Expression of Rat Liver Tryptophan 2,3-Dioxygenase inEscherichia coli:Structural and Functional Characterization of the Purified Enzyme

ARCHIVES OF BIOCHEMISTRY AND BIOPHYSICS

Vol. 333, No. 1, September 1, pp. 96–102, 1996 Article No. 0368

Expression of Rat Liver Tryptophan 2,3-Dioxygenase in Escherichia coli: Structural and Functional Characterization of the Purified Enzyme Shiyan Ren, Hanguan Liu,1 Estefania Licad, and Maria Almira Correia2 Departments of Cellular and Molecular Pharmacology, Pharmacy and Pharmaceutical Chemistry, and the Liver Center, University of California, San Francisco, California 94143

Received February 9, 1996, and in revised form May 31, 1996

The hepatic hemoprotein tryptophan 2,3-dioxygenase (TDO) is the key regulatory enzyme that, through irreversible degradation, controls the flux of tryptophan through physiologically relevant pathways. This enzyme is composed of four identical subunits and in its fully assembled tetrameric form requires 2 mol of heme (Fe/2-protoporphyrin IX)/mol of protein for functional competence. Using a full-length cDNA for the rat liver TDO subunit (pUC119/TDO) as the template, TDO cDNA was amplified by polymerase chain reaction (PCR) and incorporated into the expression vector pTrc99A after introduction of convenient restriction sites as well as modification of the second codon AGT to GCT to optimize its bacterial expression. DH5aF* strain Escherichia coli cells transfected with this pTrc99A/TDO construct expressed soluble, functionally active, tetrameric TDO protein in high yields. The enzyme was isolated from 30,000g supernatant of cell lysates, purified by ion-exchange chromatography, and its spectral and catalytic properties were assessed in terms of its substrate and prosthetic moiety specificities. In almost all aspects, the bacterially expressed enzyme was found to be identical to that of the rat liver. Heterologous expression of the fully functional enzyme, we trust, will enable future elucidation of its structure–function relationships. q 1996 Academic Press, Inc.

Rat liver L-tryptophan 2,3-dioxygenase (TDO) is a tetrameric hemoprotein (Mr É 167,000), consisting of four equivalent protomeric subunits of Mr É 43,000, and containing 2 mol of protoheme IX per mole of tetrameric enzyme (1, 2). It is the key enzyme in the physio1 Present address: Department of Pharmacology and Toxicology, Queen’s University, Kingston, Ontario K7L 3N6, Canada. 2 To whom correspondence and reprint requests should be addressed. Fax: (415) 476-5292.

logical regulation of tryptophan flux in the body: Controlling through irreversible degradation, on one hand, the availability of the intact amino acid for the 5-hydroxytryptamine (serotonin) pathways of the central and peripheral nervous system, and consequently the serotonergic tone, and on the other, the formation of pyridine nucleotides and polyADP-ribose (2–5). As the rate-limiting enzyme in the breakdown of tryptophan to kynurenine, it catalyzes the insertion of molecular oxygen into the 2,3-bond of the indole moiety of L-tryptophan via a dioxetane intermediate that is subsequently cleaved to yield the intermediate product, Nformyl-L-kynurenine (6–9). The enzyme formamidase then removes the formyl moiety to yield L-kynurenine as the end product. As in other catalytic hemoproteins, the prosthetic heme in its Fe/2-form is the sole requirement for binding and activation of molecular oxygen. No other cofactor is found to be associated with the enzyme (1, 2). The topology of the active site of this enzyme is unknown, and it is unclear whether each of the two heme moieties is contained within one of the individual subunits or whether each heme is nestled between two adjacent subunits (1). Furthermore, although 12 histidines are present per protomeric subunit (10), it is unclear which of these are involved in ligating heme. Since TDO constitutes a relatively small fraction of the rat liver cytosolic proteins even after glucocorticoid induction (11, 12), and the usual yields of the purified rat liver TDO are insufficient for structure–function studies, we attempted to heterologously express it. MATERIALS AND METHODS Materials. Restriction endonucleases, DH5aF* competent E. coli cells and media for bacterial growth were purchased from GIBCO-BRL (Grand Island, NY). Heme analogs either were obtained from Porphyrin Products Inc. (Logan, Utah) or were gifts from Professor Kevin Smith (University of California, Davis). Ltryptophan, hemin, and other chemicals were purchased from

96

AID

0003-9861/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.

