- Email: [email protected]
Expression of PPAR and RXR Isoforms in the Developing Rat and Human Term Placentas
Placenta (2002), 23, 661–671 doi:10.1053/plac.2002.0855, available online at http://www.idealibrary.com on
Expression of PPAR and RXR Isoforms in the Developing Rat and Human Term Placentas Q. Wanga, H. Fujiib and G. T. Knippa,c a
Department of Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers, The State University of New Jersey, 160 Frelinghuysen Road, Piscataway, NJ 08854-8022, USA; b Department of Biochemistry, Niigata University School of Medicine, Niigata 951, Japan Paper accepted 31 May 2002
Placental fatty acid transfer is critical to meet the foetal requirements necessary for the biosynthesis of biological membranes, myelin, and various signaling molecules. The primary objective of this research was to elucidate the placental expression patterns of genes that may potentially regulate placental fatty acid transfer and homeostasis. In this study, we have elucidated the temporal and spatial patterns of expression of peroxisome proliferator-activated receptor (PPAR) and 9-cis retinoic acid receptor (RXR) isoforms in the junctional and labyrinth zones of the developing rat chorioallantoic placenta and in human term placenta. PPAR (, , and ) and RXR (, , and ) isoforms are nuclear hormone receptors that are known to regulate gene transcription and protein expression levels of fatty acid transport and metabolism mediating proteins through the formation of a DNA binding heterodimer complex. In the present study, the expression patterns of PPAR and RXR isoforms were determined in developing rat placenta and human term placenta using RT-PCR and immunohistochemical analyses. PPAR, , , RXR, and were expressed in both junctional (invasive/endocrine function) and labyrinth (transport barrier) zones of the rat placenta, from day 13 to day 21 of gestation. In the human term placenta, PPAR, , , RXR and were observed, while RXR was not detected. Immunocytochemistry staining results determined the presence of PPAR, , , RXR and to be specific to the syncytial trophoblast layer of the human chorionic villi. The presence of PPAR and RXR isoforms in both the rat and human placentas suggest that PPAR and RXR isoforms are potential regulators of placental lipid transfer and homeostasis. Our work provides a framework for the further investigation of PPAR and RXR isoform specific regulation of placental fatty acid uptake, transport and metabolism. 2002 Elsevier Science Ltd. All rights reserved. Placenta (2002), 23, 661–671
INTRODUCTION The placenta acts as the barrier between the maternal and foetal circulatory systems and plays an important role in the development and growth of the foetus (Soares, 1997; Knipp et al., 1999). There are several major functions performed by the placenta including: uterine wall invasion, evasion of the maternal immune system, mediation of the placental-uterine microenvironment by hormonal secretions, and regulating bi-directional maternal and foetal nutrient and waste transport (Faria and Soares, 1991; Hoggard et al., 1997; Soares, 1997; Flynn et al., 1998). The placental functions are performed by several different trophoblast cell types, which differ in morphological and functional properties (Soares, Handwerger and Talamantes, 1993; Soares, 1997). c
To whom correspondence should be addressed at: Department of Pharmaceutics, Rutgers University, 160 Frelinghuysen Road, Piscataway, NJ 08854-8022, USA. Tel.: (732) 445-2669; Fax: (732) 445-3134; E-mail: [email protected] 0143–4004/02/$-see front matter
The rat placenta has been widely used as a model to study placental development. Briefly, the rat placenta is composed of two distinct zones, the junctional zone (invasion and endocrine function) and the labyrinth zone (transport barrier) (Knipp et al., 1999). The junctional zone is adjacent to the maternal compartment and is mainly involved in uterine wall invasion and the production of hormones/cytokines. The labyrinth zone is the main barrier to diffusion and acts to regulate the transfer of nutrients and wastes between the maternal and foetal compartments. Of note is the fact that syncytial trophoblast cells form the transport barriers in both the rat and human placentas (Ogata, Lane and Simmons, 1997). The primary interest to our laboratory is to expand our understanding of the regulation of transplacental fatty acid homeostasis and its role in guiding proper foetal development. Fatty acids are of critical importance in normal development of the foetus, due to the fact that fatty acids serve as obligatory constituents of biological membranes (Uauy, Mena and Valenzuela, 1999), concentrated fuel storage (Uauy and 2002 Elsevier Science Ltd. All rights reserved.
662
Hoffman, 2000), and precursors of intracellular signalling molecules (Narumiya and Fukushima, 1986). In addition, insufficient fatty acid supply has been demonstrated to result in foetal intrauterine growth retardation (IUGR), foetal facial dysmorphology and severe postnatal growth retardation (Abel, 1984; West, 1994; Denkins et al., 2000). Central to these observations is the role of the placenta in influencing bi-directional transfer of fatty acids between the maternal and foetal circulations. Fatty acids are hydrophobic, and depending on their physicochemical properties, may passively diffuse into cells across the lipid bilayer membrane (Hamilton, 1998; Hamilton and Kamp, 1999). However, the capacity of fatty acid transfer by free diffusion is limited and not sufficient to satisfy the demand of the developing foetus. Therefore, a facilitative, directional transfer of fatty acids from the maternal circulation to the foetus is required to properly meet foetal demands. Consistent with this observation, Hornstra et al. demonstrated that fatty acid transport is highly directional, with a strong preference in the direction from the mother to the foetus (Hornstra et al., 1995). Dutta-Roy and other investigators have demonstrated that there exists a preference for transporting long-chain polyunsaturated fatty acid (LCPUFAs) over nonessential fatty acids in the human placenta and in BeWo cells, a human choriocarcinoma cell line (Campbell et al., 1997; Campbell et al., 1998; Dutta-Roy, 2000). This observation cannot be explained by simple diffusion of fatty acids alone. Recently, several fatty acid transport proteins have been found in the rat and human placentas and in in vitro trophoblast cell culture models (Campbell, Gordon and Dutta-rov, 1994; Crabtree et al., 1998; Dutta-Roy, 2000; Knipp et al., 2000). These proteins were identified as plasma membrane fatty acid binding protein (FABPpm), fatty acid translocase (FAT), fatty acid transport protein (FATP) and members of cytosolic fatty acid binding proteins (FABPs). All of these proteins are known to function as fatty acid transferring proteins in other tissues and their expression in the both the rat and human placentas have been shown. However, the regulation of fatty acid transport across the placenta remains to be elucidated. In recent years, it has become clear that fatty acids act in an autocrine manner to regulate their metabolism, uptake and transport (McDonald and Lane, 1995; Niot, Poirier and Besnard, 1997; Vamecq and Latruffe, 1999). Further investigations demonstrated that this autocrine effect may be facilitated by nuclear hormone receptors of the peroxisome proliferator-activated receptor (PPAR) family (Lemberger et al., 1994; Lemberger, Desvergne and Whali, 1996; Schoonjans, Straels and Auwerx, 1996; Vidal-Puig et al., 1996; Latruffe and Vamecq, 1997; Vamecq and Latruffe, 1999; Issemann and Green, 1990). There are currently three PPAR isoforms, , , and , that have been identified in various tissues from several species (Mukherjee, Noonan and McDonnell, 1994; Braissant et al., 1996; Cullingford et al., 1998; Mukherjee et al., 1997). A wide range of structurally different chemicals, including long chain fatty acids, eicossa-
Placenta (2002), Vol. 23
noids, leukotrienes, hypolipidemic drugs, and antidiabetic agents (Issemann and Green, 1990; Forman, Chen and Evans, 1997; Kliewer et al., 1997; Krey et al., 1997) have been demonstrated to bind and activate PPAR isoforms. It must be noted that for each PPAR isoform, binding has a moderate degree of specificity, and certain compounds may only interact with a particular isoform (Krey et al., 1997). PPAR has been demonstrated to play a role in regulating lipid catabolism (Krey et al., 1993; Belury et al., 1998), whereas PPAR was demonstrated to promote the differentiation of preadipocyte fibroblasts to the mature adipocytes (Lambe and Tugwood, 1996; Peraldi, Xu and Spiegelman, 1997). Recently, PPAR has also been shown to be an important regulatory factor for placental development (Barak et al., 1999; Waite et al., 2000). PPAR isoforms have been demonstrated to form a heterodimer with another nuclear hormone receptor family, the 9-cis-retinoic acid receptor (RXR) isoforms that are activated by ligand binding of 9-cis-retinoic acid (Levin et al., 1992). Three isoforms of RXR family, , , and , have been characterized in different species (Mangelsdorf et al., 1992; Mangelsdorf and Evans, 1995; Maden, 2000; Cullingford et al., 1998; Freebern, Niles and LoVerde, 1999). The individual PPAR/RXR heterodimers bind to the peroxisome proliferator response element (PPRE) in the promoter region of target genes to control gene transcription (Martin et al., 1997; Schoonjans et al., 1996; Simoneau et al., 1999). The PPAR/ RXR heterodimers have been demonstrated to regulate the transcription of several target genes including FAT, FATP, several FABP subtypes, acyl-CoA oxidase, phosphoenolpyruvate carboxykinase (PEPCK) (Schoonjans et al., 1995; Schoonjans et al., 1996), which collectively exert integrative effects on lipid homeostasis. In the present study, we identify the spatial and temporal expression patterns of PPAR and RXR isoforms in developing rat placenta and in human term placenta using RT-PCR/ Southern blot analysis and immunohistochemistry. The results of our studies provide a framework for investigating the role of PPAR/RXR heterodimer formation and potential function in regulating lipid homeostasis across the rat and human placentas.
MATERIALS AND METHODS Reagents The cDNAs for the rat PPAR and RXR isoforms were generated using primers (Table 1) specifically designed to amplify the complete coding sequences in our laboratory and sequenced to confirm identities. Polyclonal antibodies to PPAR and RXR isoforms were purchased from Santa Cruz (Santa Cruz, CA, USA). Human term-placenta tissue slides and cDNAs were obtained from Maxim Biotech Inc. (South San Francisco, CA, USA). DAB immunohistochemical staining kits were obtained from Zymed (South San Francisco, CA, USA). TRIzol Reagent for RNA extraction was obtained from
Wang et al.: PPAR and RXR Isoforms in Rat and Human Placentas
663
Table 1. Gene-specific primers for rat PPAR and RXR isoform probes
Target gene
Gene bank accession no.
