Expression of proliferating cell nuclear antigen (PCNA) in the adult and developing mouse nervous system

Molecular Brain Research 78 (2000) 163–174 www.elsevier.com / locate / bres

Research report

Expression of proliferating cell nuclear antigen (PCNA) in the adult and developing mouse nervous system Hidetoshi Ino*, Tanemichi Chiba Third Department of Anatomy, Chiba University School of Medicine, 1 -8 -1 Inohana, Chuo-ku, Chiba 260 -8670, Japan Accepted 18 April 2000

Abstract Proliferating cell nuclear antigen (PCNA) is essential for the function of DNA polymerases d and e. Because proliferating cell nuclear antigen is required for DNA replication and repair, PCNA is abundantly expressed in proliferating cells. Interestingly, PCNA mRNA has also been detected in the adult mouse brain by Northern blot analysis. In this study, two monoclonal antibodies against PCNA, PC10 and 19F4, were used for Western blot analysis. Monoclonal antibody PC10, but not 19F4, detected a band in the adult mouse brain extract. This PC10-reactive protein in the brain displayed a more acidic isoelectric point than PCNA by two-dimensional gel electrophoresis. In situ hybridization showed that PCNA mRNA was abundantly expressed in the adult mouse subventricular zone. Additionally, relatively low levels of PCNA mRNA expression were also found in neurons throughout the central nervous system, however, no hybridization was observed in the white matter. Immunohistochemistry was also performed using 19F4 and PC10, and staining of progenitor cell nuclei in the subventricular zone was observed with both antibodies. Whereas 19F4 immunostaining was restricted to progenitor cells, PC10 immunostaining was also found in postmitotic nonproliferating cell nuclei. In the cortical neuroepithelium of developing mice, the distribution of PC10 immunoreactivity was wider than that of 19F4 immunoreactivity and PCNA mRNA expression. These results suggest that proliferating cell nuclear antigen mRNA is expressed not only in proliferating cells but also in nonproliferating cells such as neurons. The protein recognized only with PC10 may be a modified, most probably a phosphorylated PCNA.  2000 Published by Elsevier Science B.V. Theme: Development and regeneration Topic: Cell differentiation and migration Keywords: PCNA; Cell cycle; Cell proliferation; Development; Neurogenesis

1. Introduction Proliferating cell nuclear antigen (PCNA) is a 36-kDa protein known as the DNA polymerase d auxiliary or processivity factor [8,28,29,39], and it is required for DNA replication [1,4,9,34,35,40,41] and repair [37,46]. PCNA is also an auxiliary factor for DNA polymerase e, another essential eukaryotic DNA polymerase [10,22,33]. PCNA expression shows periodic fluctuation in accordance with the cell cycle. PCNA is synthesized during the late G1early S phase of the cell cycle, immediately preceding the onset of DNA synthesis, is most abundant during the S phase, and declines during the G2 / M phase [20,21]. X-ray crystallography has shown that PCNA molecules form a *Corresponding author. Tel.: 181-43226-2024; fax: 181-43226-2025. E-mail address: [email protected] (H. Ino)

trimeric ring around DNA [19]. PCNA also associates with other cell cycle-related proteins such as cyclins, cyclindependent kinases, p21 Waf1 / Cip1 [44,47] and Gadd45 [12,14,38]. Because of its close relation to the cell cycle, PCNA is used as a physiological or pathological marker protein of proliferating cells [13,20]. It is well known that the adult brain is an organ that contains only a few proliferating cells. Differentiated neurons lose the ability to divide and do not proliferate further under any known condition. Glia (astrocytes, oligodendrocytes and microglia), ependymal cells, endothelial cells and fibroblasts are normally quiescent, although they can proliferate during unusual pathological conditions such as gliosis or fibrosis. Developmental studies of the rat central nervous system, using [ 3 H]thymidine as a marker of DNA replication, indicate that most neurons cease proliferating during the early

0169-328X / 00 / $ – see front matter  2000 Published by Elsevier Science B.V. PII: S0169-328X( 00 )00092-9

164

H. Ino, T. Chiba / Molecular Brain Research 78 (2000) 163 – 174

postnatal period. However, some granule cells in the olfactory bulb, dentate gyrus and cerebellum exceptionally continue to proliferate into the juvenile and adult periods [5,6,17]. Especially in the subventricular zone (SVZ) and the subgranular zone of the dentate gyrus, proliferation of progenitor cells is observed during the adult period [2,3,25,27]. Progenitor cells in the SVZ differentiate into neurons, that is, granule cells and periglomerular cells in the olfactory bulb [18,26,27] and glia [23], or undergo cell death [30]. However, the populations of these cells are very small in relation to the whole brain, and accordingly contribute little to Northern and Western blot analyses. Therefore, the normal mature brain, as a whole, is composed of quiescent tissue. In spite of this fact, it has been previously reported that PCNA mRNA is detectable in the normal adult rat brain by Northern blot analysis [24]. However, PCNA protein could not be detected by Western blot analysis. Thus, it was concluded that PCNA is transcripted, but not translated in the brain by post-translational regulation. In this study, we show our observations of a PCNA or a PCNA-like protein by Northern and Western blotting, immunohistochemistry and in situ hybridization in the mature and developing mouse central and peripheral nervous systems.