ARCH 9557

/

6b1e$$$301

07-29-96 14:45:27

arcal

AP: Archives

CHARACTERIZATION OF E. COLI-EXPRESSED TRYPTOPHAN 2,3-DIOXYGENASE Sigma Chemical Co. (St. Louis, MO). Isopropyl-b-D-thiogalactopyranoside (IPTG) and N-formyl-L-kynurenine were purchased from Calbiochem Corp. (La Jolla, CA). Construction of expression plasmids. The expression vector pTrc99A was purchased from Pharmacia LKB Biotechnology Co. A full-length cDNA pUC119/TDO was generously provided by Dr. T. Nakamura (Kyushu University) (10). The TDO cDNA was amplified by polymerase chain reaction (PCR). Primers for PCR amplification were obtained from the University of California San Francisco Biomolecular Resource Center (San Francisco, CA). The construct was incorporated into pTrc99A by introducing an NcoI site (CCATGG; with the 5*-sense oligonucleotide, 5*-TTCGAATTCCATGGCTGGGTGCCCATTTTC) to include the start codon, and a Sal I site (GTCGAC; with 3*-antisense oligonucleotide 5*GATGTTCAGGTCGACTCAATCTGATTCATC) downstream of the stop codon. The second codon AGT (Ser) of TDO cDNA was modified to GCT (Ala) to optimize the bacterial expression (13). This modification resulted in Ser to Ala substitution at the N-terminus of the TDO protein. The PCR amplification was performed with a Perkin – Elmer – Cetus DNA Thermal Cycler, Taq DNA polymerase, and reagents supplied in the Cetus GeneAmp DNA amplification kit (Perkin – Elmer – Cetus, Norwalk, CT). The PCR reaction involved 1 cycle of denaturing at 947C for 3 min, annealing at 457C for 3 min, and extension at 727C for 3 min. This was followed by denaturing at 947C for 45 s, annealing at 457C for 45 s, and extension at 727C for 1 min for 30 cycles. Following restriction digestion, the NcoI – Sal I fragment of TDO cDNA was ligated into pTrc99A vector, using T4 DNA ligase at 167C overnight. The pTrc99A/TDO plasmid was used to transform competent DH5aF* strain E. coli cells (Gibco-BRL, Grand Island, NY). E. coli cells containing the TDO constructs were stored in 20% glycerol at 0807C. Expression of plasmids in E. coli. A single ampicillin-resistant colony of E. coli cells transformed with pTrc99A/TDO plasmid was grown overnight at 377C in 100 ml of Luria-Bertani (LB) media pH 7.0, containing 50 mg ampicillin/ml. A 35- to 50-ml aliquot was used to inoculate 1.0 liter of Terrific Broth (TB) containing 0.2% (w/v) bactopeptone, trace elements (0.25 ml/liter of culture, of a stock solution composed of FeCl3 , 27 g; ZnCl2 , 2 g; Na2MoO4r2H2O, 2 g; CaCl2r2H2O, 1 g; CuCl2 , 1 g; H3BO3 , 0.5g, and conc. HCl, 100 ml in a final volume of 1 liter) and supplemented with ampicillin (50 mg/ ml) in a 2.8-liter Fernbach flask and grown at 377C with constant shaking at 240 rpm, until an OD600 value of 0.5 was reached. IPTG (final concentration, 1.0 mM) was then added to induce the trc promoter for TDO expression and allowed to proceed for 18–20 h at 287C with vigorous (200 rpm) shaking. The cells were harvested by centrifugation at 5,000g for 15 min at 47C and freeze-thawed after overnight storage at 0807C. The pelleted cells were resuspended (15 ml/g wet weight cells) in Tris–acetate buffer (100 mM, pH 7.6) containing sucrose (500 mM), tryptophan (5 mM), DTT (1 mM), and EDTA (0.5 mM). Protease inhibitors [PMSF (1 mM), leupeptin (2 mM), bestatin (2 mM), pepstatin (1 mM), aprotinin (0.01 mg/ml), and soybean trypsin inhibitor (0.01 mg/ml)] were added, and the cells were homogenized in a glass homogenizer and the homogenate placed in a beaker on ice and lysed at 10 pulses/10 s cycle for five to seven cycles (90– 100 watts) of a Branson sonicator (Model 450). The cells were sedimented at 30,000g for 20 min at 47C, and the supernatant containing TDO was used for subsequent protein purification. If the pellet retained appreciable TDO activity, it was subjected to sequential cycles of sonication and sedimentation, until most of the expressed TDO was recovered in the supernatant fractions, which were combined with the first supernatant, concentrated by ultrafiltration under N2 , and used for TDO purification. Alternatively, cells were lysed by the addition of lysozyme (0.2 mg/ ml) in the presence of protease inhibitors, following which the cells were gently stirred with a magnetic bar for 30 min at 47C. However, 20–30% of the cytosolic TDO leaked out of the spheroplasts and was somewhat unstable. For these reasons, when higher recovery of

