemiluminescence and exposed to Kodak Biomax film.

2.3. Expression of alternative splicing during development RT–PCR was performed with total RNA (10 mg) from various tissues (brain, pituitary, spinal cord, colon myenteric plexus, DRG, cultured DRG, brain cortex, and liver). Splice variants of Goa1 were first amplified with primers GO and GO1B, then with internal primers GOM and GO1A using the first PCR product as the template. Goa2 was first amplified with primers GO and GO2B, then with internal primers GOM and GO2C using the first PCR product as the template. To examine the expression of Goa1 splice variants during development, we compared the expression of the splice variants at the following time points: prenatal (24 days), postnatal (14 days), and adult (6 months). Primers GOA13 and GO11 were used for PCR with the template obtained from primers GO and GO1BA. PCR was performed with Taq polymerase (Promega) through 30 cycles of denaturation (1 min at 94 8C), annealing (2 min at 50 8C), and extension (1 min at 72 8C), with a final extension period of 10 min at 72 8C. The splice variants were identified and analysed using the same methods previously described in Section 2.1.

3. Results 3.1. PCR cloning of gene splice variants Three PCR bands of 445, 332, and 231 bp, shown in Fig. 2A (a, b, and c), are from a fetal rat brain cDNA library and an adult rat brain obtained from primers GOA13 and GO11. Identification of the gene splice variants revealed that band a was identical to the previously reported Goa1 sequence (Jones and Reed, 1987). The PCR bands b and c indicated the presence of novel splice variants, which we designated Goa1b and Goa1c, respectively. Asterisks in Fig. 2B indicate the nucleotide sequence of junction sites in exons 9 and 10 for Goa1a; exons 10 and 11 for Goa1b; exons 9 and 11 for Goa1c. The nucleotide numbers are based on the published data describing Goa1 (GenBank accession no. M17526). The splice variant Goa1b (Fig. 2C) is produced by the use of a cryptic donor site at nt 304 in exon 10, which results in the deletion of 94 bp (nt 304–397) from exon 10 with splicing to exon 11. The other splice variant, Goa1c, represents a direct splicing from exon 9 to exon 11 with the deletion of exon 10. In contrast to Goa1, which is the source of all three splice variants, the isoform Goa2 uses exons 7 and 8 in place of exons 9 and 10 (Fig. 3A). The ATG translation initiation codon is located in exon 1 in both Goa1 and Goa2, whereas the stop codon appears to be located in different exons (Fig. 3A). The major differences in the deduced protein structure between the Goa1 isoforms we studied exist in the C-termini and are caused by translation frameshifts resulting from splicing in the region of exon 10 (Fig. 3B). 3.2. Two-dimensional gel electrophoresis and Western blot analysis To determine whether the alternatively spliced mRNA was expressed at the protein level, 2-D gel electrophoresis

Fig. 3. Structure and amino acid comparison of Goa splice variants. (A) Structure of Goa splice variants. Goa1a uses exons 9 and 10 in place of exons 7 and 8, whereas Goa2 contained these exons in place of exons 9, 10, and 11. Goa1b contained the same exons as Goa1a except for a deletion of 94 bp in exon 10. Goa1c loses exons 7, 8, and 10. Asterisks indicate the stop codon. (B) Amino acid comparison of Goa1 splice variants. The major amino acid differences in the Ctermini between the variants are highlighted in shaded boxes. The numbers on the right indicate the number of amino acids and predicted MW for each variant.