Coding frame
Rat PPAR
NM–013196
378–1784
Rat PPAR
U40064
256–1578
Rat PPAR
NM–013124
49–1566
Rat RXR
L06482
168–1571
Rat RXR
M81766
31–1386
Rat RXR
AJ223083
1–967
5 –3 primer sequence AACCATTCAACATGGTGGACA GTACATGTCTCTGTAGATCT GTCAGTCATGGAACAGCCAC AGATCTACAGAGACATGTAC TGCTGTTATGGGTGAAACT ATACAAGTCCTTGTAGATCT GTAGCAGACATGGACACCAAAC GTGGTTTGATGTGGGGC GGGACGGGATGGGCGACAC CTCAAGCATCTCCATGAG CACCCTCAGGAGCCTTGGCA AGGGTGGCATAAACCTTCTCT
Table 2. The sequence specific primers, as confirmed by BLAST sequence analysis, designed to amplify rat PPAR and RXR isoforms by RT-PCR
Isoform
Direction
5 –3 Primer sequence
rPPAR
Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense
TTC GGA AAC TGC AGA CCT TTA GGA ACT CTC GGG TGA T CAG ACC TCT CCC AGA ATT C AAG CGG CAG TAC TGA CAC TTG TAG GTG TGA TCT TAA CTG TCG GCA TGG TGT AGA TGA TCT CA AGA GGA CAG TAC GCA AAG AC GTG AAG AGC TGC TTG TCT G GAG ATA ACA AAG ACT GCA CAG T GCA GTA TGA CCT GGT CGT C ATC GGA AAT ATG AAC TAC CCA T GTC ATT TGT CGA GCT CTC C
rPPAR rPPAR rRXR rRXR rRXR
Sigma Chemical Company (St Louis, MO, USA). Reverse transcriptase-polymerase chain reaction (RT-PCR) kits were purchased from Life Technologies (Rockville, MD, USA). North–South Biotin Random Prime Kit and the North–South Chemiluminescent Nucleic Acid Hybridization and Detection Kit were obtained from the Pierce Chemical Company (Rockford, IL, USA). Unless otherwise stated, all other chemicals and reagents were purchased from Fisher Scientific (Atlanta, GA, USA).
Animals and tissue collection Sprague–Dawley rats (Harlan Laboratory, IN, USA) were housed in an environmentally controlled facility and allowed free access to food and water. Timed pregnancies and tissue dissections were performed as previously described (Soares, 1987). The observation of a copulatory plug or sperm in the vaginal smear was designated Day 0 of pregnancy. Upon isolation, the tissues were quickly frozen in liquid nitrogen and
Product size (bp) 425 241 531 336 371 411
then stored at 80C until further analysis. The Animal Care and Use Committee of Rutgers, the State University of New Jersey, approved all protocols for the care and use of these animals.
RT-PCR and Southern blotting analysis Total RNA was isolated from tissues and cells using the TRIzol reagent according to the manufacturer’s protocol (Sigma Chemical Co.). RT-PCR was performed with specific primers for the PPAR and RXR isoforms. The primers used in the present study were BLAST searched to confirm specificity for each individual isoform (Tables 2 and 3). The RT-PCR was performed under optimized conditions, using an Eppendorf PCR MasterCycler. Reaction products were electrophoretically separated on 1.4% agarose gels. The separated PCR products were then transferred to nitrocellulose membranes and probed with their respective biotin-labelled PPAR or RXR isoform probes. North–South Biotin Random
664
Placenta (2002), Vol. 23
Table 3. The sequence specific primers, as confirmed by BLAST sequence analysis, designed to amplify human PPAR and RXR isoforms by RT-PCR
Isoform
Direction
5 –3 Primer sequence
hPPAR
Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense
ATC GGC GAG GAT AGT TCT AAT CGC GTT GTG TGA CAT CAG AAG AAG AAC CGC AAC A CGC CAT ACT TGA GAA GGG T CAG ATC CAG TGG TTG CAG GTC AGC GGA CTC TGG ATT ATA AGC ATC ACA TTT TGG GG GAC ATG CAG ATG GAC AAG T ATT AAC TCA ACA GTG TCA CTC CC TTA GTC ACA GGG TCA TTT GG AGC TAC ACA GAT ACC CCA GT CAC ATT CTG CCT CAC TCT
hPPAR hPPAR hRXR hRXR hRXR
Product size (bp) 375 486 440 417 503 532
Prime Kit and North–South Chemiluminescent Nucleic Acid Hybridization and Detection Kit (Pierce Chemical Company) were used to carry out the probe synthesis and hybridization analysis. The blots were washed for 30 min three times with a high stringency buffer (c1% SSC) at 58C to remove nonspecifically bound probe. The chemiluminescent signals were detected and recorded by the Nucleotech (920 Image System (NucleoTech Corporation, San Mateo, CA, USA). Immunohistochemistry Rat slides. Rat placental tissues were frozen upon dissection, and then prepared as cryostat sections. Before staining, the slides were pre-treated with boiling 0.01 M citric acid (pH 6.0) 5 min. The slides were immersed in 3% hydrogen peroxide to quench the endogenous peroxidase activity. Then the slides were blocked with non-immune serum, incubated with primary and secondary antibodies, and visualized with DAB chromatogen system (Zymed, South San Francisco, CA, USA). The results were recorded by using Leica Fluorescent Microscope with a 16-bit digital camera (magnifications, 400). Human slides. The immunohistochemical staining of human placental tissue section was performed according to vendor’s protocol (Maxim Biotech Inc, South San Francisco, CA, USA). Briefly, the slides were deparaffinized in xylene, blocked with non-immune serum, incubated with primary and secondary antibodies, and visualized with DAB chromatogen system (Zymed, South San Francisco, CA, USA). The results were recorded by using Leica Fluorescent Microscope with a 16-bit digital camera (magnifications, 400). RESULTS Rat placental expression The temporal and spatial expression patterns for rat PPAR isoforms in the rat placenta are presented in Figure 1. The
Figure 1. Expression of PPAR , and isoforms in the rat placenta during the second half of gestation. (Top Panel) RT-PCR analysis showing temporal and spatial patterns of expression of rat PPAR isoforms. RT-PCR was performed with specific primers for each mRNA. Reaction products were electrophoretically separated in 1.4% agarose gels. Lanes A–H: placental mRNA samples from days 13, 16, 19 and 21 of gestation. (Bottom Panel) Southern Blot analysis showing the temporal and spatial patterns of expression of rat PPAR isoforms. RT-PCR products were transferred to nitrocellulose filers. The filers then were probed with specific biotin-labelled cDNAs. The images were visualized using a chemiluminescent system. J: junctional zone. L: Labyrinth zone.
RT-PCR/Southern blotting results showed that PPAR isoforms are expressed ubiquitously in both the junctional and labyrinth zones from mid to late gestation of the developing rat placenta. The developing rat placenta at day 13 and day 19 were used to localize the expression of PPAR isoforms (Figure 2). Each individual PPAR isoforms were localized to the syncytial trophoblast of rat placenta section slides, confirming their presence in the developing day 13 and day 19 rat placentas (Figure 2). Three RXR isoforms demonstrated ubiquitous expression patterns in both the junctional and labyrinth zones of the developing rat placenta (Figure 3). Both RXR and RXR isoforms were expressed at a fairly constant level through gestational day 13 until the term on day 21 by RT-PCR/ Southern blotting analysis, whereas RXR exhibited a fluctuation in the temporal and spatial expression patterns. The
Wang et al.: PPAR and RXR Isoforms in Rat and Human Placentas
665
Figure 2. Immunohistochemistry staining results of PPAR isoforms in the rat developing placenta at gestation day 13 and 19. The slides were pre-treated with citric buffer, incubated with polyclonal anti-rabbit primary antibody, then with secondary antibody, and then stained with DAB staining kit from Zymed. The control slide was incubated with non-immune rabbit IgG instead of primary antibody. The pictures were taken with Leica Microscope (magnification bar, 5 m). A–C: PPAR , and isoforms at gestation day 13, respectively. D–F: PPAR , and isoforms at gestation day 19, respectively. G: Control slide.
666
Placenta (2002), Vol. 23
Human placental expression
Figure 3. Expression of RXR , and isoforms in the rat placenta during the second half of gestation. (Top Panel) RT-PCR analysis showing temporal and spatial patterns of expression of rat RXR isoforms. RT-PCR was performed with specific primers for each mRNA. Reaction products were electrophoretically separated in 1.4% agarose gels. (Bottom Panel) Southern Blot analysis showing the temporal and spatial patterns of expression of rat RXR isoforms. RT-PCR products were transferred to nitrocellulose filers. The filers then were probed with specific biotin-labelled cDNAs. The images were visualized using a chemiluminescent system. J: junctional zone. L: Labyrinth zone.
expression of RXR increased in both the junctional and labyrinth zones with increasing gestational age of the rat placenta. At the same gestational age, however, RXR appears to exhibit stronger expression in the junctional zone when contrasted to the expression found in the labyrinth zone. Further investigation is required to illustrate the significance of these observations. The immunohistochemical staining of the day 13 and day 19 tissues demonstrated the presence of RXR, and in the developing rat placenta (Figure 4). RT-PCR analysis of the rat PPAR and RXR isoforms at Day 13 revealed faint expression of ethidium-labelled bands on the agarose gel that are not clearly observable in the presented blots. After hybridization with considerably more sensitive chemiluminscent probes, the signal was amplified and is apparent in the accompanying Southern Blots. It should also be mentioned that a certain degree of caution must be maintained when one considers the Day 13 staining of cells. At day 13, the chorioallantoic placenta is in the early stages of differentiating from common progenitor cell type(s). Based on the fact that at Day 11 the two zones are indistinguishable and that at Day 12 the zones are just beginning to be defined, the common expression observed in these cell types may be artifactual from the progenitor cell expression. The differences in the expression of the individual PPAR and RXR isoforms observed with the RT-PCR and immunohistochemical analysis may arise from the dissection methods utilized to separate the two zones for mRNA extraction. While the two zones are separable, there exists a possibility that residual junctional zone tissue may reside in the labyrinth zone tissue, and vice versa. Upon highly sensitive RT-PCR amplification, these residual contaminations may manifest themselves in the form of a band. In addition, lower levels of expression in other cell types may be obfuscated by the higher levels of expression observed in the syncytium upon immunohistochemical staining.
All three PPAR isoforms were detected in the human term placenta by RT-PCR (Figure 5). However, RXR isoforms exhibited different expression patterns. Both RXR and RXR were expressed in the human term placenta, while RXR was not detected. In trying to amplify human RXR isoform, we designed two sets of primers, however, no expression was determined under these conditions. Therefore we postulate that RXR might not be expressed in the human term placenta, however, we cannot rule out its expression in early developmental stages. Immunohistochemical staining with PPAR isoform antibodies illustrated the presence of the individual PPAR isoforms in the human placenta. In Figure 6, the staining for each PPAR isoform appears to be predominantly concentrated in the syncytial trophoblast layer. Consistent with our RT-PCR results, we did not detect the expression of RXR through the immunohistochemical staining with its specific antibody. The expression of the RXR and RXR isoforms were also concentrated in the syncytial trophoblast layer (Figure 6). The immunohistochemistry staining analysis revealed that the PPAR, and isoforms were also present in the syncytial trophoblast and cytotrophoblast cells in the human term placental slides. The cytotrophoblast staining might be expected due to the fact that they are precursor cells that help to form the syncytium in humans. These observations are consistent with the results of studies performed by Schaiff et al. (2000) and Waite et al. (2000).