AID

ARCH 9557

/

6b1e$$$301

07-29-96 14:45:27

97

expressed cytosolic TDO was required for routine purification purposes, the former method was employed. To determine the influence of cellular heme availability on the E. coli expression of TDO, the effect of varying concentrations of the heme precursor d-aminolevulinic acid (ALA) in the bacterial cultures was examined. For this purpose, a single DH5a colony containing the expression plasmid pTrc99/TDO was inoculated into a 50-ml LBAmp media and grown overnight at 377C. An aliquot was then inoculated into three separate flasks each containing 500 ml of modified TB culture media (as described above) and grown at 377C, with continuous shaking at 250 rpm. When the cell density reached an A600nm reading of 0.3, ALA was added to each flask at 0, 25, and 50 mg/ liter. The cultures were grown at 377C until a log phase A600nm of 0.5 was reached and then induced with 1 mM IPTG. The temperature was lowered to 287C and the cultures grown overnight. At 15, 18, 21, and 24 h, aliquots were taken for TDO functional assays and SDS–PAGE analysis. Purification of expressed TDO by affinity column chromatography. The 30,000g supernatant of cell lysates was desalted by dialysis overnight at 47C [against potassium phosphate buffer (20 mM, pH 7.2) containing L-tryptophan (10 mM) after which it was concentrated by ultrafiltration and diluted down with the same buffer]. This sample was then applied to a DEAE cellulose (DE 53, Whatman) column (2.6 1 35 cm), previously equilibrated with a starting buffer (Buffer A) containing potassium phosphate (20 mM, pH 7.2), L-tryptophan (10 mM), EDTA (1 mM), DTT (1 mM), and hemin (1 mM) and bubbled with 100% N2 gas. All buffer solutions from this stage on required equilibration with 100% N2 gas, as previously recommended for stability of the enzyme (1). The column was washed with 200 ml of this Buffer A, followed sequentially by 400 ml of Buffer A containing 80 mM NaCl, and a linear gradient of 500 ml of 80 mM NaCl/Buffer A and 500 ml of 300 mM NaCl/Buffer A at 1.5 ml/min, overnight. The fractions containing TDO activity (eluting at É180–250 mM NaCl gradient) were collected, pooled, desalted by dialysis under N2 , concentrated by ultrafiltration, and loaded onto a second DE53 column (2.6 1 38 cm), also equilibrated with Buffer A. The column was washed with 200 ml of Buffer A at a flow rate of 2 ml/min, followed sequentially by 400 ml of Buffer A containing 80 mM NaCl and 200 ml of Buffer A containing 100 mM NaCl, and a linear gradient of 500 ml of Buffer A containing 100 mM NaCl, and 500 ml of Buffer A (containing 250 mM potassium phosphate buffer and 100 mM NaCl). The expressed TDO was eluted at a potassium phosphate concentration range of 70–90 mM. The TDO-containing fractions were identified by their TDO activity and checked by SDS–PAGE for purity. Pooled TDO fractions were subjected to dialysis at 47C, against sufficient Buffer A to reduce the salt concentration to the starting levels, concentrated by ultrafiltration, and loaded onto a DEAE-Sephacel column (Pharmacia, 2.6 1 20 cm), equilibrated with Buffer A. After loading the sample, the column was washed with 300 ml of starting Buffer A, followed by gradient elution consisting of 50 mM potassium phosphate/Buffer A (70 mM potassium phosphate, final) and 250 mM potassium phosphate/Buffer A (270 mM potassium phosphate, final). The TDO eluted between 90 and 130 mM potassium phosphate/Buffer A and was approximately 70–80% pure. Further purification was achieved by subjecting the TDO-containing fractions (after concentration dialysis under N2) to Q-Sepharose high performance chromatography, by passing through HiTrap Q columns regenerated as per the manufacturer’s instructions (Pharmacia, Bulletin 71-7149-00) and then equilibrated with 20% glycerol/Buffer A. The dialyzed TDO fractions were loaded onto the cartridge and washed with a step-wise gradient of 50 ml of Buffer A, followed by 120 ml of 150 mM NaCl/Buffer A, 150 ml of 200 mM NaCl/Buffer A, and finally eluted with 250 mM NaCl/ Buffer A. The TDO-containing fractions were collected, pooled, and dialyzed after dilution with Buffer A, by concentration dialysis under N2 . Some recalcitrant contaminating proteins remained and were removed by resubjecting the sample to DEAE-Sephacel chromatography. The purified TDO was extremely unstable at this stage even at

arcal

AP: Archives

98

REN ET AL.