J.H. Yoo et al. / Gene 296 (2002) 249–255

253

Fig. 4. Detection of Goa1 proteins by 2-D gel electrophoresis and Western blot analysis. Rat brain lysates were separated by 2-D gel electrophoresis and stained with Coomassie Blue (A) or processed for Western blot analysis using polyclonal anti-Go mid-portion (B) or C-terminal antibodies (C). The inset in (A) corresponds to the regions shown in the Western blots (B,C). The pH of the detected proteins ranged from 6 to 8.

was performed (Fig. 4A). Goa1 was detected by Western blot analysis using polyclonal anti-Go antibodies directed against the mid-portion (Fig. 4B) and the C-terminal (Fig. 4C) of the protein. The mid-portion antibody should detect the predicted protein products of all three Goa1 mRNAs and Goa2 as shown in Fig. 4. The relatively dense band at 39

kDa in Fig. 4B corresponds to both Goa1a and Goa1b, as there is only a small difference in the MW between these two variants. The internal antibody also detects a spot at ,34 kDa, consistent with the expected mass of the Goa1c protein product. Only a 39 kDa protein was detected using the C-terminal antibody, an expected result, since it would not recognize the C-terminus of the modified Goa1c. These results indicate that a protein with properties consistent with expression of the Goa1c transcript is present in adult rat brain. 3.3. Expression of alternative splicing during development Goa1 mRNA expression exceeded that for Goa2 in all screened tissues, including cerebral cortex, pituitary, spinal cord, colon myenteric plexus, DRG, and prenatal cortex (Fig. 5). Sequence data supported the presence of three

Fig. 5. Expression of Goa splice variants in neuronal (A) and non-neuronal (B) tissues. Splice variants of Goa1a and Goa1c were first amplified with primers GO and GO1BA, and then with internal primers GOA13 and GO11 using the first PCR product as the template. Goa2 was first amplified with primers GO and GO2B, and then with internal primers GOM and GO2C using the first PCR product as the template. GAPDH served as an internal control. MP, myenteric plexus; CDRG, cultured DRG; P. cortex, prenatal cortex.

Fig. 6. Expression of Goa1 splice variants at three stages of developmental. RT–PCR demonstrates the kinetics of mRNA expression in brain using primers GOA13 and GO11. GAPDH served as an internal control.

254

J.H. Yoo et al. / Gene 296 (2002) 249–255

Goa1 splice variants. We believe that Goa1b and Goa1c represent new splice variants. Expression of the Goa1a variant mRNA decreased during the transition from the late prenatal to the postnatal stage of development, whereas Goa1c mRNA increased during this period (Fig. 6). Expression of Goa1b mRNA was relatively less than that of the other two splice variants and did not change significantly during the stages of development we examined.

4. Discussion One gene encodes for the Goa subunit, but previous research has demonstrated that alternative splicing produces two mRNA products, Goa1 and Goa2, which differ by alternative use of the final two exons 7/8 and 9/10. Our results extend the work of McIntire et al. (1998), who reported that Goa1 and its splice variants appear to be the most abundant form of Go expressed in brain. Our study shows that Goa1 mRNA is the most abundant form expressed in the peripheral as well as the central nervous system. The Western blot analysis presented in Fig. 4 suggests that the level of protein expression of Goa1a and Goa1b are greater than the expression of Goa1c. This can be contrasted with the PCR analysis of the splice variants in adult brain depicted in Fig. 2A that demonstrates comparatively robust expression of Goa1c mRNA relative to Goa1a and Goa1b. The differences in the Western and PCR studies may reflect differences in antibody affinity for the splice variants. This could result from differential post-transcriptional or posttranslational processing of the splice variants. The two novel splice variants Goa1b and Goa1c reported here have much more substantial structural changes than do previously published Goa isoforms (Shibasaki et al., 1991; Spicher et al., 1991; Wilcox et al., 1995). The complete replacement of the amino acid sequences in the C-terminal end of Goa1b and Goa1c would be expected to dramatically alter or even abolish interactions with receptors, since those residues play a critical role in receptor interactions (Conklin et al., 1993). The functional significance of these sequence alternations will be determined by further direct investigations. We believe that one of the potentially important observations in the current study is the relatively ubiquitous expression of the Goa1c splice variant in neuronal and nonneuronal tissues that increases postnatally. This observation may indicate a physiological role for this splice variant within and outside the nervous system. Previous studies support the importance of Go in the brain where it is the most abundant G protein with a well-documented role in various functions, including the inhibition of voltage-gated calcium channels (Sternweis and Robishaw, 1984; Hescheler and Schultz, 1994). Future investigations may also elucidate the effects of the structural changes embodied in the novel Goa splice variants on nucleotide binding and interactions with b/g