2. Materials and methods

2.1. cDNA probes and antibodies Mouse PCNA cDNA (1.0 kbp) was synthesized by polymerase chain reaction (PCR) from mouse embryo first-strand cDNA. The primers 59GGAAGCTTAGAGTAGCTCTCATC39 and 59GGGAATTCGTGACAGAAAAGACCTC39 were designed according to the DDBJ / GenBank / EMBLE DNA data base [accession number X57800]. After digestion with restriction endonucleases Hind III and EcoR I, the PCR product was cloned into the pBluescript II SK(1) vector (Stratagene, La Jolla, CA). Mouse monoclonal anti-PCNA antibody clone PC10 [43] was obtained from Pharmingen (San Diego, CA), clone 19F4 [32] from Roche Diagnostics.

2.2. Northern and Western blot analyses Northern blot analysis was performed as described previously [15]. Western blot analysis was performed as described previously with some modifications [16]. Briefly, adult male (about 8 weeks old) and postnatal (from P0 to P21) ddY mice were perfused with ice-cold saline through the heart to wash out endogenous immunoglobulins in blood. Mouse whole embryos (E12) or embryonal brains (from E12 to E18) were removed and briefly rinsed with ice-cold saline. The tissue was homogenized in 50 mM Tris–HCl, pH 7.5 and 1 mM phenylmethylsulfonyl fluoride (PMSF), and the supernatants were collected after

centrifugation at 10,0003g for 5 min. Crude extracts (50 mg) were subjected to 10% SDS–polyacrylamide gel electrophoresis. Proteins were blotted onto polyvinylidene difluoride filters (Immobilon P, Millipore). Blocking was performed with 5% skim milk in phosphate buffered saline (PBS). The anti-PCNA antibodies (PC10 and 19F4) and peroxidase-conjugated anti-mouse IgG antibody (Vector Labs., Burlingame, CA) were diluted to 1:2000. Washing was performed with 0.05% Tween-20 in PBS. Signals were detected with ECL or ECL Plus Western blotting detection reagents (Amersham Pharmacia). The day after mating was defined as embryonic day zero (E0).

2.3. Two-dimensional gel electrophoresis The tissue was homogenized in 1% Triton X-100, 10 mM Tris–HCl, pH 7.5 and 1 mM PMSF, and the supernatants were collected after centrifugation at 10,0003g for 5 min. Adult mouse brain and E12 whole embryo crude extracts (200 mg and 10 mg, respectively) were applied to isoelectric focusing gel rods (Immobiline DryStrip, pH 4–7L, 7 cm, Amersham Pharmacia) in the presence of 8 M urea, 0.5% Triton X-100, 40 mM DTT, 0.5% Ampholine (pH 3.5–9.5) and carbamylated carbonic anhydrase marker proteins (Carbamylate calibration kit, Amersham Pharmacia). Electrophoresis was performed using an IPGphor (Amersham Pharmacia) according to the manufacturer’s protocol. Gel rods were then placed on 10% SDS–polyacrylamide gel slabs, and electrophoresis was performed. After blotting onto filters, the filters were stained with 0.1% Amido Black 10B in 12.5% isopropanol and 5% acetic acid and destained with the same solution without dye. The digital image was saved using a scanner. Then blocking, immunoreaction and detection were performed as above. Brain and E12 filters were reacted with PC10 and 19F4, respectively. After first immunoreaction, E12 filters were blocked again and reprobed with PC10. The immunostained image was superimposed on the dyestained image using Adobe Photoshop.

2.4. In situ hybridization In situ hybridization was performed as described previously with some modifications [15]. Sections of developing mouse brains were prepared by the same procedure to make sections for immunohistochemistry. Mouse PCNA cDNA was used as a template for the synthesis of digoxigenin-labeled cRNA probes. Probe concentration was approximately 0.5 mg / ml in hybridization solution. The probes were hydrolyzed with alkaline to an average size of 300 nucleotides.

2.5. Immunohistochemistry Fixed organs were heat-treated prior to making frozen sections. Tissue preparation, heat-treatment and immuno-

H. Ino, T. Chiba / Molecular Brain Research 78 (2000) 163 – 174

histochemistry were performed as described previously [16]. Before heat-treatment, adult and neonatal brains were sliced to 3-mm thickness and spinal cords were cut to 5-mm length. Embryonal brains were fixed by immersing into a fixation solution for 2 days at 48C and processed as adult organs. Adult brains, spinal cords and trigeminal ganglia were heat-treated for 3 min. Embryonal and neonatal brains were heat-treated for 2 min. Anti-PCNA antibodies (PC10 and 19F4) were diluted to 1:2000. After the immunostaining, adult brain, spinal cord and trigeminal ganglion sections were stained with Luxol fast blue. All

165

animals were treated and cared for in accordance with the Chiba University School of Medicine Guidelines.