DISCUSSION In this study, we have investigated the temporal and spatial distribution of PPAR and RXR isoforms in the developing rat chorioallantoic placenta and in the human term placenta. PPAR and RXR isoforms are nuclear hormone receptors that are known to regulate several physiological processes, including fatty acid homeostasis (Schoonjans et al., 1996). The results of our studies establish a framework for further investigations into the regulation of fatty acid transfer across and trafficking within the placenta. Defining the fundamental expression profiles of PPAR and RXR isoforms in the placenta may improve our understanding of mechanisms regulating fatty acid transfer across the placenta and it may eventually provide pharmaceutical avenues for the correction of abnormal placental fatty acid transfer. RT-PCR, Southern blotting and immunohistochemical analysis were utilized to demonstrate that the PPAR , and isoforms are present in the developing rat placenta from mid gestation day 13 to the term day 21, as demonstrated in Figures 1 and 2. As mentioned previously, each of the three PPAR isoforms has been theorized to have overlapping, yet distinct functions in mediating cellular fatty acid homeostasis (Schoonjans et al., 1995, 1996). For example, Deluca et al. (2000) determined that the functions of PPAR , and are
Wang et al.: PPAR and RXR Isoforms in Rat and Human Placentas
667
Figure 4. Immunohistochemistry staining results of RXR isoforms in the developing rat placenta at gestation day 13 and 19. The slides were pre-treated in citric buffer, incubated with polyclonal anti-rabbit primary antibody, then with secondary antibody, and then stained with DAB staining kit from Zymed. The control slide was incubated with non-immune rabbit IgG instead of primary antibody. The pictures were taken with Leica Microscope (magnification bar, 5 m). A–C: RXR , and isoforms at gestation day 13, respectively. D–F: RXR , and isoforms at gestation day 19, respectively. G: Control slide.
668
Figure 5. RT-PCR analysis of human PPAR and RXR , and mRNAs in human term placenta cDNA. RT-PCR was performed with specific primers for each mRNA. Reaction products were electrophoretically separated in 1.4% agarose gels.
complementary, as demonstrated by the treatment of PPARnull mice with high doses of PPAR/ specific ligands. The effect of these treatments lead to the PPAR-null mice exhibiting increased peroxisome proliferation in contrast to wild type mice, where classically the increase in peroxisome proliferation was ascribed primarily to the activation of PPAR (Deluca et al., 2000). The investigators postulated that the results are due to the overlap of physical functions of PPAR isoforms in vivo. In contrast, it has also been widely demonstrated that the PPAR , and isoforms possess different biological functions as well (Kliewer et al., 1994; Forman et al., 1995; Schoonjans et al., 1996). For instance, PPAR is mainly involved in lipid catabolism (Krey et al., 1997; Kliewer et al., 1994), whereas PPAR plays a critical role in preadipocyte differentiation and adipogenesis (Aperlo et al., 1995). PPAR was the first-discovered PPAR isoform (Issemann and Green, 1990), and it has been the most widely investigated isoform. PPAR is assumed to regulate many physiological aspects besides adipogenesis, including serving as a key regulating factor or a participant with other factors in the regulation of type II diabetes (Lehmann et al., 1997), inflammation (Forman et al., 1995), and immune system function (Peraldi, Xu and Spieglman, 1997). The PPAR isoform has been shown to be actively involved in the placenta development in mice, rats and humans. Barak et al. investigated the biological importance of PPAR by using PPAR knockout mice (Barak et al., 1999). Unlike the PPAR knockout mice, PPAR knockout mice did not survive gestation. The PPAR knockout mice demonstrated an embryonic lethal phenotype, dying at day 10 of gestation. Human placental studies performed by Schaiff et al. demonstrated the presence of PPAR protein in the term human placenta by immunohistochemical analysis (Schaiff et al., 2000), which were confirmed with mRNA analysis by Northern Blotting (Marvin et al., 2000). Though the PPAR isoform is considered widely expressed throughout various rat and human tissues (Schoonjans et al., 1996; Latruffe and Vamecq, 1997), the physiological significance of PPAR is not well defined. Recently, studies have suggested that the role of PPAR is to function as an upstream regulator of PPAR expression (Bastie et al., 1999; Berger et al., 1999). These investigators claim that the expression of PPAR is earlier than the onset of PPAR in the fibroblasts
Placenta (2002), Vol. 23
and decreases over time, while PPAR expression increases during this period. In our present study, the expression of PPAR does not change along with the gestation in the developing rat placenta, from day 13 to day 21, both in the junctional and the labyrinth zones (Figure 1). PPAR is also present in human term placenta (Figure 5). Further investigations are required to elucidate the exact physiological functions of PPAR. Since the PPAR and RXR isoforms are known to form heterodimer PPAR/RXR regulatory complexes to react with PPRE sites in the promoter regions of genes, RXR isoforms need to be included when we are investigating the regulatory roles of PPAR isoforms. RXR isoforms also belong to the superfamily of nuclear hormone receptors and are considered as ‘master’ receptors. They not only can form heterodimers with PPAR isoforms, but they can bind with other nuclear hormone receptors, such as all-trans-retinoic acid receptors (RAR), vitamin D3 receptors, thyroid hormone receptors as well as others, and they can even form RXR-RXR homodimers (Mangelsdorf et al., 1992; Mangelsdorf and Evans, 1995). In addition, the only naturally-occurring ligand for RXR isoforms is 9-cis retinoic acid (a derivative of vitamin A), while PPAR isoforms can be activated by many ligands. In our present study, all RXR isoforms exhibit ubiquitous and similar expression profiles in the developing rat placenta, starting from day 13 to day 21. The general expression patterns of RXR isoforms may indicate they are involved in regulating many different physiological activities of rat placenta. Interestingly, RXR isoforms have different expression patterns in human term placenta (Figure 6) than in the developing rat placentas (Figure 4). Our results demonstrate that both the RXR and RXR isoforms are expressed in the human term placenta. The importance of RXR isoform expression in the human placenta may be derived from studies demonstrating the importance of vitamin A and its derivatives (including 9-cis-retinoic acid) in guiding embryonic development and placenta formation. For example, Guibourdenche et al. found that treatment of cytotrophoblasts with 9-cis-retinoic acid doubled the placental secretion of human chorionic gonadotropin (Guibourdenche et al., 2000). In addition, Guibourdenche et al. found that the RXR isoform was specifically expressed in human term chorionic villi, while the RXR was not significantly observed (Guibourdenche et al., 2000). The function of each RXR isoform in the regulation process is still under considerable investigation, with no clear understanding currently established. One investigation (Mangelsdorf and Evans, 1995) argued that only RXR binds with PPAR isoforms, forming regulatory heterodimer. Other studies have argued that RXR isoforms undoubtedly are of critical importance in the embryonic development (Maden, 2000). Wendling and coworkers discovered that mouse embryos carrying null mutations of both retinoid X receptors alpha and beta (RXR / /RXR / mutants) died between 9.5 and 10.5 days of gestation and display a wide range of abnormalities (Wendling et al., 1999). These studies suggested that RXR isoforms are of critical importance in the normal development
Wang et al.: PPAR and RXR Isoforms in Rat and Human Placentas
669
Figure 6. Immunohistochemistry staining results of the PPAR and RXR isoforms in the human term placenta. The slides were deparaffinized in xylene, incubated with polyclonal anti-rabbit primary antibody, then with secondary antibody, and then stained with DAB staining kit from Zymed. The control slide was incubated with non-immune rabbit IgG instead of primary antibody. The pictures were taken with Leica Microscope (magnification bar, 5 m). A–C: human PPAR , and isoforms, respectively. D–F: RXR , and isoforms, respectively. G: control slide.
670
of placenta. The function and roles of these isoforms in mediating these responses remains to be determined. Although the exact role of each RXR isoform is not fully understood, it is believed that each expressed RXR isoform is critical to proper placental development (Wendling et al., 1999; Mangelsdorf et al., 2000). In summary, the temporal and spatial expression distribution of PPAR and RXR isoforms has been described in the developing rat placenta and the human term placenta. PPAR
Placenta (2002), Vol. 23
and RXR isoforms belong to the superfamily of nuclear hormone receptors, and they integrally regulate lipid homeostasis by stimulating relevant gene transcription, including fatty acid transferring proteins and fatty acid oxidizing enzymes. The establishment of the temporal and spatial expression distribution of PPAR and RXR isoforms in these tissues provides a framework for the further investigation of their functional importance and physiological relevancy in guiding proper foetal development.
ACKNOWLEDGEMENTS The authors would like to thank Dr Michael J. Soares for his considerable advice and assistance in preparing this manuscript, Ms Dea Herrera-Ruiz for her technical assistance on this project, and Mr Rajesh Patel (Department of Pathology, UMDNJ) for preparation the cryostat sections of developing rat placenta. This work was primarily supported by research funds provided by Rutgers University College of Pharmacy and the Department of Pharmaceutics.
REFERENCES Abel EL (1984) Fetal Alcohol Syndrome and Fetal Effects. Oradell, NJ: Medical Economics Books. Aperlo C, Pognonec P, Saladin R, Auwerx J & Boulukos KE (1995) cDNA cloning and characterization of the transcriptional activities of the hamster peroxisome proliferator-activated receptor. Gene, 162, 297–302. Barak Y, Nelson MC, Ong ES, Jones YZ, Ruiz-Lozano P, Chien KR, Koder A & Evans RM (1999) PPAR gamma is required for placental, cardiac, and adipose tissue development. Mol Cell, 4, 585–595. Bastie C, Holst D, Gaillard D, Jehl-Pietri C & Grimaldi PA (1999) Expression of peroxisome proliferator-activated receptor PPAR promotes induction of PPAR and adipocyte differentiation in 3T3C2 fibroblasts. J Biol Chem, 274, 21290–21295. Belury M, Moya-Camarena SY, Sun H, Snyder E, Davis JW, Cunningham ML & Vanden Heuvel JP (1998) Comparison of doseresponse relationship for induction of lipid metabolizing and growth regulatory genes by peroxisome proliferators in rat liver. Toxi Applied Pharma, 151, 254–261. Berger J, Leibowitz MD, Doebber TW, Elbrecht A, Zhang B, Zhou G, Biswas C, Cullinan CA, Hayes NS, Li Y, Tanen M, Ventre J, Wu MS, Berger GD, Mosley R, Marquis R, Santini C, Sahoo SP, Tolman RL, Smith RG & Moller DE (1999) Novel proliferator-activated receptor and PPAR ligands produce distinct biological effects. J Biol Chem, 274, 6718–6725. Braissant O, Foufelle F, Scotto C, Dauca M & Wahli W (1996) Differential expression of peroxisome proliferator-activated receptors: tissue distribution of PPAR-, and in the adult rat. Endocrinology, 137, 354–366. Campbell FM, Gordon MJ & Dutta-Rov AK (1994) Plasma membrane fatty acid binding protein (FABPpm) of the sheep placenta. Biochimica Biophysicica Acta, 1214, 187–192. Campbell FM, Clohessy AM, Gordon MJ, Page KR & Dutta-Roy AK (1997) Uptake of long chain fatty acids by human placental carcinoma (BeWo) cells: role of plasma membrane fatty acid-binding protein. J Lipid Res, 38, 2558–2568. Campbell FM, Clohessy AM, Gordon MJ, Page KR & Dutta-Roy AK (1998) Placental membrane fatty acid-binding protein preferentially binds arachidonic and docosahexaenoic acid. Life Sci, 63, 235–240. Crabtree JT, Gordon MJ, Campbell FM & Dutta-Roy AK (1998) Differential distribution and metabolism of arachidonic acid and docosahexaenoic acid by human placental chriocarcinoma (BeWo) cells. Mol Cell Biochem, 185, 191–198. Cullingford TE, Bhakoo K, Peuchen S, Dolphin CT, Patel R & Clark JB (1998) Distribution of mRNAs encoding the peroxisome proliferatoractivated receptors , , and and retinoid X receptor , , and in rat central nervous system. J Neurochem, 70, 1366–1375. Deluca JG, Doebber TW, Kelly LJ, Kemp RK, Molon-Noblot S, Sahoo SP, Ventre J, Wu MS, Peters JM, Gonzalez FJ & Moller DE (2000) Evidence for Peroxisome Proliferator-Activated Receptor (PPAR)alphaIndependent Peroxisome Proliferation: Effects of PPARgamma/deltaSpecific Agonists in PPARalpha-Null Mice. Mol Pharmacol, 58, 470–476.