0807C, but the stability was improved by concentration of the protein and storage under N2 . TDO assay. The 30,000g supernatant of TDO-expressing cell lysates (É100 mg protein) was preincubated at 377C for 3 min and then added to a 377C-preequilibrated incubation system containing L-tryptophan (3 mM), ascorbate (100 mM), and hemin (6 mM) in 1 ml of potassium phosphate buffer (100 mM, pH 7.0). The time-dependent formation of N-formyl L-kynurenine, the L-tryptophan metabolite, was monitored at 321 nm wavelength at 377C, with an SLM-Aminco DW-2 spectrophotometer, and quantitated using a molar extinction coefficient of 3152. Visible electronic absorption spectra of the expressed TDO. Absorption spectra of the purified TDO were recorded with an SLM-Aminco 2000 UV-Vis spectrophotometer in the 350- to 700-nm wavelength range, in the presence or absence of tryptophan, and before and after chemical reduction of the enzyme with sodium dithionite. The residual tryptophan was removed by passage of the HiTrap Q/DEAE Sephacel purified enzyme through a Sephadex G-25 column, preequilibrated with 0.1 M potassium phosphate buffer, pH 7.0. It was important to remove traces of both DTT (reducing agent) and tryptophan from the enzyme preparation. Assembly of expressed TDO with structural hemin analogs. The TDO fraction partially purified after the first DEAE-Sephacel chromatography was used, because the fully purified enzyme became partially inactivated during the procedures that were required for assessing prosthetic acceptance and substrate specificity of the enzyme. For determining heme acceptance, the partially purified TDO fraction was passed through a Sephadex G-25 column equilibrated with Buffer A (without hemin), which was capable of reducing its heme content and lowering its activity to 6% of the basal activity of the fully heme-saturated protein. Solutions of hemin and its analogs were prepared and quantitated by the pyridine hemochromogen method (e Å 34.2 mM01 cm01 for hemin; 33.2 mM01 cm01 for mesohemin at 557–590 nm) as described previously (14). The constitution system included L-tryptophan (6 mM), hemin analogs (3 mM) and expressed partially purified TDO (50 ml) in 1 ml of potassium phosphate buffer (100 mM, pH 7.0). The L-tryptophan metabolite, N-formylkynurenine, was monitored at 321 nm wavelength with an SLMAminco DW-2 spectrophotometer, as described above. Substrate specificity of the expressed TDO enzyme. For this purpose, just before assay, the partially purified TDO fraction was passed through a Sephadex G-25 column equilibrated with Buffer A (without tryptophan) to remove the residual tryptophan included in all the buffers for stabilization of the enzyme. L-tryptophan or one of its analogs/derivatives was included in the assay mixture at the substrate concentration of 6 mM and TDO activity assayed as described above. Kinetic parameters Km and Vmax were obtained from Lineweaver–Burk analyses of data using the fully purified enzyme [after passage through Sephadex G-25 preequilibrated with Buffer A containing 0.1 mM hemin, to remove residual L-tryptophan (see below)] and L-tryptophan as the substrate (0–6.0 mM).

RESULTS AND DISCUSSION

Characterization of expressed TDO—Preliminary studies. Preliminary findings, with lysates obtained from cells transfected with both pTrc99A vector by itself and pTrc99A with the TDO cDNA insert (pTrc99A/ TDO) and grown at 377C for 22 h, revealed a protein band comigrating with purified rat liver cytosolic TDO after SDS–PAGE with Coomassie blue staining in the pTrc99A/TDO, but not in the pTrc99A-transfected cells. Immunoblotting analyses confirmed that the expressed protein reacted with rabbit polyclonal IgGs raised against rat liver TDO (not shown). The yield of