3. Results

3.1. Northern and Western blot analyses Northern blot analysis was performed by probing mouse total RNA with mouse PCNA cDNA (Fig. 1A). Strong positive signals were seen in whole embryo (E12) and

Fig. 1. (A) Northern blot analysis of mouse PCNA mRNA. Total RNA (10 mg per lane) was subjected to 1% agarose gel electrophoresis, blotted onto nylon filters and hybridized with 32 P-labeled mouse PCNA cDNA probe. After removal of the PCNA probe with hot 0.5% SDS, filters were rehybridized with a rat glyceraldehyde-3-phosphate dehydrogenase (G3PDH) cDNA probe as a control. The positions of 28S (4.5 kb) and 18S (1.9 kb) rRNAs are indicated. (B) Northern blot analysis of PCNA mRNA from developing mouse brains. The experimental conditions were as above.

166

H. Ino, T. Chiba / Molecular Brain Research 78 (2000) 163 – 174

adult thymus, spleen and testis samples. Bands were also observed at lower intensities in the adult brain, muscle, kidney and liver samples at the same position. The positive bands observed in the brain, muscle, kidney and liver samples were remarkable, because these tissues normally contain only a few proliferating cells. We continued experiments by focusing on the brain. PCNA mRNA expression in developing mouse brain is shown in Fig. 1B. Intense bands were observed from E12 to E14, then the intensity gradually decreased and reached the adult level.

Western blot analysis was performed on crude extracts of mouse whole embryo (E12) and adult brain and testis by probing with the anti-PCNA antibodies (PC10 and 19F4) (Fig. 2A). Both antibodies detected bands in embryo and testis, however, only PC10 showed a positive band in brain extract. From these results, we deduced that the protein detected with PC10 in mouse brain may be a modified PCNA or a distinct PCNA-like protein, in which the PC10 epitope is conserved and the 19F4 epitope is not. The band in testis detected with 19F4 was much weaker than that

Fig. 2. (A) Western blot analysis using anti-PCNA antibodies (PC10 and 19F4) in mouse E12 whole embryo and in adult brain and testis. Crude extracts (50 mg per lane) were subjected to 10% SDS–polyacrylamide gel electrophoresis, blotted onto filters and reacted with either PC10 or 19F4. The arrowhead indicates the position of PCNA. Bands seen at approximately 55 kDa were due to endogenous immunoglobulin heavy chains. (B) Western blot analysis using anti-PCNA antibodies (PC10 and 19F4) in developing mouse brains. The experimental conditions were as above.

H. Ino, T. Chiba / Molecular Brain Research 78 (2000) 163 – 174

detected with PC10, whereas the band intensity in embryos showed no apparent difference between the antibodies, suggesting that high levels of the PCNA-like protein may also be present in testis. Results of Western blot analysis with PC10 and 19F4 in developing mouse brains are shown in Fig. 2B. Staining with 19F4 disappeared after E18, but PC10 staining was seen up to the adult period, although the intensity gradually weakened during development.

3.2. Two-dimensional gel electrophoresis of PCNA For further analysis of the PCNA-like protein observed in the adult brain, we performed two-dimensional gel electrophoresis. Amido Black staining of marker proteins and immunostaining with PC10 and 19F4 were combined to detect a slight difference of isoelectric points. The protein in the brain stained with PC10 showed a slight but distinct acidic shift in the isoelectric point compared to PCNA stained with 19F4 in the E12 embryo (Fig. 3A, B). In the embryo, a spot with PC10 was composed of two partially overlapping parts (small acidic and large basic

167

parts) (Fig. 3C), which indicates that both the above two proteins were included in this sample.

3.3. In situ hybridization of PCNA in the adult mouse nervous system To investigate the relationship between PCNA mRNA expression and 19F4 and PC10 immunoreactivity, we conducted histological studies. First, in situ hybridization was performed on the adult mouse nervous system using antisense and sense digoxigenin-labeled mouse PCNA cRNA probes. Intense signals with the antisense probe were observed in the SVZ, especially in the lateral corner of the lateral ventricle (Fig. 4A). Positive cells were continuously observed from the olfactory ventricle, the lateral ventricle extending into the olfactory bulb, to the lateral wall of the more caudal part of the lateral ventricle. Because the distribution of PCNA expression in the SVZ coincides with that of bromodeoxyuridine incorporation, those cells are considered to be proliferating progenitor cells (data not shown). PCNA mRNA was also expressed in several neurons, such as pyramidal cells of the hippocampus and granule cells of the dentate gyrus as well as

Fig. 3. Two-dimensional gel electrophoresis of PCNA. Adult mouse brain and E12 whole embryo (200 mg and 10 mg, respectively) crude extracts with the carbamylated carbonic anhydrase marker protein were subjected to two-dimensional gel electrophoresis, blotted onto filters, stained with Amido Black 10B and reacted with either PC10 or 19F4. Brain (A) and E12 embryo (B, C). Immunostained spots with PC10 (A, C) and 19F4 (B) (left panels) and immunostained spots superimposed on Amido Black-stained marker spots (right panels). Arrows indicate immunostained spots. Asterisks indicate spots of the identical marker protein. Note that PC10-reactive protein in the brain displays a more acidic isoelectric point than 19F4-reactive protein in the embryo. (C) is obtained by reprobing of the filter used in (B).