Denkins YM, Woods J, Whitty JE, Hannigan JH, Martier SS, Sokol RJ & Salem N Jr (2000) Effects of gestational alcohol exposure on the fatty acid composition of umbilical cord serum in humans. Am J Clin Nutr, 71, 300S–306S. Dutta-Roy AK (2000) Transport mechanisms for long-chain polyunsaturated fatty acids in the human placenta. Am J Clin Nutr, 71, 315S–322S. Faria TN & Soares MJ (1991) Trophoblast cell differentiation: establishment, characterization, and modulation of a rat trophoblast cell line expressing members of the placental prolactin family. Endocrinology, 129, 2895–2906. Flynn M, Scott TR, Pritchard TC & Plata-Salaman CR (1998) Mode of action of OB protein (leptin) on feeding. Am J Physio, 44, 174–179. Forman B, Tontonoz P, Chen J, Brun RP, Spiegelman BM & Evans RM (1995) 15-deoxy-12,14-Prostaglandin J2 is a ligand for the adipocyte determination factor PPAR. Cell, 83, 803–812. Forman BM, Chen J & Evans RM (1997) Hypolipidemic drugs, polyunsaturated fatty acids, and eicosanoids are ligands for peroxisome prolifearator-activated receptors and . Proc Natl Acad Sci USA, 94, 4312–4317. Freebern W, Niles EG & LoVerde PT (1999) RXR-2 a member of the retinoid X receptor family in Schistoma mansoni. Gene, 233, 33–38. Guibourdenche J, Alsat E, Soncin F, Rochette-Egly C & Evain-Brion D (2000) Retinoid receptors expression in human term placenta: involvement of RXR alpha in retinoid induced-hCG secretion. J Clin Endocrinol Metab, 83(4), 1384–1387. Hamilton J (1998) Fatty acid transport: difficult or easy? J lipid Res, 39, 467–481. Hamilton J & Kamp F (1999) How are free fatty acids transported in membranes? Diabetes, 48, 2255–2269. Hoggard N, Hunter L, Duncan JS, Williams LM, Trayhurn P & Mercer JG (1997) Leptin and leptin receptor mRNA and protein expression in the murine fetus and placenta. Proc Natl Acad Sci USA, 94, 11073–11078. Hornstra G, Al MD, van Houwelingen AC & Foreman-van Drongelen MM (1995) Essential fatty acids in pregnancy and early human development. Eur J Obs & Gyn, 61, 57–62. Issemann I & Green S (1990) Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature, 347, 645–650. Kliewer SA, Forman BM, Blumberg B, Ong ES, Borgmeyer U, Mangelsdorf DJ, Umesono K & Evans RM (1994) Differential expression and activation of a family of murine peroxisome proliferator-activated receptors. Proc Natl Acad Sci USA, 91, 7355–7359. Kliewer SA, Sundseth SS, Jones SA, Brown PJ, Wisely GB, Koble CS, Devchand P, Wahli W, Willson TM, Lenhard JM & Lehmann JM (1997) Fatty acids and eicosanoids regulate gene expression through direct interaction with peroxisome proliferator-activated receptor and . Proc Natl Acad Sci USA, 94, 4318–4323. Knipp GT, Audus KL & Soares MJ (1999) Nutrient transport across the placenta. Adv Drug Deliv Rev, 38, 41–58. Knipp GT, Liu B, Audus KL, Fujii H, Ono T & Soares MJ (2000) Fatty acid transport regulatory proteins in the developing rat placenta and in trophoblast cell culture models. Placenta, 21, 367–375. Krey G, Keller H, Mahfoudi A, Medin J, Ozato K, Dreyer C & Wahli W (1993) Xenopus peroxisome proliferator-activated receptors: genomic
Wang et al.: PPAR and RXR Isoforms in Rat and Human Placentas organization, response element recognition, heterodimer formation with retinoid X receptor and activation by fatty acids. J Steroid Biochem Molec Biol, 47, 65–73. Krey G, Braissant O, L’Horset F, Kalkhoven E, Perroud M, Parker MG & Wahli W (1997) Fatty acids, eicossaniods, and hypolipidemic agents identified as ligands of peroxisome proliferator-activated receptors by co-activator-dependent receptor ligand assay. Mol Endocrinol, 11, 779–791. Lambe KG & Tugwood JD (1996) A human peroxisome proliferatoractivated receptor ( is activated by inducers of adipogenesis, including thiazolidinedione drugs. Euro J Biochem, 239, 1–7. Latruffe N & Vamecq J (1997) Peroxisome proliferator and peroxisome proliferator-activated receptors as regulators of lipid metabolism. Biochimie, 79, 81–94. Lehmann JM, Lenhard JM, Oliver BB, Ringold GM & Kliewer SA (1997) Peroxisome proliferator-activated receptor and - are activated by indomethacin and other non-steroid anti-inflammatory drugs. J Biol Chem, 272, 3406–3410. Lemberger T, Staels B, Saladin R, Desvergne B, Auwerx J & Wahli W (1994) Regulation of the peroxisome proliferator-activated receptor alpha gene by glucocorticoids. J Biol Chem, 269, 24527–24530. Lemberger T, Desvergne B & Whali W (1996) Peroxisome proliferatoractivated receptor: a nuclear receptor signaling pathway in lipid physiology. Annu Rev Cell Dev, 12, 335–363. Levin AA, Sturzenbecker LJ, Kazmer S, Bosakowski T, Huselton C, Allenby G, Speck J, Kratzeisen C, Rosenberger M & Lovey A (1992) 9-cis retinoic acid stereoisomer binds and activates the nuclear receptor RXR. Nature, 355, 359–361. Maden M (2000) The role of retinoic acid in embryonic and post-embryonic development. Proc Nutr Soc, 59, 65–73. Mangelsdorf DJ, Borgmeyer U, Heyman RA, Zhou JY, Ong ES, Oro AE, Kakizuka A & Evans RM (1992) Characterization of three RXR genes that mediate the action of 9cis retinoic acid. Genes Dev, 6, 329–344. Mangelsdorf DJ & Evans RM (1995) The RXR heterodimers and orphan receptors. Cell, 83, 841–850. Martin G, Schoonjans K, Lefebvre AM, Staels B & Auwerx J (1997) Coordinate regulation of the expression of the fatty acid transport protein and acyl-CoA synthetase genes by PPAR and PPAR activators. J Biol Chem, 272, 28210–28217. Marvin KW, Eykholt RL, Keelan JA, Sato TA & Mitchell MD (2000) The 15-deoxy-delta(12,14)-prostaglandin J(2)receptor, peroxisome proliferator activated receptor-gamma (PPARgamma) is expressed in human gestational tissues and is functionally active in JEG3 choriocarcinoma cells. Placenta, 21(4), 436–440. McDonald OA & Lane MD (1995) When precursors are also regulators. Current Biology, 5, 618–621. Mukherjee R, Noonan D & McDonnell DP (1994) Human and rat peroxisome proliferator-activated receptors demonstrate similar tissue distribution but different responsiveness to PPAR activators. J Steroid Biochem Molec Biol, 51, 157–166. Mukherjee R, Jow L, Croston GE & Paterniti JR Jr (1997) Identification, characterization, tissue distribution peroxisome proliferator-activated receptor isoforms PPAR2 versus PPAR1 and activation with retinoid X receptor agonists and antagonists. J Biol Chem, 272, 8071–8076.
671 Narumiya S & Fukushima M (1986) Site and mechanism of growth inhibition by PGs. J Pharmaco Experi Therap, 239, 500–511. Niot I, Poirier H & Besnard P (1997) Regulation of gene expression by fatty acids: Special reference to fatty acid-binding protein (FABP). Biochimie, 79, 129–131. Ogata ES, Lane HR & Simmons RA (1997) Placental transport in fetal growth retardation. In Placental Function and Fetal Nutrition (Ed.) Battaglia FC, pp. 97–112. Nestle Nutrition Workshop Series, Vol. 39. Peraldi P, Xu M & Spiegelman BM (1997) Thiazolidinediones block tumor necrosis factor -induced inhibition of insulin signaling. J Clin Invest, 100, 1863–1869. Schoonjans K, Watanabe M, Suzuki H, Mahfoudi A, Krey G, Wahli W, Grimaldi P, Staels B, Yamamoto T & Auwerx J (1995) Induction of the acyl-CoA synthetase gene by fibrates and fatty acids is mediated by a peroxisome proliferator response element in the C promoter. J Biol Chem, 270, 19269–19276. Schoonjans K, Staels B & Auwerx J (1996) Role of peroxisome proliferatoractivated receptor in mediating the effects of the fibrates and fatty acids on gene expression. J of Lipid Research, 37, 907–925. Schaiff WT, Carlson MG, Smith SD, Levy R, Nelson DM & Sadovsky Y (2000) Peroxisome proliferator-activated receptor-gamma modulates differentiation of human trophoblast in a ligand-specific manner. J Clin Endocrinol Metab, 85(10), 3874–3881. Simoneau J, Veerkamp JH, Turcotte LP & Kelley DE (1999) Markers of capacity to utilize fatty acids in human skeletal muscle: relation to insulin resistance and obesity and effects of weight loss. FASEB J, 13, 2051–2060. Soares MJ (1987) Developmental changes in the intraplacental distribution of placental lactogen and alkaline phosphatase in the rat. J Reprod Fert, 79, 93–98. Soares MJ, Handwerger S & Talamantes F (1993) Trophoblast Cells. New York: Springer-Verlag, Ch 4, pp. 45–65. Soares MJ (1997) Molecular Mechanisms of Placental Development. In Placental Function and Fetal Nutrition (Ed.) Battaglia FC, pp. 31–45. Nestl Nutrition Workshop Series, Vol. 39. Philadelphia, PA: Nestec Ltd. Vevey/ Lippincott-Raven Publishers. Uauy R, Mena P & Valenzuela A (1999) Essential fatty acids as determinants of lipid requirement in infants, children and adults. Euro J Clin Nutr, 53, S66–S77. Uauy R & Hoffman DR (2000) Essential fat requirement of preterm infants. Am J Clin Nutr, 71(Suppl), 245S–250S. Vamecq J & Latruffe N (1999) Medical significance of peroxisome proliferator-activated receptors. Lancet, 354, 141–148. Vidal-Puig A, Jimenez-Linan M, Lowell BB, Hamann A, Hu E, Spiegelman B, Flier JS & Moller DE (1996) Regulation of PPAR gene expression by nutrition and obesity in rodents. J Clin Invest, 98, 2553–2561. Waite LL, Person EC, Zhou Y, Lim KH, Scanlan TS & Taylor RN (2000) Placental peroxisome proliferator-activated receptor-gamma is up-regulated by pregnancy serum. J Clin Endocrinol Metab, 85, 3808–3814. Wendling O, Chambon P & Mark M (1999) Retinoid X receptors are essential for early mouse development and placentogenesis. Proc Natl Acad Sci U S A, 96, 547–551. West JS (1994) Recent finding on the mechanisms by which alcohol damages the developing nervous system. Alcohol & Alcoholism, Suppl, 2, 395–399.
