Expression of recombinant antibody against cancer-specific carbohydrate

JOURNALOF FERMENTATION AND BIOENGINEERING Vol. 19, No. 5, 405-409. 1995

Expression of Recombinant Antibody Carbohydrate KUNIAKI REIJI

TAKAGI,’ KIYOSHI YASUKAWA,2 YOSHITAKA KANNAGI,3 KATSUNORI KOHDA,4 MASAHIRO

against Cancer-Specific

IBA,2 YUJI ISOBE,’ YASUNOBU SUKETA,’ TAKAG1,4 AND TADAYUKI IMANAKA4*

Department of Environmental Biochemistry, University of Shizuoka School of Pharmaceutical Science, 395, Yada, Shizuoka-shi, Shizuoka 422,’ Biotechnology Research Laboratory, Tosoh Corporation, 2743-1, Hayakawa, Ayase-shi, Kanagawa,2 Laboratory of Experimental Pathology, Research Institute, Aichi Cancer Center, I-1, Chigusa-ku, Nagoya-shi, Aichi 464,3 Department of Biotechnology, Faculty of Engineering, Osaka University, 2-1, Yamadaoka, Suita, Osaka 565,4 Japan Received 8 December 1994/Accepted

17 February 1995

Starting with a previously established hybridoma producing a monoclonal antibody (Fla75) against a synthetic glycolipid, in which the carbohydrate moiety was artificially designed to be putatively cancer-specific, we cloned complementary DNA (cDNA) for active variable regions of both heavy and light chains of the antibody. We established a Chinese hamster ovary (CHO) cell line expressing a recombinant Fla75 of human IgG class. The recombinant Fla75 retained the binding ability to its antigen and was easily purified. The result suggests that the conversion into the IgG class by genetic engineering is useful for antibodies of the IgM class which are difficult to be purified due to aggregation. Sequence analysis of variable regions of Fla75 revealed no strong homology with an antibody against galactose, the terminal residue of the synthetic glycolipid, suggesting the clinical usefulness of the recombinant Fla75. antibody,

[Key words:

PCR, recombinant

antibody,

cancer-specific

GG; VHlFOR2, 5’-TGAGGAGACGGTGACCGTGGTC CCTTGGCCCC; VrlBACK, 5’-GACATTCAGCTGAC CCAGTCTCCA; VK~FOR, 5’-GTTAGATCTCCAGCTT GGTCCC. FlnVHlBACK, 5’-CAGCTGCAGGAGTCT GGGACTGAGCTGGTGAGG; VHFORSALl, 5’-GGGG GTCGACGCTGAGGAGACGGTGACCGTGGTCCCTT GGCCCCAG. Restriction sites are underlined.

Several carbohydrate antigens including mucins have been characterized as tumor-specific antigens, and detection of these antigens such as CA19-9 in serum and tissues is widely used in diagnosis (1). Fla75 is a mouse monoclonal antibody of IgM class generated against the synthetic mucin-type carbohydrate lipid Fl a (Gal,9 l+ 4GlcNAcb 1 +6GalNAca 1+Ceramide), in which the carbohydrate portion is artificially designed to be putatively cancer-specific (2). Recent immunohistochemical analysis showed that Fla75 strongly reacted with antigen in malignant tissues including gastric, colon, and pancreatic cancers but not with antigen in normal tissues (3), suggesting that Fla is a cancer-specific antigen. In order to evaluate the clinical usefulness of Fla75, a large amount of purified antibody is required. In general, it has been difficult to manipulate anti-carbohydrate antibodies recognizing cancer-specific antigens since they belong to the IgM class in most cases, they sometimes bind carbohydrate residue and easily aggregate, and their affinity constant is small. Indeed, Fla75 of IgM class shows high aggregation potential when purified (unpublished data), possibly because it interacts with the carbohydrate residue. Therefore, conditioned medium containing Fla75 has been used in all of the experiments to date instead of purified Fln75 (3). To overcome these difficulties, we used a genetic engineering technique on Fla75 to prepare a recombinant antibody of IgG class. MATERIALS Oligonucleotides

were synthesized and AGGT(C/G)(A/C)A(A/G)

AND

carbohydrate]