168

H. Ino, T. Chiba / Molecular Brain Research 78 (2000) 163 – 174

Fig. 4. In situ hybridization of PCNA. Sections were hybridized with antisense (A, C, E) and sense (B, D, F) probes for mouse PCNA. Frontal sections of subventricular zone (A, B), hippocampus and dentate gyrus (C, D) and cerebral cortex (E, F). Progenitor cells in the subventricular zone, neurons in the hippocampus, dentate gyrus and cerebral cortex were stained only with the antisense probe. LV, lateral ventricle; S, striatum; cc, corpus callosum; DG, dentate gyrus; CA1, CA1 region of hippocampal pyramidal cells. Scale bar5200 mm.

neurons of the cerebral cortex (Fig. 4C, E) and neurons of other areas in the central nervous system (data not shown), though the hybridization signals were weaker than those in the SVZ. However, no apparent staining was observed in

the white matter of the central and peripheral nervous systems and in neurons of the peripheral nervous system, such as the trigeminal ganglion (data not shown). The sense probe gave no hybridization signals (Fig. 4B, D, F).

H. Ino, T. Chiba / Molecular Brain Research 78 (2000) 163 – 174

3.4. Immunohistochemistry of PCNA in the adult mouse nervous system Next, we performed immunohistochemistry. Strong immunostaining with both 19F4 and PC10 was observed in nuclei of cells in the SVZ of adult mice (Fig. 5A, B). The distribution of positive cells stained with 19F4 and PC10 in the SVZ was similar to that of PCNA mRNA expression observed by in situ hybridization (Fig. 4A). A small number of cells in the subgranular zone of the dentate gyrus were also intensely stained by both 19F4 and PC10 (Fig. 5C, D). Although 19F4 immunostaining in the mature brain was restricted to the SVZ and subgranular zone, PC10 immunostaining was observed in cell nuclei throughout the mouse brain. Notably, glia in the white matter exhibited intense staining. Results are shown for the corpus callosum, the lateral olfactory tract, the medulla of the cerebellum and the anterior and lateral funiculi of the spinal cord (Fig. 5B, E–G). We presume that these glia may be oligodendrocytes, although precise identification of the cell type was not performed. Granular cells in the dentate gyrus and cerebellar nuclear neurons showed PC10 immunostaining (Fig. 5D, F). Weak staining with PC10 was also observed in nuclei of other types of neurons and glia, such as pyramidal cells and astrocytes in the hippocampus (Fig. 5D). In the peripheral nervous system, such as in trigeminal ganglia, staining of nuclei was observed in sensory neurons (Fig. 5H). Although no detectable expression of PCNA mRNA was seen in glia of the white matter, PC10 strongly stained these cells. On the other hand, PCNA mRNA expression was observed in neurons of the hippocampus and cerebral cortex, and PC10 immunoreactivity was also observed in these cells, even though the intensity was much weaker than in the white matter.

3.5. In situ hybridization and immunohistochemistry of PCNA in the developing mouse nervous system We further compared PCNA mRNA expression with 19F4 and PC10 immunostaining in developing mouse brains using adjacent sections. Between E12 and E17, the rodent cortical neuroepithelium is divided into the mitotic, synthetic, subventricular and intermediate zones layered from the lumen of the lateral ventricle to the cortical plate (cortex) [7]. Cells undergo the DNA replication at the synthetic zone and migrate to the mitotic zone in which the mitosis occurs. Then, postmitotic neurons migrate toward the cortical plate. Hybridization signals were restricted almost entirely to the synthetic zone at E14 (Fig. 6A). It is notable that differentiated neurons positioned in the cortical plate showed no detectable levels of PCNA mRNA expression at this stage, although weak to moderate expression was observed in neurons in the adult period as shown in Fig. 4. In contrast, immunostaining with 19F4