Expression of PPAR and RXR Isoforms in the Developing Rat and Human Term Placentas Q. Wanga, H. Fujiib and G. T. Knippa,c a
Department of Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers, The State University of New Jersey, 160 Frelinghuysen Road, Piscataway, NJ 08854-8022, USA; b Department of Biochemistry, Niigata University School of Medicine, Niigata 951, Japan Paper accepted 31 May 2002
Placental fatty acid transfer is critical to meet the foetal requirements necessary for the biosynthesis of biological membranes, myelin, and various signaling molecules. The primary objective of this research was to elucidate the placental expression patterns of genes that may potentially regulate placental fatty acid transfer and homeostasis. In this study, we have elucidated the temporal and spatial patterns of expression of peroxisome proliferator-activated receptor (PPAR) and 9-cis retinoic acid receptor (RXR) isoforms in the junctional and labyrinth zones of the developing rat chorioallantoic placenta and in human term placenta. PPAR (, , and ) and RXR (, , and ) isoforms are nuclear hormone receptors that are known to regulate gene transcription and protein expression levels of fatty acid transport and metabolism mediating proteins through the formation of a DNA binding heterodimer complex. In the present study, the expression patterns of PPAR and RXR isoforms were determined in developing rat placenta and human term placenta using RT-PCR and immunohistochemical analyses. PPAR, , , RXR, and were expressed in both junctional (invasive/endocrine function) and labyrinth (transport barrier) zones of the rat placenta, from day 13 to day 21 of gestation. In the human term placenta, PPAR, , , RXR and were observed, while RXR was not detected. Immunocytochemistry staining results determined the presence of PPAR, , , RXR and to be specific to the syncytial trophoblast layer of the human chorionic villi. The presence of PPAR and RXR isoforms in both the rat and human placentas suggest that PPAR and RXR isoforms are potential regulators of placental lipid transfer and homeostasis. Our work provides a framework for the further investigation of PPAR and RXR isoform specific regulation of placental fatty acid uptake, transport and metabolism. 2002 Elsevier Science Ltd. All rights reserved. Placenta (2002), 23, 661–671
INTRODUCTION The placenta acts as the barrier between the maternal and foetal circulatory systems and plays an important role in the development and growth of the foetus (Soares, 1997; Knipp et al., 1999). There are several major functions performed by the placenta including: uterine wall invasion, evasion of the maternal immune system, mediation of the placental-uterine microenvironment by hormonal secretions, and regulating bi-directional maternal and foetal nutrient and waste transport (Faria and Soares, 1991; Hoggard et al., 1997; Soares, 1997; Flynn et al., 1998). The placental functions are performed by several different trophoblast cell types, which differ in morphological and functional properties (Soares, Handwerger and Talamantes, 1993; Soares, 1997). c
To whom correspondence should be addressed at: Department of Pharmaceutics, Rutgers University, 160 Frelinghuysen Road, Piscataway, NJ 08854-8022, USA. Tel.: (732) 445-2669; Fax: (732) 445-3134; E-mail: [email protected] 0143–4004/02/$-see front matter
The rat placenta has been widely used as a model to study placental development. Briefly, the rat placenta is composed of two distinct zones, the junctional zone (invasion and endocrine function) and the labyrinth zone (transport barrier) (Knipp et al., 1999). The junctional zone is adjacent to the maternal compartment and is mainly involved in uterine wall invasion and the production of hormones/cytokines. The labyrinth zone is the main barrier to diffusion and acts to regulate the transfer of nutrients and wastes between the maternal and foetal compartments. Of note is the fact that syncytial trophoblast cells form the transport barriers in both the rat and human placentas (Ogata, Lane and Simmons, 1997). The primary interest to our laboratory is to expand our understanding of the regulation of transplacental fatty acid homeostasis and its role in guiding proper foetal development. Fatty acids are of critical importance in normal development of the foetus, due to the fact that fatty acids serve as obligatory constituents of biological membranes (Uauy, Mena and Valenzuela, 1999), concentrated fuel storage (Uauy and 2002 Elsevier Science Ltd. All rights reserved.
662
Hoffman, 2000), and precursors of intracellular signalling molecules (Narumiya and Fukushima, 1986). In addition, insufficient fatty acid supply has been demonstrated to result in foetal intrauterine growth retardation (IUGR), foetal facial dysmorphology and severe postnatal growth retardation (Abel, 1984; West, 1994; Denkins et al., 2000). Central to these observations is the role of the placenta in influencing bi-directional transfer of fatty acids between the maternal and foetal circulations. Fatty acids are hydrophobic, and depending on their physicochemical properties, may passively diffuse into cells across the lipid bilayer membrane (Hamilton, 1998; Hamilton and Kamp, 1999). However, the capacity of fatty acid transfer by free diffusion is limited and not sufficient to satisfy the demand of the developing foetus. Therefore, a facilitative, directional transfer of fatty acids from the maternal circulation to the foetus is required to properly meet foetal demands. Consistent with this observation, Hornstra et al. demonstrated that fatty acid transport is highly directional, with a strong preference in the direction from the mother to the foetus (Hornstra et al., 1995). Dutta-Roy and other investigators have demonstrated that there exists a preference for transporting long-chain polyunsaturated fatty acid (LCPUFAs) over nonessential fatty acids in the human placenta and in BeWo cells, a human choriocarcinoma cell line (Campbell et al., 1997; Campbell et al., 1998; Dutta-Roy, 2000). This observation cannot be explained by simple diffusion of fatty acids alone. Recently, several fatty acid transport proteins have been found in the rat and human placentas and in in vitro trophoblast cell culture models (Campbell, Gordon and Dutta-rov, 1994; Crabtree et al., 1998; Dutta-Roy, 2000; Knipp et al., 2000). These proteins were identified as plasma membrane fatty acid binding protein (FABPpm), fatty acid translocase (FAT), fatty acid transport protein (FATP) and members of cytosolic fatty acid binding proteins (FABPs). All of these proteins are known to function as fatty acid transferring proteins in other tissues and their expression in the both the rat and human placentas have been shown. However, the regulation of fatty acid transport across the placenta remains to be elucidated. In recent years, it has become clear that fatty acids act in an autocrine manner to regulate their metabolism, uptake and transport (McDonald and Lane, 1995; Niot, Poirier and Besnard, 1997; Vamecq and Latruffe, 1999). Further investigations demonstrated that this autocrine effect may be facilitated by nuclear hormone receptors of the peroxisome proliferator-activated receptor (PPAR) family (Lemberger et al., 1994; Lemberger, Desvergne and Whali, 1996; Schoonjans, Straels and Auwerx, 1996; Vidal-Puig et al., 1996; Latruffe and Vamecq, 1997; Vamecq and Latruffe, 1999; Issemann and Green, 1990). There are currently three PPAR isoforms, , , and , that have been identified in various tissues from several species (Mukherjee, Noonan and McDonnell, 1994; Braissant et al., 1996; Cullingford et al., 1998; Mukherjee et al., 1997). A wide range of structurally different chemicals, including long chain fatty acids, eicossa-
Placenta (2002), Vol. 23
noids, leukotrienes, hypolipidemic drugs, and antidiabetic agents (Issemann and Green, 1990; Forman, Chen and Evans, 1997; Kliewer et al., 1997; Krey et al., 1997) have been demonstrated to bind and activate PPAR isoforms. It must be noted that for each PPAR isoform, binding has a moderate degree of specificity, and certain compounds may only interact with a particular isoform (Krey et al., 1997). PPAR has been demonstrated to play a role in regulating lipid catabolism (Krey et al., 1993; Belury et al., 1998), whereas PPAR was demonstrated to promote the differentiation of preadipocyte fibroblasts to the mature adipocytes (Lambe and Tugwood, 1996; Peraldi, Xu and Spiegelman, 1997). Recently, PPAR has also been shown to be an important regulatory factor for placental development (Barak et al., 1999; Waite et al., 2000). PPAR isoforms have been demonstrated to form a heterodimer with another nuclear hormone receptor family, the 9-cis-retinoic acid receptor (RXR) isoforms that are activated by ligand binding of 9-cis-retinoic acid (Levin et al., 1992). Three isoforms of RXR family, , , and , have been characterized in different species (Mangelsdorf et al., 1992; Mangelsdorf and Evans, 1995; Maden, 2000; Cullingford et al., 1998; Freebern, Niles and LoVerde, 1999). The individual PPAR/RXR heterodimers bind to the peroxisome proliferator response element (PPRE) in the promoter region of target genes to control gene transcription (Martin et al., 1997; Schoonjans et al., 1996; Simoneau et al., 1999). The PPAR/ RXR heterodimers have been demonstrated to regulate the transcription of several target genes including FAT, FATP, several FABP subtypes, acyl-CoA oxidase, phosphoenolpyruvate carboxykinase (PEPCK) (Schoonjans et al., 1995; Schoonjans et al., 1996), which collectively exert integrative effects on lipid homeostasis. In the present study, we identify the spatial and temporal expression patterns of PPAR and RXR isoforms in developing rat placenta and in human term placenta using RT-PCR/ Southern blot analysis and immunohistochemistry. The results of our studies provide a framework for investigating the role of PPAR/RXR heterodimer formation and potential function in regulating lipid homeostasis across the rat and human placentas.
MATERIALS AND METHODS Reagents The cDNAs for the rat PPAR and RXR isoforms were generated using primers (Table 1) specifically designed to amplify the complete coding sequences in our laboratory and sequenced to confirm identities. Polyclonal antibodies to PPAR and RXR isoforms were purchased from Santa Cruz (Santa Cruz, CA, USA). Human term-placenta tissue slides and cDNAs were obtained from Maxim Biotech Inc. (South San Francisco, CA, USA). DAB immunohistochemical staining kits were obtained from Zymed (South San Francisco, CA, USA). TRIzol Reagent for RNA extraction was obtained from
Wang et al.: PPAR and RXR Isoforms in Rat and Human Placentas
663
Table 1. Gene-specific primers for rat PPAR and RXR isoform probes
Target gene
Gene bank accession no.
Coding frame
Rat PPAR
NM–013196
378–1784
Rat PPAR
U40064
256–1578
Rat PPAR
NM–013124
49–1566
Rat RXR
L06482
168–1571
Rat RXR
M81766
31–1386
Rat RXR
AJ223083
1–967
5 –3 primer sequence AACCATTCAACATGGTGGACA GTACATGTCTCTGTAGATCT GTCAGTCATGGAACAGCCAC AGATCTACAGAGACATGTAC TGCTGTTATGGGTGAAACT ATACAAGTCCTTGTAGATCT GTAGCAGACATGGACACCAAAC GTGGTTTGATGTGGGGC GGGACGGGATGGGCGACAC CTCAAGCATCTCCATGAG CACCCTCAGGAGCCTTGGCA AGGGTGGCATAAACCTTCTCT
Table 2. The sequence specific primers, as confirmed by BLAST sequence analysis, designed to amplify rat PPAR and RXR isoforms by RT-PCR
Isoform
Direction
5 –3 Primer sequence
rPPAR
Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense
TTC GGA AAC TGC AGA CCT TTA GGA ACT CTC GGG TGA T CAG ACC TCT CCC AGA ATT C AAG CGG CAG TAC TGA CAC TTG TAG GTG TGA TCT TAA CTG TCG GCA TGG TGT AGA TGA TCT CA AGA GGA CAG TAC GCA AAG AC GTG AAG AGC TGC TTG TCT G GAG ATA ACA AAG ACT GCA CAG T GCA GTA TGA CCT GGT CGT C ATC GGA AAT ATG AAC TAC CCA T GTC ATT TGT CGA GCT CTC C
rPPAR rPPAR rRXR rRXR rRXR
Sigma Chemical Company (St Louis, MO, USA). Reverse transcriptase-polymerase chain reaction (RT-PCR) kits were purchased from Life Technologies (Rockville, MD, USA). North–South Biotin Random Prime Kit and the North–South Chemiluminescent Nucleic Acid Hybridization and Detection Kit were obtained from the Pierce Chemical Company (Rockford, IL, USA). Unless otherwise stated, all other chemicals and reagents were purchased from Fisher Scientific (Atlanta, GA, USA).