AID

ARCH 9557

/

6b1e$$$301

07-29-96 14:45:27

TDO activity was of the order of 103 mmol of N-formylL-kynurenine formed/min/liter of cell culture, corresponding to approximately 40 mg of protein. Further confirmation of TDO expression was obtained when the 100,000g lysate supernatant (100 mg protein) from cells transformed either with pTrc99A vector alone or with pTrc99A/TDO was incubated with L-tryptophan (2.5 mM) in potassium phosphate buffer (0.1 M, pH 7.4; final volume, 1 ml) at 377C for 5 min, with vigorous shaking (220 rpm), followed by UV-Vis scanning from 300 to 400 nm of the incubation mixture. A peak with maximum absorbance at 321 nm was detected in the pTrc99A/TDO cell lysate supernatant but not in that of pTrc99A vector alone cells (not shown). The peak absorbance at 321 nm was comparable to that exhibited by an aqueous solution of authentic Nformyl-L-kynurenine. Kinetic measurements of the absorbance at 321 nm showed a linear increase with time, when L-tryptophan was incubated with the pTrc99A/ TDO cell lysate supernatant but not with that of pTrc99A vector alone transfected cells (Fig. 1). Similar incubations of 100,000g supernatant (100 mg protein) of TDO-expressing cell lysates in the presence and absence of hemin, revealed that É50% of the hemoprotein was expressed in its holoenzyme form. Furthermore, although the enzyme is cytosolic in nature, higher activity could be consistently obtained in the 30,000g supernatant rather than in the 100,000g supernatant, as with the rat liver enzyme (15). Effects of d-ALA on bacterial expression of TDO. Inclusion of d-ALA (25 mg/liter, 149 mM) in the TBcultures led to a É75% increase in the overall yield of functionally active TDO at 18 h post IPTG induction (Fig. 2). Further raising the d-ALA levels to 50 mg/ liter (298 mM) lowered rather than improved TDO yields, indicating that too much heme apparently was deleterious not only to TDO expression but to the expression of other cellular proteins (Fig. 2). Since TDO is a hemoprotein that is fully reconstitutible in vitro by the addition of hemin, and hemin is usually added to fully reconstitute the enzyme before assay (see above), these findings indicate that in addition to serving as the prosthetic moiety of TDO, hemin might also stabilize the nascent apoprotein in culture (Fig. 3). This possibility is underscored by the observation that in the absence of added d-ALA, TDO functional levels remained low and rapidly declined after É21 hr (Fig. 2). Given this finding, d-ALA (149 mM) was included in all subsequent studies. Using these conditions, the total TDO activity (determined after incubation with 3 mM hemin) in a liter of cultured cell lysates was found to be É205.3 mmol of N-formyl-L-kynurenine formed/min, or an estimated total yield of É79 mg TDO protein/liter of cell culture, based on the reported value (2.6 mmol of N-formyl-L-kynurenine formed/mg protein/min) for the specific activity of fully purified rat liver TDO (1).

arcal

AP: Archives

CHARACTERIZATION OF E. COLI-EXPRESSED TRYPTOPHAN 2,3-DIOXYGENASE

99

FIG. 1. Time-dependent metabolism of L-tryptophan to N-formylkynurenine. Lysate supernatants (30,000g) from E. coli cells (50 ml) transfected with pTrc99A/TDO (left panel) or pTrc99A alone (right panel), were used to assay TDO as detailed (Materials and Methods). Note the 10-fold difference in the Y-axis scales.

Purification of expressed TDO. Passage of the 30,000g supernatant of lysates of E. coli transfected with pTrc99A/TDO through the first DE53 column, removed some but not all of the contaminating proteins, requiring passage through a second DE53 column and a subsequent DEAE-Sephacel step, which yielded an apparent relative purity of É 70% by SDS–PAGE analyses and an É 54.8% recovery of initial TDO activity

FIG. 2. Effects of varying d-ALA concentrations on the E. coli expression of functionally active TDO. The TB culture media was supplemented with ALA (0, 25, or 50 mg/liter) and the functionally active TDO in cell lysates (100 ml) was assayed at different intervals 15– 24 hr post-IPTG induction. FK, N-formyl-L-kynurenine.

AID

ARCH 9557

/

6b1e$$$301

07-29-96 14:45:27

(Fig. 4; Table I). Further purification could be achieved by passage of the enzyme through HiTrap Q, a strong anion exchanger with Q-Sepharose high performance media characteristics. However, several contaminating protein bands remained, that required further removal by rechromatography on a DEAE-Sephacel column (Fig. 4). The DEAE-Sephacel purified TDO fraction

FIG. 3. Effects of varying d-ALA concentrations on the E. coli expression of TDO protein. Cell lysates (25 mg protein) from the ALA (0, 25, or 50 mg/liter)-supplemented E. coli cultures (Fig. 2) were subjected to SDS–PAGE analysis for an estimate of the relative expression of the TDO protein. Partially purified TDO (TO) was included as a retention time marker.

arcal

AP: Archives

100

REN ET AL.