169

was observed both in the synthetic and mitotic zones (Fig. 6B). Immunostaining with PC10 was seen not only in the synthetic and mitotic zones but also in the subventricular and intermediate zones (Fig. 6C). However, no PC10positive cells were found in the cortical plate. Although the structure of the cortical neuroepithelium at E16 resembled that at E14, the thickness of the neuroepithelium was reduced (Fig. 6D–F). At this point, cells positioned in the cortical plate, including many neurons, showed weak PCNA mRNA hybridization signals (Fig. 6D) and were also weakly stained with PC10 (Fig. 6F). During relatively early developmental periods, PCNA mRNA expression in nonproliferating cells was undetectable, as shown in Fig. 6A. However, its expression gradually became evident after P0. Fig. 6G shows the obvious expression of PCNA mRNA in CA1 pyramidal cells at P4 to the same level as observed during the adult period. The signal was specific because no staining was observed with the sense probe (Fig. 6H). These neurons showed no staining with 19F4 (Fig. 6I) and only weak staining with PC10 (Fig. 6J). In the cerebellum at P4, neuronal stem cells, destined to differentiate into granule cells, in the external germinal layer and proliferating astrocytes distributed in the inner area of the cerebellum were intensely stained by PCNA in situ hybridization as well as 19F4 and PC10 immunostaining (Fig. 6K–M). Interestingly, in contrast to what we observed in the cortical neuroepithelium, no significant difference in staining patterns was observed using the different staining methods in the external germinal layer, even though the number of PC10-positive cells in the inner area of the cerebellum seemed to be slightly higher than 19F4-positive and PCNA mRNA-expressing cells.

4. Discussion The physiological function of PCNA is well documented, being necessary for DNA replication and repair in proliferating eukaryotic cells. Its expression declines as cells become quiescent. Therefore, our results showing positive staining with the monoclonal antibody PC10 in mouse brain were somewhat surprising because there are only a few dividing cells in the mature brain. Liu and Liu did not detect PCNA protein by Western blotting, despite observing PCNA mRNA by Northern blotting [24]. We reasoned that the discrepancy between our and their Western blot data could have been due to the different anti-PCNA antibodies used. Therefore, we used a second anti-PCNA antibody (19F4) for Western blot analysis, which did not detect any bands in a mouse brain extract. Additionally, in extracts from developing mouse brains, bands stained with 19F4 disappeared during relatively early embryonic periods, whereas bands stained with PC10 were detectable into the adult period. Interesting data were also obtained from the in situ

170

H. Ino, T. Chiba / Molecular Brain Research 78 (2000) 163 – 174

Fig. 5. Immunohistochemistry using anti-PCNA antibodies (19F4 and PC10) in adult mouse central and peripheral nervous systems. Immunostaining with 19F4 (A, C) and PC10 (B, D, E–H). Frontal sections of subventricular zone (A, B), hippocampus and dentate gyrus (C, D) and piriform cortex (E). Parasagittal section of cerebellum (F). Cross section of spinal cord (G). Longitudinal section of trigeminal ganglion (H). Myelins were stained with Luxol fast blue. Note that although 19F4 staining was observed only in cell nuclei of the subventricular zone (A) and subgranular zone (C), PC10 staining was more widely distributed. LV, lateral ventricle; S, striatum; cc, corpus callosum; DG, dentate gyrus; CA1, CA1 region of hippocampal pyramidal cells; lo, lateral olfactory tract; CN, cerebellar nucleus; P, Purkinje cell layer; m, cerebellar medulla; AH, anterior horn; lf, lateral funiculus. Scale bar5200 mm.

H. Ino, T. Chiba / Molecular Brain Research 78 (2000) 163 – 174

171

Fig. 6. Immunohistochemistry and in situ hybridization of PCNA in developing mouse central nervous system. In situ hybridization with antisense (A, D, G, K) and sense (H) probes for mouse PCNA. Immunostaining with 19F4 (B, E, I, L) and PC10 (C, F, J, M). Horizontal sections of cortical neuroepithelia at E14 (A–C) and E16 (D–F). Frontal sections of hippocampus at P4 (G–J). Parasagittal sections of cerebellum at P4 (K–M). Areas between arrowheads in (A–C) indicate neuroepithelial layers that included stained cells. At E14, hybridization signals were seen in the synthetic zone (A), whereas 19F4 staining was observed in the mitotic and synthetic zones (B), whereas PC10 stained the whole area of neuroepithelium (C). The cortical plate was not stained by any method. At E16, weak hybridization signals (D) and PC10 staining (F) were found in the cortical plate. At P4, apparent PCNA mRNA expression was observed in CA1 pyramidal neurons (G). LV, lateral ventricle; CP, cortical plate; CA1, CA1 region of hippocampal pyramidal cells; CX, cerebral cortex. Scale bar5100 mm.