Animals and tissue collection Sprague–Dawley rats (Harlan Laboratory, IN, USA) were housed in an environmentally controlled facility and allowed free access to food and water. Timed pregnancies and tissue dissections were performed as previously described (Soares, 1987). The observation of a copulatory plug or sperm in the vaginal smear was designated Day 0 of pregnancy. Upon isolation, the tissues were quickly frozen in liquid nitrogen and
Product size (bp) 425 241 531 336 371 411
then stored at 80C until further analysis. The Animal Care and Use Committee of Rutgers, the State University of New Jersey, approved all protocols for the care and use of these animals.
RT-PCR and Southern blotting analysis Total RNA was isolated from tissues and cells using the TRIzol reagent according to the manufacturer’s protocol (Sigma Chemical Co.). RT-PCR was performed with specific primers for the PPAR and RXR isoforms. The primers used in the present study were BLAST searched to confirm specificity for each individual isoform (Tables 2 and 3). The RT-PCR was performed under optimized conditions, using an Eppendorf PCR MasterCycler. Reaction products were electrophoretically separated on 1.4% agarose gels. The separated PCR products were then transferred to nitrocellulose membranes and probed with their respective biotin-labelled PPAR or RXR isoform probes. North–South Biotin Random
664
Placenta (2002), Vol. 23
Table 3. The sequence specific primers, as confirmed by BLAST sequence analysis, designed to amplify human PPAR and RXR isoforms by RT-PCR
Isoform
Direction
5 –3 Primer sequence
hPPAR
Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense
ATC GGC GAG GAT AGT TCT AAT CGC GTT GTG TGA CAT CAG AAG AAG AAC CGC AAC A CGC CAT ACT TGA GAA GGG T CAG ATC CAG TGG TTG CAG GTC AGC GGA CTC TGG ATT ATA AGC ATC ACA TTT TGG GG GAC ATG CAG ATG GAC AAG T ATT AAC TCA ACA GTG TCA CTC CC TTA GTC ACA GGG TCA TTT GG AGC TAC ACA GAT ACC CCA GT CAC ATT CTG CCT CAC TCT
hPPAR hPPAR hRXR hRXR hRXR
Product size (bp) 375 486 440 417 503 532
Prime Kit and North–South Chemiluminescent Nucleic Acid Hybridization and Detection Kit (Pierce Chemical Company) were used to carry out the probe synthesis and hybridization analysis. The blots were washed for 30 min three times with a high stringency buffer (c1% SSC) at 58C to remove nonspecifically bound probe. The chemiluminescent signals were detected and recorded by the Nucleotech (920 Image System (NucleoTech Corporation, San Mateo, CA, USA). Immunohistochemistry Rat slides. Rat placental tissues were frozen upon dissection, and then prepared as cryostat sections. Before staining, the slides were pre-treated with boiling 0.01 M citric acid (pH 6.0) 5 min. The slides were immersed in 3% hydrogen peroxide to quench the endogenous peroxidase activity. Then the slides were blocked with non-immune serum, incubated with primary and secondary antibodies, and visualized with DAB chromatogen system (Zymed, South San Francisco, CA, USA). The results were recorded by using Leica Fluorescent Microscope with a 16-bit digital camera (magnifications, 400). Human slides. The immunohistochemical staining of human placental tissue section was performed according to vendor’s protocol (Maxim Biotech Inc, South San Francisco, CA, USA). Briefly, the slides were deparaffinized in xylene, blocked with non-immune serum, incubated with primary and secondary antibodies, and visualized with DAB chromatogen system (Zymed, South San Francisco, CA, USA). The results were recorded by using Leica Fluorescent Microscope with a 16-bit digital camera (magnifications, 400). RESULTS Rat placental expression The temporal and spatial expression patterns for rat PPAR isoforms in the rat placenta are presented in Figure 1. The
Figure 1. Expression of PPAR , and isoforms in the rat placenta during the second half of gestation. (Top Panel) RT-PCR analysis showing temporal and spatial patterns of expression of rat PPAR isoforms. RT-PCR was performed with specific primers for each mRNA. Reaction products were electrophoretically separated in 1.4% agarose gels. Lanes A–H: placental mRNA samples from days 13, 16, 19 and 21 of gestation. (Bottom Panel) Southern Blot analysis showing the temporal and spatial patterns of expression of rat PPAR isoforms. RT-PCR products were transferred to nitrocellulose filers. The filers then were probed with specific biotin-labelled cDNAs. The images were visualized using a chemiluminescent system. J: junctional zone. L: Labyrinth zone.
RT-PCR/Southern blotting results showed that PPAR isoforms are expressed ubiquitously in both the junctional and labyrinth zones from mid to late gestation of the developing rat placenta. The developing rat placenta at day 13 and day 19 were used to localize the expression of PPAR isoforms (Figure 2). Each individual PPAR isoforms were localized to the syncytial trophoblast of rat placenta section slides, confirming their presence in the developing day 13 and day 19 rat placentas (Figure 2). Three RXR isoforms demonstrated ubiquitous expression patterns in both the junctional and labyrinth zones of the developing rat placenta (Figure 3). Both RXR and RXR isoforms were expressed at a fairly constant level through gestational day 13 until the term on day 21 by RT-PCR/ Southern blotting analysis, whereas RXR exhibited a fluctuation in the temporal and spatial expression patterns. The
Wang et al.: PPAR and RXR Isoforms in Rat and Human Placentas
665
Figure 2. Immunohistochemistry staining results of PPAR isoforms in the rat developing placenta at gestation day 13 and 19. The slides were pre-treated with citric buffer, incubated with polyclonal anti-rabbit primary antibody, then with secondary antibody, and then stained with DAB staining kit from Zymed. The control slide was incubated with non-immune rabbit IgG instead of primary antibody. The pictures were taken with Leica Microscope (magnification bar, 5 m). A–C: PPAR , and isoforms at gestation day 13, respectively. D–F: PPAR , and isoforms at gestation day 19, respectively. G: Control slide.
666
Placenta (2002), Vol. 23
Human placental expression
Figure 3. Expression of RXR , and isoforms in the rat placenta during the second half of gestation. (Top Panel) RT-PCR analysis showing temporal and spatial patterns of expression of rat RXR isoforms. RT-PCR was performed with specific primers for each mRNA. Reaction products were electrophoretically separated in 1.4% agarose gels. (Bottom Panel) Southern Blot analysis showing the temporal and spatial patterns of expression of rat RXR isoforms. RT-PCR products were transferred to nitrocellulose filers. The filers then were probed with specific biotin-labelled cDNAs. The images were visualized using a chemiluminescent system. J: junctional zone. L: Labyrinth zone.
expression of RXR increased in both the junctional and labyrinth zones with increasing gestational age of the rat placenta. At the same gestational age, however, RXR appears to exhibit stronger expression in the junctional zone when contrasted to the expression found in the labyrinth zone. Further investigation is required to illustrate the significance of these observations. The immunohistochemical staining of the day 13 and day 19 tissues demonstrated the presence of RXR, and in the developing rat placenta (Figure 4). RT-PCR analysis of the rat PPAR and RXR isoforms at Day 13 revealed faint expression of ethidium-labelled bands on the agarose gel that are not clearly observable in the presented blots. After hybridization with considerably more sensitive chemiluminscent probes, the signal was amplified and is apparent in the accompanying Southern Blots. It should also be mentioned that a certain degree of caution must be maintained when one considers the Day 13 staining of cells. At day 13, the chorioallantoic placenta is in the early stages of differentiating from common progenitor cell type(s). Based on the fact that at Day 11 the two zones are indistinguishable and that at Day 12 the zones are just beginning to be defined, the common expression observed in these cell types may be artifactual from the progenitor cell expression. The differences in the expression of the individual PPAR and RXR isoforms observed with the RT-PCR and immunohistochemical analysis may arise from the dissection methods utilized to separate the two zones for mRNA extraction. While the two zones are separable, there exists a possibility that residual junctional zone tissue may reside in the labyrinth zone tissue, and vice versa. Upon highly sensitive RT-PCR amplification, these residual contaminations may manifest themselves in the form of a band. In addition, lower levels of expression in other cell types may be obfuscated by the higher levels of expression observed in the syncytium upon immunohistochemical staining.
All three PPAR isoforms were detected in the human term placenta by RT-PCR (Figure 5). However, RXR isoforms exhibited different expression patterns. Both RXR and RXR were expressed in the human term placenta, while RXR was not detected. In trying to amplify human RXR isoform, we designed two sets of primers, however, no expression was determined under these conditions. Therefore we postulate that RXR might not be expressed in the human term placenta, however, we cannot rule out its expression in early developmental stages. Immunohistochemical staining with PPAR isoform antibodies illustrated the presence of the individual PPAR isoforms in the human placenta. In Figure 6, the staining for each PPAR isoform appears to be predominantly concentrated in the syncytial trophoblast layer. Consistent with our RT-PCR results, we did not detect the expression of RXR through the immunohistochemical staining with its specific antibody. The expression of the RXR and RXR isoforms were also concentrated in the syncytial trophoblast layer (Figure 6). The immunohistochemistry staining analysis revealed that the PPAR, and isoforms were also present in the syncytial trophoblast and cytotrophoblast cells in the human term placental slides. The cytotrophoblast staining might be expected due to the fact that they are precursor cells that help to form the syncytium in humans. These observations are consistent with the results of studies performed by Schaiff et al. (2000) and Waite et al. (2000).
DISCUSSION In this study, we have investigated the temporal and spatial distribution of PPAR and RXR isoforms in the developing rat chorioallantoic placenta and in the human term placenta. PPAR and RXR isoforms are nuclear hormone receptors that are known to regulate several physiological processes, including fatty acid homeostasis (Schoonjans et al., 1996). The results of our studies establish a framework for further investigations into the regulation of fatty acid transfer across and trafficking within the placenta. Defining the fundamental expression profiles of PPAR and RXR isoforms in the placenta may improve our understanding of mechanisms regulating fatty acid transfer across the placenta and it may eventually provide pharmaceutical avenues for the correction of abnormal placental fatty acid transfer. RT-PCR, Southern blotting and immunohistochemical analysis were utilized to demonstrate that the PPAR , and isoforms are present in the developing rat placenta from mid gestation day 13 to the term day 21, as demonstrated in Figures 1 and 2. As mentioned previously, each of the three PPAR isoforms has been theorized to have overlapping, yet distinct functions in mediating cellular fatty acid homeostasis (Schoonjans et al., 1995, 1996). For example, Deluca et al. (2000) determined that the functions of PPAR , and are
Wang et al.: PPAR and RXR Isoforms in Rat and Human Placentas
667
Figure 4. Immunohistochemistry staining results of RXR isoforms in the developing rat placenta at gestation day 13 and 19. The slides were pre-treated in citric buffer, incubated with polyclonal anti-rabbit primary antibody, then with secondary antibody, and then stained with DAB staining kit from Zymed. The control slide was incubated with non-immune rabbit IgG instead of primary antibody. The pictures were taken with Leica Microscope (magnification bar, 5 m). A–C: RXR , and isoforms at gestation day 13, respectively. D–F: RXR , and isoforms at gestation day 19, respectively. G: Control slide.