FIG. 4. SDS–PAGE analyses of TDO protein from cell culture lysates and subsequent fractions obtained during purification of the enzyme. Because tryptophan inclusion was essential for stability of the enzyme, and protein assays were unreliable, the fractions were loaded on the basis of TDO activity and/or volume. Lanes shown are: (1) Molecular weight standards (97.4, 66, 45, 31, 21.5 kDa); (2) 30,000g supernatant of pTrc99A-cell lysates; (3) 30,000g supernatant of pTrc99A/TDO-cell lysates; (4) pooled TDO fractions from the first DE-53 column; (5) pooled TDO fractions from the second DE-53 column; (6) pooled TDO fractions from the first DEAE-Sephacel column; (7) pooled TDO fractions from the Hi Trap Q column; (8) pooled second DEAE-Sephacel column fractions 54–60; (9) pooled second DEAE-Sephacel column fractions 61–66; (10) Molecular weight standards (same as above). Lanes 3–7 were loaded with sample volumes corresponding to a TDO activity of 0.27 nmol FK formed/min. Lanes 2, 8, and 9 were loaded with 2.5 ml (É14.8 mg cellular protein), 12 ml (TDO protein), and 12 ml (TDO protein), respectively. SDS–PAGE was carried out with 9% acrylamide gels (containing 0.24% bisacrylamide), at 150 v for 40 min, followed by gel staining with 0.2% Coomassie brilliant blue for 15 min and destaining with acetic acid (10%)/MeOH (30%)/water.

showed one major band after SDS–PAGE (Fig. 4), which for unclear reasons, as previously noted (1), under certain conditions appeared doubled. Because enzyme stability absolutely requires inclusion of 10 mM tryptophan in all the buffers at all stages of the purification, standard protein assays could not be reliably performed to afford estimates of the relative specific activity as an index of the purification progress at each step. Assay of the fully purified enzyme followed by extensive dialysis to remove tryptophan, yielded a specific activity of 6.37 mmol/mg protein/min, or a relative purification of ú60-fold over the crude cytosolic TDO fraction. Furthermore, in its partially or fully purified form, the enzyme was somewhat unstable even when stored at 0807C in buffers containing tryptophan (10 mM), 25% glycerol, and equilibrated with 100% N2 . Electronic absorption spectra of the purified TDO. The absorption spectrum of the substrate-free oxidized (Fe/3) TDO exhibited a Soret maximum at 421.4 nm, with b- and a-bands at 543.2 and 572.9 nm, respectively (Fig. 5A). Chemical reduction of the enzyme with sodium dithionite caused a slight hyperchromic red

AID

ARCH 9557

/

6b1e$$$301

07-29-96 14:45:27

shift of the Soret band to 425.6 nm in the enzyme spectrum and coalescence of the a- and b-bands into a single band with maximum absorbance at 556.8 nm. Addition of L-tryptophan (3 mM) resulted in a red shift in the absorbance of both the oxidized (Fe/3) and reduced (Fe/2) forms of the enzyme, with absorption maxima at 426.5, 551, and 575.7 nm for the Fe/3-form and 431.7 and 572.7 nm for the Fe/2-form, respectively (Fig. 5B). Furthermore, tryptophan addition caused a marked hyperchromicity of the reduced (Fe/2) TDO (Fig. 5B). Although the absorption spectra of the E. coli expressed TDO differ slightly in the detected wavelength maxima from the corresponding values reported for the rat liver and Pseudomonas fluorescens TDO (1, 16), they are consistent in that chemical reduction causes red absorbance shifts in the observed spectra of the enzyme, which are further magnified by tryptophan addition. Kinetic parameters of the purified TDO. Lineweaver–Burk kinetic analysis of the data obtained from incubations of the fully purified enzyme passed through Sephadex G-25 to remove traces of L-tryptophan and assayed in the presence of added L-tryptophan (0–6.0 mM) yielded a KM value of 0.221 mM and a Vmax of 6.44 mmol/min/mg of purified enzyme. Relative constitution of expressed TDO with structural hemin analogs. To assess the relative selectivity of the prosthetic acceptance of the enzyme, hemin (Fe3/-protoporphyrin IX) and several of its analogs were examined. For this purpose, due to the inherent instability of the fully purified TDO, the partially purified enzyme obtained after the first DEAE-Sephacel column was used. Its constitutive prosthetic heme content was first depleted by passage through Sephadex G-25 which reduced the holoTDO activity to 6–10% of the total. Consistent with previous findings (14), proto-

TABLE I

Purification of TDO from E. coli Cell Lysates

Step

TDO activity (mmol formylkynurenine/ min/liter culture)

% Yield

pTrc99A (Vector alone) pTrc99A/TDO Lysates DE-53 (1st) DE-53 (2nd) DEAE-Sephacel (1st)a HiTrap Q DEAE-Sephacel (2nd)

6.8 194.9 179.9 136.8 107 44.5b 22.7

— 100 92 70 54.9 22.8 11.7

Note. For details see Materials and Methods. a The enzyme fraction is extremely unstable after this step, with É57% activity losses, even on storage at 0807C in N2-equilibrated buffers containing tryptophan (10 mM). b Because of this instability, the amount applied to the HiTrap column was equivalent to 60.99 units of TDO activity, yielding a recovery of the order of 73% at this step.