172

H. Ino, T. Chiba / Molecular Brain Research 78 (2000) 163 – 174

hybridization experiments. Judging from the coincidence of intense hybridization signals with 19F4 immunostaining in the SVZ of adult mice, we conclude that 19F4 immunoreactivity precisely indicates the existence of PCNA protein that may be active in DNA replication. Relatively weak hybridization signals were also observed in neurons that showed no immunostaining with 19F4. We suggest that the band seen in the brain by Northern blot analysis is due to neuronal PCNA mRNA, widely distributed over the brain. It is interesting to speculate whether the PCNA mRNA in neurons is translated to protein, and whether this protein is responsible for the PC10 staining. There are at least two possibilities. As our results indicated, the distribution of PC10 staining was much wider than that of 19F4 staining. PC10 stained not only progenitor cells in the SVZ and subgranular zone but also neurons and glia. Therefore, the first possibility is that the PC10 immunoreactivity in nonproliferating cells may not be due to PCNA but to a structurally related protein (analog). To date, the existence of PCNA analogs has not been reported except for PCNA pseudogenes [42,45]. Although this sufficiently explains the lack of concordance between the immunohistochemistry and in situ hybridization results, other interpretations are also possible. PCNA protein in oligodendrocytes may be extremely stable and remain at relatively high levels despite low-level mRNA expression. In this case, the second possibility is that the protein stained only with PC10 may represent a modified PCNA, because it was not recognized by 19F4. This modification could be, for instance, a phosphorylation. By two-dimensional gel electrophoresis, the PCNA-like protein in the brain showed the slight acidic shift in the isoelectric point compared to that of PCNA. These data strengthen the hypothesis that the PCNA-like protein in the brain is a phosphorylated form of PCNA, even though they do not necessarily exclude the possibility of other types of modification. The Western blotting and two-dimensional gel electrophoresis data indicate further that these two proteins exist as a mixture in proliferating tissues. We prefer the second possibility to the first, because the PCNA-like protein showed the identical molecular weight and a nearly identical but slightly acidic isoelectric point compared to PCNA. The epitopes recognized by PC10 and 19F4 are both within the amino acid residues 111–125 (VSDYEMKLMDLDVEQ in human, murine and frog sequences), although the epitope recognized by PC10 is more restricted [36]. This sequence (residues 109–117) forms a b sheet structure, which is important for intermolecular interactions in the PCNA trimer [19]. It is notable that phosphorylation of the serine and / or tyrosine residues is possible. Several interesting results were also obtained from the histological studies in developing mouse brains. In the cortical neuroepithelium at E14, PCNA mRNA expression occurred only in the synthetic zone, whereas PCNA protein (19F4 immunoreactivity) was identified not only in

the synthetic zone but also in the mitotic zone. Exceptionally, the decline of PCNA at the M phase did not seem to occur in these neuronal progenitor cells. There is also the question of whether the PCNA mRNA in mature neurons is a remainder from progenitor cells or newly expressed after differentiation. From observation in the cortices by in situ hybridization at E14, E16 and P4, we conclude that PCNA mRNA expression in neurons is up-regulated again after differentiation. Finally, in the developing cerebellum in contrast to the cortical epithelium, the discrepancy between PCNA mRNA expression and 19F4 and PC10 immunoreactivity was not observed. We cannot explain why this difference occurred. PC10 is one of the anti-PCNA antibodies commonly used to detect proliferating cells in normal and pathological tissues. However, little attention has been paid to its specificity. Our results indicate that this antibody probably recognizes a protein distinct from PCNA or a distinct form of PCNA, and its immunoreactivity is not necessarily restricted to proliferating cells. Naturally its physiological roles may be different from those of the original PCNA. In support of this, other studies have also noted PC10 staining in nonproliferating cells [13]. We also observed a wider distribution of PC10 immunostaining compared with 19F4 in mouse normal non-neuronal tissues and human tumor tissues (data not shown). In both cases, staining with 19F4 was only found in putative proliferating cells. Therefore, unambiguous identification of PCNA requires the use of 19F4 or an antibody with similar specificity. The physiological significance of PCNA mRNA expression in nonproliferating cells is unknown. Recently, the existence of ectopic cell-cycle regulatory proteins, PCNA, cyclins and cyclin-dependent kinases [11,31] in neurons of Alzheimer’s disease brains was reported. We speculate that PCNA mRNA expression in neurons may possibly be related to neuronal cell death together with other cell-cycle regulatory proteins.

Acknowledgements We thank Professor Shigeki Yuasa for helpful advice on the development of the mouse nervous system. This work was supported by grants from the Ministry of Education, Science, Sports and Culture, Japan.

References [1] J.M. Almendral, D. Huebsch, P.A. Blundell, H. Macdonald-Bravo, R. Bravo, Cloning and sequence of the human nuclear protein cyclin: Homology with DNA-binding proteins, Proc. Natl. Acad. Sci. USA 84 (1987) 1575–1579. [2] J. Altman, Autoradiographic investigation of cell proliferation in the brains of rats and cats, Anat. Rec. 145 (1963) 573–592. [3] J. Altman, Autoradiographic and histological studies of postnatal neurogenesis. IV. Cell proliferation and migration in the anterior

H. Ino, T. Chiba / Molecular Brain Research 78 (2000) 163 – 174

[4]