668
Figure 5. RT-PCR analysis of human PPAR and RXR , and mRNAs in human term placenta cDNA. RT-PCR was performed with specific primers for each mRNA. Reaction products were electrophoretically separated in 1.4% agarose gels.
complementary, as demonstrated by the treatment of PPARnull mice with high doses of PPAR/ specific ligands. The effect of these treatments lead to the PPAR-null mice exhibiting increased peroxisome proliferation in contrast to wild type mice, where classically the increase in peroxisome proliferation was ascribed primarily to the activation of PPAR (Deluca et al., 2000). The investigators postulated that the results are due to the overlap of physical functions of PPAR isoforms in vivo. In contrast, it has also been widely demonstrated that the PPAR , and isoforms possess different biological functions as well (Kliewer et al., 1994; Forman et al., 1995; Schoonjans et al., 1996). For instance, PPAR is mainly involved in lipid catabolism (Krey et al., 1997; Kliewer et al., 1994), whereas PPAR plays a critical role in preadipocyte differentiation and adipogenesis (Aperlo et al., 1995). PPAR was the first-discovered PPAR isoform (Issemann and Green, 1990), and it has been the most widely investigated isoform. PPAR is assumed to regulate many physiological aspects besides adipogenesis, including serving as a key regulating factor or a participant with other factors in the regulation of type II diabetes (Lehmann et al., 1997), inflammation (Forman et al., 1995), and immune system function (Peraldi, Xu and Spieglman, 1997). The PPAR isoform has been shown to be actively involved in the placenta development in mice, rats and humans. Barak et al. investigated the biological importance of PPAR by using PPAR knockout mice (Barak et al., 1999). Unlike the PPAR knockout mice, PPAR knockout mice did not survive gestation. The PPAR knockout mice demonstrated an embryonic lethal phenotype, dying at day 10 of gestation. Human placental studies performed by Schaiff et al. demonstrated the presence of PPAR protein in the term human placenta by immunohistochemical analysis (Schaiff et al., 2000), which were confirmed with mRNA analysis by Northern Blotting (Marvin et al., 2000). Though the PPAR isoform is considered widely expressed throughout various rat and human tissues (Schoonjans et al., 1996; Latruffe and Vamecq, 1997), the physiological significance of PPAR is not well defined. Recently, studies have suggested that the role of PPAR is to function as an upstream regulator of PPAR expression (Bastie et al., 1999; Berger et al., 1999). These investigators claim that the expression of PPAR is earlier than the onset of PPAR in the fibroblasts
Placenta (2002), Vol. 23
and decreases over time, while PPAR expression increases during this period. In our present study, the expression of PPAR does not change along with the gestation in the developing rat placenta, from day 13 to day 21, both in the junctional and the labyrinth zones (Figure 1). PPAR is also present in human term placenta (Figure 5). Further investigations are required to elucidate the exact physiological functions of PPAR. Since the PPAR and RXR isoforms are known to form heterodimer PPAR/RXR regulatory complexes to react with PPRE sites in the promoter regions of genes, RXR isoforms need to be included when we are investigating the regulatory roles of PPAR isoforms. RXR isoforms also belong to the superfamily of nuclear hormone receptors and are considered as ‘master’ receptors. They not only can form heterodimers with PPAR isoforms, but they can bind with other nuclear hormone receptors, such as all-trans-retinoic acid receptors (RAR), vitamin D3 receptors, thyroid hormone receptors as well as others, and they can even form RXR-RXR homodimers (Mangelsdorf et al., 1992; Mangelsdorf and Evans, 1995). In addition, the only naturally-occurring ligand for RXR isoforms is 9-cis retinoic acid (a derivative of vitamin A), while PPAR isoforms can be activated by many ligands. In our present study, all RXR isoforms exhibit ubiquitous and similar expression profiles in the developing rat placenta, starting from day 13 to day 21. The general expression patterns of RXR isoforms may indicate they are involved in regulating many different physiological activities of rat placenta. Interestingly, RXR isoforms have different expression patterns in human term placenta (Figure 6) than in the developing rat placentas (Figure 4). Our results demonstrate that both the RXR and RXR isoforms are expressed in the human term placenta. The importance of RXR isoform expression in the human placenta may be derived from studies demonstrating the importance of vitamin A and its derivatives (including 9-cis-retinoic acid) in guiding embryonic development and placenta formation. For example, Guibourdenche et al. found that treatment of cytotrophoblasts with 9-cis-retinoic acid doubled the placental secretion of human chorionic gonadotropin (Guibourdenche et al., 2000). In addition, Guibourdenche et al. found that the RXR isoform was specifically expressed in human term chorionic villi, while the RXR was not significantly observed (Guibourdenche et al., 2000). The function of each RXR isoform in the regulation process is still under considerable investigation, with no clear understanding currently established. One investigation (Mangelsdorf and Evans, 1995) argued that only RXR binds with PPAR isoforms, forming regulatory heterodimer. Other studies have argued that RXR isoforms undoubtedly are of critical importance in the embryonic development (Maden, 2000). Wendling and coworkers discovered that mouse embryos carrying null mutations of both retinoid X receptors alpha and beta (RXR / /RXR / mutants) died between 9.5 and 10.5 days of gestation and display a wide range of abnormalities (Wendling et al., 1999). These studies suggested that RXR isoforms are of critical importance in the normal development
Wang et al.: PPAR and RXR Isoforms in Rat and Human Placentas
669
Figure 6. Immunohistochemistry staining results of the PPAR and RXR isoforms in the human term placenta. The slides were deparaffinized in xylene, incubated with polyclonal anti-rabbit primary antibody, then with secondary antibody, and then stained with DAB staining kit from Zymed. The control slide was incubated with non-immune rabbit IgG instead of primary antibody. The pictures were taken with Leica Microscope (magnification bar, 5 m). A–C: human PPAR , and isoforms, respectively. D–F: RXR , and isoforms, respectively. G: control slide.
670
of placenta. The function and roles of these isoforms in mediating these responses remains to be determined. Although the exact role of each RXR isoform is not fully understood, it is believed that each expressed RXR isoform is critical to proper placental development (Wendling et al., 1999; Mangelsdorf et al., 2000). In summary, the temporal and spatial expression distribution of PPAR and RXR isoforms has been described in the developing rat placenta and the human term placenta. PPAR
Placenta (2002), Vol. 23
and RXR isoforms belong to the superfamily of nuclear hormone receptors, and they integrally regulate lipid homeostasis by stimulating relevant gene transcription, including fatty acid transferring proteins and fatty acid oxidizing enzymes. The establishment of the temporal and spatial expression distribution of PPAR and RXR isoforms in these tissues provides a framework for the further investigation of their functional importance and physiological relevancy in guiding proper foetal development.
ACKNOWLEDGEMENTS The authors would like to thank Dr Michael J. Soares for his considerable advice and assistance in preparing this manuscript, Ms Dea Herrera-Ruiz for her technical assistance on this project, and Mr Rajesh Patel (Department of Pathology, UMDNJ) for preparation the cryostat sections of developing rat placenta. This work was primarily supported by research funds provided by Rutgers University College of Pharmacy and the Department of Pharmaceutics.
REFERENCES Abel EL (1984) Fetal Alcohol Syndrome and Fetal Effects. Oradell, NJ: Medical Economics Books. Aperlo C, Pognonec P, Saladin R, Auwerx J & Boulukos KE (1995) cDNA cloning and characterization of the transcriptional activities of the hamster peroxisome proliferator-activated receptor. Gene, 162, 297–302. Barak Y, Nelson MC, Ong ES, Jones YZ, Ruiz-Lozano P, Chien KR, Koder A & Evans RM (1999) PPAR gamma is required for placental, cardiac, and adipose tissue development. Mol Cell, 4, 585–595. Bastie C, Holst D, Gaillard D, Jehl-Pietri C & Grimaldi PA (1999) Expression of peroxisome proliferator-activated receptor PPAR promotes induction of PPAR and adipocyte differentiation in 3T3C2 fibroblasts. J Biol Chem, 274, 21290–21295. Belury M, Moya-Camarena SY, Sun H, Snyder E, Davis JW, Cunningham ML & Vanden Heuvel JP (1998) Comparison of doseresponse relationship for induction of lipid metabolizing and growth regulatory genes by peroxisome proliferators in rat liver. Toxi Applied Pharma, 151, 254–261. Berger J, Leibowitz MD, Doebber TW, Elbrecht A, Zhang B, Zhou G, Biswas C, Cullinan CA, Hayes NS, Li Y, Tanen M, Ventre J, Wu MS, Berger GD, Mosley R, Marquis R, Santini C, Sahoo SP, Tolman RL, Smith RG & Moller DE (1999) Novel proliferator-activated receptor and PPAR ligands produce distinct biological effects. J Biol Chem, 274, 6718–6725. Braissant O, Foufelle F, Scotto C, Dauca M & Wahli W (1996) Differential expression of peroxisome proliferator-activated receptors: tissue distribution of PPAR-, and in the adult rat. Endocrinology, 137, 354–366. Campbell FM, Gordon MJ & Dutta-Rov AK (1994) Plasma membrane fatty acid binding protein (FABPpm) of the sheep placenta. Biochimica Biophysicica Acta, 1214, 187–192. Campbell FM, Clohessy AM, Gordon MJ, Page KR & Dutta-Roy AK (1997) Uptake of long chain fatty acids by human placental carcinoma (BeWo) cells: role of plasma membrane fatty acid-binding protein. J Lipid Res, 38, 2558–2568. Campbell FM, Clohessy AM, Gordon MJ, Page KR & Dutta-Roy AK (1998) Placental membrane fatty acid-binding protein preferentially binds arachidonic and docosahexaenoic acid. Life Sci, 63, 235–240. Crabtree JT, Gordon MJ, Campbell FM & Dutta-Roy AK (1998) Differential distribution and metabolism of arachidonic acid and docosahexaenoic acid by human placental chriocarcinoma (BeWo) cells. Mol Cell Biochem, 185, 191–198. Cullingford TE, Bhakoo K, Peuchen S, Dolphin CT, Patel R & Clark JB (1998) Distribution of mRNAs encoding the peroxisome proliferatoractivated receptors , , and and retinoid X receptor , , and in rat central nervous system. J Neurochem, 70, 1366–1375. Deluca JG, Doebber TW, Kelly LJ, Kemp RK, Molon-Noblot S, Sahoo SP, Ventre J, Wu MS, Peters JM, Gonzalez FJ & Moller DE (2000) Evidence for Peroxisome Proliferator-Activated Receptor (PPAR)alphaIndependent Peroxisome Proliferation: Effects of PPARgamma/deltaSpecific Agonists in PPARalpha-Null Mice. Mol Pharmacol, 58, 470–476.