arcal

AP: Archives

101

CHARACTERIZATION OF E. COLI-EXPRESSED TRYPTOPHAN 2,3-DIOXYGENASE

FIG. 5. Electronic absorption spectra of partially purified TDO fractions. The electronic absorption spectra of oxidized (—) and chemically reduced (----) functionally active TDO in the first DEAE-Sephacel pooled column fractions (500 ml) were obtained before and after passage through Sephadex G-25, to remove tryptophan from the samples (Materials and Methods). Sodium dithionite was used as the chemical reductant. (A) Absorption spectra of oxidized (—) and chemically reduced (----) TDO in the absence of L-tryptophan (after Sephadex G-25). (B) Absorption spectra of oxidized (—) and chemically reduced (----) TDO in the presence of L-tryptophan (before Sephadex G-25).

hemin IX (2-vinyl, 4-vinyl) reconstituted the TDO activity the best (Fig. 6). 4-Vinyl deuterohemin- and 4ethyl deuterohemin-constituted TDO retained 60–70%

activity of the parent hemin-reconstituted native enzyme and were considerably more active than the corresponding enzymes assembled with either the 2-vinyl or 2-ethyl analogs, indicating once again the relative importance of the 4-alkyl side chain in the assembly of functionally competent TDO (Fig. 6). On the other hand, the enzyme species reconstituted with the 2-vinyl, 4-ethyl- and 2-ethyl, 4-vinyl-analogs had comparable activities (É50% of that of the native enzyme), and were surprisingly more active than the corresponding mesohemin (2-ethyl, 4-ethyl)-reconstituted enzyme, which exhibited É36% activity (Fig. 6). The enzyme reconstituted with deuterohemin, the analog with hydrogens at positions 2 and 4, was relatively inactive, exhibiting only 6.1% activity of the hemin-constituted

TABLE II

Substrate Specificity of E. coli Expressed TDO

Substrate (6 mM) FIG. 6. Relative prosthetic acceptance of hemin and several of its 2- and 4-side chain substituted analogs by the partially purified TDO. Functionally active TDO fractions from the first DEAE-Sephacel column were used after passage through Sephadex G-25, to remove constitutive heme from the samples (Materials and Methods). Basal (100%) activity of TDO fractions (100 ml), fully saturated with hemin [R2 Å R4 Å vinyl (V); 3 mM] was 0.62 mmol/min/ml, in the presence of L-tryptophan (6 mM). The corresponding activity of the TDO fractions (100 ml) in the absence of added hemin was 6% of basal. This fraction was used to assess the relative prosthetic acceptance of mesohemin [R2 Å R4 Å ethyl (E)], deuterohemin [R2 Å R4 Å hydrogen (H)], and their R2 or R4 V-, H-, or E-substituted analogs, each assayed at 3 mM concentrations.

AID

ARCH 9557

/

6b1e$$$301

07-29-96 14:45:27

L-Tryptophan D-Tryptophan

5-Hydroxytryptophan 5-Hydroxytryptamine 5-Hydroxyindole acetic acid N-a-methyltryptophan

TDO activity (mmol product/ml/min) 1.99 0.29 ND ND ND ND

Note. The partially purified enzyme was passed through Sephadex G-25 to remove traces of tryptophan added in the buffers as detailed (Materials and Methods). Its activity assayed in the presence of hemin and ascorbate, but absence of any added L-tryptophan was nondetectable, confirming the removal of all L-tryptophan traces. ND, Not detected.

arcal

AP: Archives

102

REN ET AL.

enzyme. These findings reveal that TDO exhibits a marked preference for 4-alkyl- rather than 2-alkyl-substituted heme analogs. Furthermore, the 2-vinyl and 4-vinyl side chains of the prosthetic heme moiety of TDO apparently are nonequivalent and play distinct, critical roles in the enzyme. It is unclear whether these structural preferences stem entirely from architectural dictates of the active site fit or are also determined by the electronic influence that each side chain might exert on the p-electron density at the heme center and consequently, on heme (Fe2/)-O2-binding and activation during catalysis. Studies with a very limited series of hemin analogs revealed that TDO from P. acidovorans exhibited increased catalytic turnover but decreased O2 affinity with analogs with decreasing p-electron density at the heme center, revealing that electron withdrawing substituents increased the reaction of molecular O2 with tryptophan (17). Substrate specificity of the expressed TDO. Once again, due to the inherent instability of the fully purified TDO, the partially purified enzyme obtained after the first DEAE-Sephacel column was used. Because 10 mM tryptophan is included in the buffers for stability of the enzyme, assessment of substrate specificity required prior removal of the tryptophan from the preparation. This was achieved also by passage through Sephadex G-25 which reduced the holoTDO activity to 0% of the initial, when the activity was verified after addition of hemin and ascorbate but no tryptophan. Of the tryptophan analogs examined as potential substrates, by far L-tryptophan was the most active, with D-tryptophan exhibiting only 14.5% activity and thus É7-fold less active (Table II). Of the other tryptophan derivatives (5-hydroxytryptophan, 5-hydroxytryptamine, 5-hydroxyindole acetic acid, and Na-methyltryptophan), none were capable of being accepted as substrates, underscoring once again the high substrate specificity of the enzyme for L-tryptophan. In summary, after transfection of DH5a E. coli cells with the engineered pTrc99/TDO vector, a functionally active TDO protein was expressed in relatively high yields. The expressed enzyme was isolated, purified, and characterized in terms of its electronic absorption spectra, catalytic profile, and substrate and prosthetic moiety specificities. In almost all respects, the proper-