[5] [6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

forebrain, which special reference to persisting neurogenesis in the olfactory bulb, J. Comp. Neurol. 137 (1969) 433–458. G.A. Bauer, P.M.J. Burgers, The yeast analog of mammalian cyclin / proliferating-cell nuclear antigen interacts with mammalian DNA polymerase d, Proc. Natl. Acad. Sci. USA 85 (1988) 7506–7510. S.A. Bayer, 3 H-Thymidine-radiographic studies of neurogenesis in the rat olfactory bulb, Exp. Brain Res. 50 (1983) 329–340. S.A. Bayer, J. Altman, Neurogenesis and neuronal migration, in: G. Paxinos (Ed.), The Rat Nervous System, 2nd Edition, Academic Press, San Diego, 1995, pp. 1041–1078. S.A. Bayer, J. Altman, Principles of neurogenesis, neuronal migration, and neural circuit formation, in: G. Paxinos (Ed.), The Rat Nervous System, 2nd Edition, Academic Press, San Diego, 1995, pp. 1079–1098. R. Bravo, J.E. Celis, A search for differential polypeptide synthesis throughout the cell cycle of HeLa cells, J. Cell Biol. 84 (1980) 795–802. R. Bravo, R. Frank, P.A. Blundell, H. Macdonald-Bravo, Cyclin / PCNA is the auxiliary protein of DNA polymerase-d, Nature 326 (1987) 515–517. P.M.J. Burgers, Saccharomyces cerevisiae replication factor C. II. Formation and activity of complexes with the proliferating cell nuclear antigen and with DNA polymerases d and e, J. Biol. Chem. 266 (1991) 22698–22706. J. Busser, D.S. Geldmacher, K. Herrup, Ectopic cell cycle proteins predict the sites of neuronal cell death in Alzheimer’s disease brain, J. Neurosci. 18 (1998) 2801–2807. I.T. Chen, M.L. Smith, P.M. O’Connor, A.J. Fornace Jr., Direct interaction of Gadd45 with PCNA and evidence for competitive interaction of Gadd45 and p21 Waf1 / Cip1 with PCNA, Oncogene 11 (1995) 1931–1937. P.A. Hall, D.A. Levison, A.L. Woods, C.C.-W. Yu, D.B. Kellock, J.A. Watkins, D.M. Barnes, C.E. Gillett, R. Camplejohn, R. Dover, N.H. Waseem, D.P. Lane, Proliferating cell nuclear antigen (PCNA) immunolocalization in paraffin sections: an index of cell proliferation with evidence of deregulated expression in some neoplasms, J. Pathol. 162 (1990) 285–294. P.A. Hall, J.M. Kearsey, P.J. Coates, D.G. Norman, E. Warbrick, L.S. Cox, Characterization of the interaction between PCNA and Gadd45, Oncogene 10 (1995) 2427–2433. H. Ino, T. Ishizuka, T. Chiba, M. Tatibana, Expression of CDK5 (PSSALRE kinase), a neural cdc2-related protein kinase, in the mature and developing mouse central and peripheral nervous systems, Brain Res. 661 (1994) 196–206. H. Ino, T. Chiba, Intracellular localization of cyclin-dependent kinase 5 (CDK5) in mouse neuron: CDK5 is located in both nucleus and cytoplasm, Brain Res. 732 (1996) 179–185. M.S. Kaplan, J.W. Hinds, Neurogenesis in the adult rat: Electron microscopic analysis of light radioautographs, Science 197 (1977) 1092–1094. K. Kishi, Golgi studies on the development of granule cells of the rat olfactory bulb with reference to migration in the subependymal layer, J. Comp. Neurol. 258 (1987) 112–124. T.S.R. Krishna, X.-P. Kong, S. Gary, P.M. Burgers, J. Kuriyan, Crystal structure of the eukaryotic DNA polymerase processivity factor PCNA, Cell 79 (1994) 1233–1243. P. Kurki, K. Ogata, E.M. Tan, Monoclonal antibodies to proliferating cell nuclear antigen (PCNA) / cyclin as probes for proliferating cells by immunofluorescence microscopy and flow cytometry, J. Immunol. Methods 109 (1988) 49–59. P. Kurki, M. Vanderlaan, F. Dolbeare, J. Gray, E.M. Tan, Expression of proliferating cell nuclear antigen (PCNA) / cyclin during the cell cycle, Exp. Cell Res. 166 (1986) 209–219. S.-H. Lee, Z.-Q. Pan, A.D. Kwong, P.M.J. Burgers, J. Hurwitz, Synthesis of DNA by DNA polymerase e in vitro, J. Biol. Chem. 266 (1991) 22707–22717. S.W. Levison, J.E. Goldman, Both oligodendrocytes and astrocytes

[24] [25]

[26] [27]

[28]

[29] [30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

[40]

[41]

[42]

[43]