Cloning of Fla75

of rearranged

gene encoding

variable

regions

mRNA was prepared from 1 x lo6 Fla75 hybridoma cells using an mRNA purification kit (Pharmacia, Uppsala, Sweden), and the cDNA was prepared using a cDNA synthesis kit (Pharmacia). VH and V/r genes were amplified from the cDNA with 30 cycles of PCR (94°C for 1 min, 54°C for 2 min, 72°C for 2 min) using Taq DNA polymerase (Toyobo, Osaka) and the primers VH 1BACK and VHlFOR2 or VslBACK and VnlFOR (4, 5). The amplified cDNA was assembled, reamplified, and cloned into the recombinant phage antibody-expressing phagemid pCANTAB5 according to the manufacturer’s instructions (Pharmacia). One clone, pCAFla2, was isolated and subjected to sequence analysis. Each of V, and VK genes was amplified again from pCAFla2 with 30 cycles of PCR under the same conditions as above and using the primers VHlBACK and VHFORSALl or VrlBACK and VnlFOR. The amplified DNA was digested with PstI and SalI for the Vu gene or PvuII and BgflI for the VK gene. After purification, the fragments were cloned into pBluescript (Toyobo). Of several clones in which the sequence of the insert DNA was analyzed, one clone containing the V, gene and another clone containing the VK gene were selected. The Vi, and Va genes were cloned into mammalian expression plasmids for recombinant antibodies, pEdHCG1 and pEdHClc (6), to give pHCG-VHl and ~HCK-VLl, respectively (Fig. 1). DNA Sequencing DNA sequencing was performed

METHODS

The following oligonucleotides used as primers. VHlBACK, 5’CTGCAG (C/G)AGTC(A/T)

* Corresponding author. 405

406

J. FERMENT. BIOENG.,

TAKAGI ET AL. Pstl/Ssel33871 \

dhfr

(4

dhfr

(4 FIG. 1. Construction of plasmids pHCG-VHl (a) and pH0VLI (b). EP, SV40 early promoter; LP, SV40 late promoter; polyA, polyadenylate attachment signal. by

the

dideoxynucleotide

chain

termination

procedure

using Sequenase (Toyobo) according to the manufacturer’s instructions. A homology search was performed using the GenBank database. Transient expression COSl cells were transfected with two plasmids, pHCG-VHl and pHCs-VLl, by the calcium phosphate method. Three days after the transfection, the culture supernatant was collected. Transformation of CHO cells and selection of the transformants Details of the procedure are described in a previous paper (7). Briefly, DXB-11 cells (8), of a dhfr- CHO cell line, were transfected with two plasmids, pHCG-VHl and pHC/r-VLl, (10 pg for each) by the calcium phosphate method. The cells had been cultured in a selective medium (nucleoside-deficient (w-MEM with 10% dialyzed fetal calf serum (FCS), 1 mM glutamine, 100 U/ml penicillin, and 100 [‘g/ml streptomycin) for 3 weeks. The selected transformants were then cloned using a limiting dilution technique. One clone, which expressed the recombinant antibody as detected by the antibody assay described below, was selected and cultured, with amplication through rounds of increasing methotrexate concentrations (from 20 nM to 200 nM). The clone thus established was designated CHFln. Production and purification of the recombinant Fla75 The CHO clone CHFln was grown to homogeneity to confluence in 2-1 cell factory systems (Nunc, Roskilde, Denmark) at 37”C, in a selective medium as described

above. The confluent monolayers were washed with (YMEM to remove FCS, and cultured for 3 d at 37°C in (YMEM without FCS. Conditioned medium was collected and concentrated in a membrane concentrator (Amicon, MA, USA). The recombinant Flu75 was purified by a Protein A sepharose affinity chromatography using an Immuno Pure IgG Purification Kit (Pierce, IL, USA). Proteins were SDS-PAGE and western blotting separated by 0.2% SDS/lo% polyacrylamide gel electrophoresis. One of the gels was stained with Coomassie brilliant blue. Proteins in another gel were equilibrated with Tris-glycine-methanol buffer and transferred onto nitrocellulose sheets (0.45 pm) at 10 V for 30 min using a semi-dry blotter. The sheet was incubated for 1 h at room temperature in 0.01 M Tris-HCl-buffered saline containing 1% BSA and subsequently incubated for 2 h with lOOO-fold-diluted horseradish peroxidase-conjugated goat anti-human IgG (H+L) (Cappel, PA, USA). After incubation, the sheet was washed five times in 0.01 M Tris-HCl-buffered saline containing 0.05% Tween 20 and immensed in 4-chloro-1-naphthol and H202 in methanol solution. Antibody assay The assay was performed as described elsewhere (9). Briefly, 96-well microplates were coated with anti-human Fey and blocked. A test sample (100 111) was added to each well and incubated at 4°C overnight. The bound chimeric antibody was detected by means of sequential incubation with horseradish peroxidase-conjugated anti-human Igk and the enzyme substrate solution. Antigen-binding assay The assay was performed as described elsewhere (9). Briefly, 96-well microplates were coated with Fl~v glycolipid antigen (2) in phosphatidylcholine and cholesterol and blocked. A test sample (100 ~1) was added to each well and incubated at 4°C overnight. The bound chimeric antibody was detected by the same method as the one above. RESULTS