subunits and other potential effectors. The crystal structure of the G protein heterotrimer (a,b/g) reveals two non-overlapping regions of contact between the a and b subunits (Lambright et al., 1996; Wall et al., 1995). The contacting residues of the a and b subunits are mostly conserved residues, not directly involved with the C-terminus of the a subunit. The effects of the structural changes in Goa1b and Goa1c on their tertiary structures, nucleotide binding, and interactions with b/g subunits and other potential effectors are not yet clear. If the new splice variants are capable of interacting with b/g subunits, but the resulting heterotrimers cannot be activated by receptors, they could serve as developmentally regulated, endogenous, dominant-negative proteins for a and b/g signaling. Acknowledgements These studies were supported by NIH R01 DK52387 and RO1 DK56997 to J.W.W. and DK-99-017 to Gastrointestinal Peptide Research Center. References Conklin, B.R., Farfel, Z., Lustig, K.D., Julius, D., Bourne, H.R., 1993. Substitution of three amino acids switches receptor specificity of Gq alpha to that of Gi alpha. Nature 363, 274–276. Granneman, J.G., Kapatos, G., 1990. Developmental expression of Go in neuronal cultures from rat mesencephalon and hypothalamus. J. Neurochem. 54, 1995–2001. Hall, K.E., Liu, J., Sima, A.A., Wiley, J.W., 2001. Impaired inhibitory Gprotein function contributes to increased calcium currents in rat with diabetic neuropathy. J. Neurophysiol. 86, 760–770. Hescheler, J., Schultz, G., 1994. Heterotrimeric G proteins involved in the modulation of voltage-dependent calcium channels of neuroendocrine cells. Ann. N. Y. Acad. Sci. 733, 306–312. Hsu, W.H., Rudolph, U., Sanford, J., Bertrand, P., Olate, J., Nelson, C., Moss, L.G., Boyd, A.E., Codina, J., Birnbaumer, L., 1990. Molecular cloning of a novel splice variant of the a subunit of the mammalian Go protein. J. Biol. Chem. 265, 11220–11226. Inanobe, A., Shibasaki, H., Takahashi, K., Kobayashi, I., Tomita, U., Ui, M., Katada, T., 1990. Characterization of four Go-type proteins purified from bovine brain membranes. FEBS Lett. 263, 369–372. Jiang, M., Gold, M.S., Boulay, G., Spicher, K., Peyton, M., Brabet, P., Srinivasan, Y., Rudolph, U., Ellison, G., Birnbaumer, L., 1998. Multiple neurological abnormalities in mice deficient in the G protein Go. Proc. Natl. Acad. Sci. USA 95, 3269–3274. Jones, D.T., Reed, R.R., 1987. Molecular cloning of five GTP-binding protein cDNA species from rat olfactory neuroepithelium. J. Biol. Chem. 262, 14241–14249. Kinoshita, M., Nukada, T., Asano, T., Mori, Y., Akaike, A., Satoh, M., Kaneko, S., 2001. Binding of Gao N-terminus is responsible for the voltage-resistant inhibition of a1A (P/Q-type, CaV2.1) Ca 21 channels. J. Biol. Chem. 276, 28731–28738. Kobayashi, I., Shibasaki, H., Takahashi, K., Kikkawa, S., Ui, M., Katada, T., 1989. Purification of GTP-binding proteins from bovine brain membranes. Identification of heterogeneity of the alpha-subunit of Go proteins. FEBS Lett. 257, 177–180. Lambright, D.G., Sondek, J., Bohm, A., Skiba, N.P., Hamm, H.E., Sigler, P.B., 1996. The 2.0 A crystal structure of a heterotrimeric G protein. Nature 379, 311–319. Li, P.P., Andreopoulos, S., Wong, C.C., Vecil, G.G., Warsh, J.J., 1995.