AID

ARCH 9557

/

6b1e$$$301

07-29-96 14:45:27

ties of the expressed TDO were comparable to those of the native rat liver TDO. ACKNOWLEDGMENTS The authors thank Professor T. Nakamura, Kyushu University, for the generous gift of the full-length pUC119/TDO cDNA, and Professor Kevin Smith, University of California at Davis, for some of the hemin analogs. They acknowledge the use of the UCSF Liver Center Core Facility in Spectrophotometry (supported by NIADKK 26743). This research project was supported by NIH-NIDDK Grant DK 26506 (M.A.C.).

REFERENCES 1. Schutz, G., and Feigelson, P. (1972) J. Biol. Chem. 247, 5327– 5332. 2. Hayaishi, O. (1980) in Biochemical and Medical Aspects of Tryptophan Metabolism (Hayaishi, O., Ishimura, Y., Kideo, R., Eds.), pp. 15–30, Elsevier/North-Holland, Amsterdam. 3. Curzon, G., and Bridges, P. K. (1970) J. Neurol. Neurosurg. Psych. 33, 698–704. 4. Wurtman, R. J. (1980) in Biochemical and Medical Aspects of Tryptophan Metabolism (Hayaishi, O., Ishimura, Y., and Kideo, R., Eds.), pp. 31–46, Elsevier/North-Holland, Amsterdam. 5. Knox, W. E. (1966) Adv. Enzyme Regul. 4, 287–297. 6. Knox, W. E., and Mehler, A. H. (1951) Science 113, 237–240. 7. Sono, M., Taniguchi, T., Watanabe, Y., and Kido, R. (1980) J. Biol. Chem. 255, 1339–1345. 8. Makino, R., Sakaguchi, K., Iizuka, T., and Ishimura, Y. (1980) in Biochemical and Medical Aspects of Tryptophan Metabolism (Hayaishi, O., Ishimura, Y., and Kideo, R., Eds.), pp. 179–187, Elsevier/North-Holland, Amsterdam. 9. Leeds, J. M., Brown, P. J., McGeehan, G. M., Brown, F. K., and Wiseman, J. S. (1993) J. Biol. Chem. 268, 17781–17786. 10. Maezono, K., Tashiro, K., and Nakamura, T. (1990) Biochem. Biophys. Res Commun. 170, 176–181. 11. Greengard, O., Smith, M. A., and Acs, G. (1963) J Biol. Chem. 238, 1548–1551. 12. Schimke, R. T, Sweeney, E. W, and Berlin, C. M. (1965) J. Biol. Chem. 240, 322–331. 13. Looman, A. C., Bodlaender, J., Comstock, L. J., Eaton, D., Thurani, P., de Boer, H. A., and Van Knippenberg, P. H. (1987) EMBO J. 6, 2489–2492. 14. Bornheim, L. M., Parish, D. W., Smith, K. M., Litman, D. A., and Correia, M. A. (1986) Arch. Biochem. Biophys. 246, 63–74. 15. Feigelson, P., and Greengard, O. (1961) J. Biol. Chem. 236, 153– 157. 16. Ishimura, Y., Nozaki, M., Hayaishi O, Nakamura, T. Tamura, M., and Yamazaki, I. (1961) J. Biol. Chem. 245, 3593–3601. 17. Makino, R., Sakaguchi, K., Iizuka, T., and Ishimura, Y. (1982) in Oxygenases and Oxygen Metabolism, (Nozaki, M., Yamamoto, S., Ishimura, Y., Coon, M. J., Ernster, L., and Estabrook, R. W., Eds.), pp. 467–477, Academic Press, New York, NY.

arcal

AP: Archives