Denkins YM, Woods J, Whitty JE, Hannigan JH, Martier SS, Sokol RJ & Salem N Jr (2000) Effects of gestational alcohol exposure on the fatty acid composition of umbilical cord serum in humans. Am J Clin Nutr, 71, 300S–306S. Dutta-Roy AK (2000) Transport mechanisms for long-chain polyunsaturated fatty acids in the human placenta. Am J Clin Nutr, 71, 315S–322S. Faria TN & Soares MJ (1991) Trophoblast cell differentiation: establishment, characterization, and modulation of a rat trophoblast cell line expressing members of the placental prolactin family. Endocrinology, 129, 2895–2906. Flynn M, Scott TR, Pritchard TC & Plata-Salaman CR (1998) Mode of action of OB protein (leptin) on feeding. Am J Physio, 44, 174–179. Forman B, Tontonoz P, Chen J, Brun RP, Spiegelman BM & Evans RM (1995) 15-deoxy-12,14-Prostaglandin J2 is a ligand for the adipocyte determination factor PPAR. Cell, 83, 803–812. Forman BM, Chen J & Evans RM (1997) Hypolipidemic drugs, polyunsaturated fatty acids, and eicosanoids are ligands for peroxisome prolifearator-activated receptors and . Proc Natl Acad Sci USA, 94, 4312–4317. Freebern W, Niles EG & LoVerde PT (1999) RXR-2 a member of the retinoid X receptor family in Schistoma mansoni. Gene, 233, 33–38. Guibourdenche J, Alsat E, Soncin F, Rochette-Egly C & Evain-Brion D (2000) Retinoid receptors expression in human term placenta: involvement of RXR alpha in retinoid induced-hCG secretion. J Clin Endocrinol Metab, 83(4), 1384–1387. Hamilton J (1998) Fatty acid transport: difficult or easy? J lipid Res, 39, 467–481. Hamilton J & Kamp F (1999) How are free fatty acids transported in membranes? Diabetes, 48, 2255–2269. Hoggard N, Hunter L, Duncan JS, Williams LM, Trayhurn P & Mercer JG (1997) Leptin and leptin receptor mRNA and protein expression in the murine fetus and placenta. Proc Natl Acad Sci USA, 94, 11073–11078. Hornstra G, Al MD, van Houwelingen AC & Foreman-van Drongelen MM (1995) Essential fatty acids in pregnancy and early human development. Eur J Obs & Gyn, 61, 57–62. Issemann I & Green S (1990) Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature, 347, 645–650. Kliewer SA, Forman BM, Blumberg B, Ong ES, Borgmeyer U, Mangelsdorf DJ, Umesono K & Evans RM (1994) Differential expression and activation of a family of murine peroxisome proliferator-activated receptors. Proc Natl Acad Sci USA, 91, 7355–7359. Kliewer SA, Sundseth SS, Jones SA, Brown PJ, Wisely GB, Koble CS, Devchand P, Wahli W, Willson TM, Lenhard JM & Lehmann JM (1997) Fatty acids and eicosanoids regulate gene expression through direct interaction with peroxisome proliferator-activated receptor and . Proc Natl Acad Sci USA, 94, 4318–4323. Knipp GT, Audus KL & Soares MJ (1999) Nutrient transport across the placenta. Adv Drug Deliv Rev, 38, 41–58. Knipp GT, Liu B, Audus KL, Fujii H, Ono T & Soares MJ (2000) Fatty acid transport regulatory proteins in the developing rat placenta and in trophoblast cell culture models. Placenta, 21, 367–375. Krey G, Keller H, Mahfoudi A, Medin J, Ozato K, Dreyer C & Wahli W (1993) Xenopus peroxisome proliferator-activated receptors: genomic
Wang et al.: PPAR and RXR Isoforms in Rat and Human Placentas organization, response element recognition, heterodimer formation with retinoid X receptor and activation by fatty acids. J Steroid Biochem Molec Biol, 47, 65–73. Krey G, Braissant O, L’Horset F, Kalkhoven E, Perroud M, Parker MG & Wahli W (1997) Fatty acids, eicossaniods, and hypolipidemic agents identified as ligands of peroxisome proliferator-activated receptors by co-activator-dependent receptor ligand assay. Mol Endocrinol, 11, 779–791. Lambe KG & Tugwood JD (1996) A human peroxisome proliferatoractivated receptor ( is activated by inducers of adipogenesis, including thiazolidinedione drugs. Euro J Biochem, 239, 1–7. Latruffe N & Vamecq J (1997) Peroxisome proliferator and peroxisome proliferator-activated receptors as regulators of lipid metabolism. Biochimie, 79, 81–94. Lehmann JM, Lenhard JM, Oliver BB, Ringold GM & Kliewer SA (1997) Peroxisome proliferator-activated receptor and - are activated by indomethacin and other non-steroid anti-inflammatory drugs. J Biol Chem, 272, 3406–3410. Lemberger T, Staels B, Saladin R, Desvergne B, Auwerx J & Wahli W (1994) Regulation of the peroxisome proliferator-activated receptor alpha gene by glucocorticoids. J Biol Chem, 269, 24527–24530. Lemberger T, Desvergne B & Whali W (1996) Peroxisome proliferatoractivated receptor: a nuclear receptor signaling pathway in lipid physiology. Annu Rev Cell Dev, 12, 335–363. Levin AA, Sturzenbecker LJ, Kazmer S, Bosakowski T, Huselton C, Allenby G, Speck J, Kratzeisen C, Rosenberger M & Lovey A (1992) 9-cis retinoic acid stereoisomer binds and activates the nuclear receptor RXR. Nature, 355, 359–361. Maden M (2000) The role of retinoic acid in embryonic and post-embryonic development. Proc Nutr Soc, 59, 65–73. Mangelsdorf DJ, Borgmeyer U, Heyman RA, Zhou JY, Ong ES, Oro AE, Kakizuka A & Evans RM (1992) Characterization of three RXR genes that mediate the action of 9cis retinoic acid. Genes Dev, 6, 329–344. Mangelsdorf DJ & Evans RM (1995) The RXR heterodimers and orphan receptors. Cell, 83, 841–850. Martin G, Schoonjans K, Lefebvre AM, Staels B & Auwerx J (1997) Coordinate regulation of the expression of the fatty acid transport protein and acyl-CoA synthetase genes by PPAR and PPAR activators. J Biol Chem, 272, 28210–28217. Marvin KW, Eykholt RL, Keelan JA, Sato TA & Mitchell MD (2000) The 15-deoxy-delta(12,14)-prostaglandin J(2)receptor, peroxisome proliferator activated receptor-gamma (PPARgamma) is expressed in human gestational tissues and is functionally active in JEG3 choriocarcinoma cells. Placenta, 21(4), 436–440. McDonald OA & Lane MD (1995) When precursors are also regulators. Current Biology, 5, 618–621. Mukherjee R, Noonan D & McDonnell DP (1994) Human and rat peroxisome proliferator-activated receptors demonstrate similar tissue distribution but different responsiveness to PPAR activators. J Steroid Biochem Molec Biol, 51, 157–166. Mukherjee R, Jow L, Croston GE & Paterniti JR Jr (1997) Identification, characterization, tissue distribution peroxisome proliferator-activated receptor isoforms PPAR2 versus PPAR1 and activation with retinoid X receptor agonists and antagonists. J Biol Chem, 272, 8071–8076.
671 Narumiya S & Fukushima M (1986) Site and mechanism of growth inhibition by PGs. J Pharmaco Experi Therap, 239, 500–511. Niot I, Poirier H & Besnard P (1997) Regulation of gene expression by fatty acids: Special reference to fatty acid-binding protein (FABP). Biochimie, 79, 129–131. Ogata ES, Lane HR & Simmons RA (1997) Placental transport in fetal growth retardation. In Placental Function and Fetal Nutrition (Ed.) Battaglia FC, pp. 97–112. Nestle Nutrition Workshop Series, Vol. 39. Peraldi P, Xu M & Spiegelman BM (1997) Thiazolidinediones block tumor necrosis factor -induced inhibition of insulin signaling. J Clin Invest, 100, 1863–1869. Schoonjans K, Watanabe M, Suzuki H, Mahfoudi A, Krey G, Wahli W, Grimaldi P, Staels B, Yamamoto T & Auwerx J (1995) Induction of the acyl-CoA synthetase gene by fibrates and fatty acids is mediated by a peroxisome proliferator response element in the C promoter. J Biol Chem, 270, 19269–19276. Schoonjans K, Staels B & Auwerx J (1996) Role of peroxisome proliferatoractivated receptor in mediating the effects of the fibrates and fatty acids on gene expression. J of Lipid Research, 37, 907–925. Schaiff WT, Carlson MG, Smith SD, Levy R, Nelson DM & Sadovsky Y (2000) Peroxisome proliferator-activated receptor-gamma modulates differentiation of human trophoblast in a ligand-specific manner. J Clin Endocrinol Metab, 85(10), 3874–3881. Simoneau J, Veerkamp JH, Turcotte LP & Kelley DE (1999) Markers of capacity to utilize fatty acids in human skeletal muscle: relation to insulin resistance and obesity and effects of weight loss. FASEB J, 13, 2051–2060. Soares MJ (1987) Developmental changes in the intraplacental distribution of placental lactogen and alkaline phosphatase in the rat. J Reprod Fert, 79, 93–98. Soares MJ, Handwerger S & Talamantes F (1993) Trophoblast Cells. New York: Springer-Verlag, Ch 4, pp. 45–65. Soares MJ (1997) Molecular Mechanisms of Placental Development. In Placental Function and Fetal Nutrition (Ed.) Battaglia FC, pp. 31–45. Nestl Nutrition Workshop Series, Vol. 39. Philadelphia, PA: Nestec Ltd. Vevey/ Lippincott-Raven Publishers. Uauy R, Mena P & Valenzuela A (1999) Essential fatty acids as determinants of lipid requirement in infants, children and adults. Euro J Clin Nutr, 53, S66–S77. Uauy R & Hoffman DR (2000) Essential fat requirement of preterm infants. Am J Clin Nutr, 71(Suppl), 245S–250S. Vamecq J & Latruffe N (1999) Medical significance of peroxisome proliferator-activated receptors. Lancet, 354, 141–148. Vidal-Puig A, Jimenez-Linan M, Lowell BB, Hamann A, Hu E, Spiegelman B, Flier JS & Moller DE (1996) Regulation of PPAR gene expression by nutrition and obesity in rodents. J Clin Invest, 98, 2553–2561. Waite LL, Person EC, Zhou Y, Lim KH, Scanlan TS & Taylor RN (2000) Placental peroxisome proliferator-activated receptor-gamma is up-regulated by pregnancy serum. J Clin Endocrinol Metab, 85, 3808–3814. Wendling O, Chambon P & Mark M (1999) Retinoid X receptors are essential for early mouse development and placentogenesis. Proc Natl Acad Sci U S A, 96, 547–551. West JS (1994) Recent finding on the mechanisms by which alcohol damages the developing nervous system. Alcohol & Alcoholism, Suppl, 2, 395–399.