J.H. Yoo et al. / Gene 296 (2002) 249–255 Effect of thyroid deficiency on Go alpha-subunit isoforms in developing rat cerebral cortex. Neurochem. Res. 20, 1249–1255. McIntire, W.E., Dingus, J., Schey, K.L., Hildebrandt, J.D., 1998. Characterization of the major bovine brain Goa isoforms. Mapping the structural differences between the alpha subunit isoforms identifies a variable region of the protein involved in receptor interactions. J. Biol. Chem. 273, 33135–33141. Murtagh Jr, J.J., Moss, J., Vaughan, M., 1994. Alternative splicing of the guanine nucleotide-binding regulatory protein Go alpha generates four distinct mRNAs. Nucleic Acids Res. 22, 842–849. Nurnberg, B., Spicher, K., Harhammer, R., Bosserhoff, A., Frank, R., Hilz, H., Schultz, G., 1994. Purification of a novel G-protein alpha o-subtype from mammalian brain. Biochem. J. 300, 387–394. O’Farrell, P.H., 1975. High resolution two-dimensional electrophoresis of proteins. J. Biol. Chem. 250, 4007–4021. Offermanns, S., 2001. In vivo functions of heterotrimeric G-proteins: studies in G alpha-deficient mice. Oncogene 20, 1635–1642. Sanger, F., Nicklen, S., Coulson, A.R., 1977. DNA sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463–5467. Scherer, N.M., Toro, M.J., Entman, M.L., Birnbaumer, L., 1987. G-protein distribution in canine cardiac sarcoplasmic reticulum and sarcolemma: comparison to rabbit skeletal muscle membranes and to brain and erythrocyte G-proteins. Arch. Biochem. Biophys. 259, 431–440. Shibasaki, H., Kozasa, T., Takahashi, K., Inanobe, A., Kaziro, Y., Ui, M., Katada, T., 1991. Amino acid sequence determination of the novel forms of Go alpha purified from bovine brain membranes. FEBS Lett. 285, 268–270.

255

Song, I., Brown, D.R., Wiltshire, R.N., Gantz, I., Trent, J.M., Yamada, T., 1993. The human gastrin/cholecystokinin type B receptor gene: alternative splice donor site in exon 4 generates two variant mRNAs. Proc. Natl. Acad. Sci. USA 90, 9085–9089. Song, I., Yoo, J.H., Hall, K.E., Wiley, J.W., 2000. Expression and function of Go alpha splice variants changes developmentally and in culture in rat primary neurons. Gastroenterology 118 (4 Suppl. 2), 1188. Spicher, K., Klinz, F.J., Rudolph, U., Codina, J., Birnbaumer, L., Schultz, G., Rosenthal, W., 1991. Identification of the G-protein alpha-subunit encoded by alpha o2 cDNA as a 39kDa pertussis toxin substrate. Biochem. Biophys. Res. Commun. 175, 473–479. Sternweis, P.C., Robishaw, J.D., 1984. Isolation of two proteins with high affinity for guanine nucleotides from membranes of bovine brain. J. Biol. Chem. 259, 13806–13813. Strathmann, M., Wilkie, T.M., Simon, M.I., 1990. Alternative splicing produces transcripts encoding two forms of the a subunit of GTP-binding protein Go. Proc. Natl. Acad. Sci. USA 87, 6447–6481. Wall, M.A., Coleman, D.E., Lee, E., Iniguez-Lluhi, J.A., Posner, B.A., Gilman, A.G., Sprang, S.R., 1995. The structure of the G protein heterotrimer Gi alpha 1 beta 1 gamma 2. Cell 83, 1047–1058. Wilcox, M.D., Dingus, J., Balcueva, E.A., McIntire, W.E., Mehta, N.D., Schey, K.L., Robishaw, J.D., Hildebrandt, J.D., 1995. Bovine brain Go isoforms have distinct g subunit compositions. J. Biol. Chem. 270, 4189–4192. Zamponi, G.W., Snutch, T.P., 1998. Modulation of voltage-dependent calcium channels by G proteins. Curr. Opin. Neurobiol. 8, 351–356.