173

develop from progenitors in the subventricular zone of postnatal rat forebrain, Neuron 10 (1993) 201–212. Y.-C. Liu, Y.-W. Liu, Gene expression of proliferating cell nuclear antigen in rat brain, Biochem. Int. 28 (1992) 129–136. C. Lois, A. Alvarez-Buylla, Proliferating subventricular zone cells in the adult mammalian forebrain can differentiate into neurons and glia, Proc. Natl. Acad. Sci. USA 90 (1993) 2074–2077. C. Lois, A. Alvarez-Buylla, Long-distance neuronal migration in the adult mammalian brain, Science 264 (1994) 1145–1148. M.B. Luskin, Restricted proliferation and migration of postnatally generated neurons derived from the forebrain subventricular zone, Neuron 11 (1993) 173–189. M.B. Mathews, R.M. Bernstein, B.R. Franza Jr., J.I. Garrels, Identity of the proliferating cell nuclear antigen and cyclin, Nature 309 (1984) 374–376. K. Miyachi, M.J. Fritzler, E.M. Tan, Autoantibody to a nuclear antigen in proliferating cells, J. Immunol. 121 (1978) 2228–2234. C.M. Morshead, D. van der Koody, Postmitotic death is the fate of constitutively proliferating cells in the subependymal layer of the adult mouse brain, J. Neurosci. 12 (1992) 249–256. Z. Nagy, M.M. Esiri, A.-M. Cato, A.D. Smith, Cell cycle markers in the hippocampus in Alzheimer’s disease, Acta Neuropathol. 94 (1997) 6–15. K. Ogata, P. Kurki, J.E. Celis, R.M. Nakamura, E.M. Tan, Monoclonal antibodies to a nuclear protein (PCNA / cyclin) associated with DNA replication, Exp. Cell Res. 168 (1987) 475–486. ¨ V.N. Podust, U. Huscher, Lagging strand DNA synthesis by calf thymus DNA polymerases, a, b, d and e in the presence of auxiliary proteins, Nucleic Acids Res. 21 (1993) 841–846. G. Prelich, M. Kostura, D.R. Marshak, M.B. Mathews, B. Stillman, The cell-cycle regulated proliferating cell nuclear antigen is required for SV40 DNA replication in vitro, Nature 326 (1987) 471–475. G. Prelich, C.-K. Tan, M. Kostura, M.B. Mathews, A.G. So, K.M. Downey, B. Stillman, Functional identity of proliferating cell nuclear antigen and a DNA polymerase-d auxiliary protein, Nature 326 (1987) 517–520. G. Roos, G. Landberg, J.P. Huff, R. Houghten, Y. Takasaki, E.M. Tan, Analysis of the epitopes of proliferating cell nuclear antigen recognized by monoclonal antibodies, Lab. Invest. 68 (1993) 204– 210. M.K.K. Shivji, M.K. Kenny, R.D. Wood, Proliferating cell nuclear antigen is required for DNA excision repair, Cell 69 (1992) 367– 374. M.L. Smith, I.-T. Chen, Q. Zhan, I. Bae, C.-Y. Chen, T.M. Gilmer, M.B. Kastan, P.M. O’Connor, A.J. Fornance Jr., Interaction of the p53-regulated protein Gadd45 with proliferating cell nuclear antigen, Science 266 (1994) 1376–1380. Y. Takasaki, D. Fishwild, E.M. Tan, Characterization of proliferating cell nuclear antigen recognized by autoantibodies in lupus sera, J. Exp. Med. 159 (1984) 981–992. C.-K. Tan, C. Castillo, A.G. So, K.M. Downey, An auxiliary protein for DNA polymerase-d from fetal calf thymus, J. Biol. Chem. 261 (1986) 12310–12316. C.-K. Tan, K. Sullivan, X. Li, E.M. Tan, K.M. Downey, A.G. So, Autoantibody to the proliferating cell nuclear antigen neutralizes the activity of the auxiliary protein for DNA polymerase delta, Nucleic Acids Res. 15 (1987) 9299–9308. Y. Taniguchi, Y. Katsumata, S. Koido, H. Suemizu, S. Yoshimura, T. Moriuchi, K. Okumura, K. Kagotani, H. Taniguchi, T. Imanishi, T. Gojobori, H. Inoko, Cloning, sequencing, and chromosomal localization of two tandemly arranged human pseudogenes for the proliferating cell nuclear antigen (PCNA), Mamm. Genom. 7 (1996) 906–908. N.H. Waseem, D.P. Lane, Monoclonal antibody analysis of the proliferating cell nuclear antigen (PCNA). Structural conservation and the detection of a nucleolar form, J. Cell Sci. 96 (1990) 121–129.

174

H. Ino, T. Chiba / Molecular Brain Research 78 (2000) 163 – 174

[44] Y. Xiong, H. Zhang, D. Beach, D type cyclins associate with multiple protein kinases and the DNA replication and repair factor PCNA, Cell 71 (1992) 505–514. [45] M. Yamaguchi, Y. Hayashi, F. Hirose, S. Matsuoka, T. Moriuchi, T. Shiroishi, K. Moriwaki, A. Matsukage, Molecular cloning and structural analysis of mouse gene and pseudogenes for proliferating cell nuclear antigen, Nucleic Acids Res. 19 (1991) 2403–2410.

[46] X.-R. Zeng, Y. Jiang, S.-J. Zhang, H. Hao, M.Y.W.T. Lee, DNA polymerase d is involved in the cellular response to UV damage in human cells, J. Biol. Chem. 269 (1994) 13748–13751. [47] H. Zhang, Y. Xiong, D. Beach, Proliferating cell nuclear antigen and p21 are components of multiple cell cycle kinase complexes, Mol. Biol. Cell 4 (1993) 897–906.