AND DISCUSSION

Cloning of rearranged gene encoding variable regions of Fla75 Recent studies have shown that polymerase chain reaction (PCR) with mixed primers is a powerful tool for cloning a rearranged gene encoding variable regions from hybridoma cells or spleen cells of immunized mice (4). Furthermore, antibody genes are simply cloned by display of single chain Fv antibodies as fusion proteins to Ml3 phage, and the phage displaying a single chain Fv antibody which binds a particular antigen can be enriched by panning against the antigen (5). We attempted this system for isolating the VH and VK genes of Fln75, but detected no significant active phage (data not shown), possibly because the affinity of FItr75 of single chain Fv to its antigen (synthetic glycolipid Fln) was too weak to allow detection. We then selected one clone, pCAFltr2, and analyzed the nucleotide sequence of the insert V, and VK genes, and found that the third base was deleted in the codon for the glycine residue at amino acid position 8, based on the published data file of amino acid sequences of antibodies (10). Because the position corresponds to the 3’ terminal of the primer VHlBACK, the sequence GGG was changed to GG by the PCR amplification with the primer in which the 3’ terminal was GG. No other apparent transcription errors were observed based on the published sequence data (10). To our experience, such type of sequence con-

VOL. 19, 1995

EXPRESSION

w.1

z

OF RECOMBINANT

ANTIBODY

407

12345

1(4

1.5c

Dilution rate

14.4t

0.6 .

lb)

E 6

(4

0.6 -

s

1

r 61

27

9

Dilution

2

34s

r_ 3

1

rate

of COSl cells transfected with FIG. 2. (a) Culture supernatant pHCG-VHl and ~HCK-VLl (filled columns) and the control plasmids pEdCH1 and pEdCx (open columns) were serially diluted with PBS containing 194 BSA, and assayed by ELISA for the chimeric antibody. (b) Conditioned media of the CHFla cells transformed with pHCG-VHl and ~HCK-VLl (filled columns) and an anti-thyroid stimulating hormone antibody-expressing CHO cell transformant (open columns) were serially diluted with PBS containing 1% BSA, and assayed by ELISA for antigen binding activity. The mean values of the triplicates are shown.

version often occurs in amplifying the V, gene with the primer VHIBACK. We previExpression of the recombinant FL275 ously constructed expression vectors pEdHCG1 and pEdHClc (6) into which PCR-amplified Vu and VK genes were directly cloned, respectively. In order to clone Vu and VK genes into these two vectors, both genes were amplified from pCAFla2. For inserting G at the position described above, Fl(xVHlBACK was used for the H chain. As shown in Fig. 1, the Ig H chain and L chain having human constant regions were designed to be expressed from pHCG-VHl and pHCh--VLl in mammalian cells, respectively. Chimeric antibody was detected in the culture medium of COSl cells transfected with a mixture of pHCG-VHl and pHc~-vLl (Fig. 2a) and the CHO cell transformant designated CHFla (data not shown). Antigen binding activity was also observed in the conditioned medium of CHFln as shown in Fig. 2b. The activity was not observed using the plate not coated with Fla (data not shown), indicating that the binding is specific to Fln. On the basis of the ELISA for chimeric antibody using purified anti-Lewis Y chimeric antibody as the standard (9), the concentration of the antibody in

03 FIG. 3. SDS-PAGE of the recombinant Flu75 of IgG class. Purified Fla75 was analyzed by 0.2% SDS/lo% polyacrylamide gel under reducing conditions and visualized by Coomassie brilliant blue staining (a), or transferred to nitrocellulose membrane for Western blot analysis followed by incubation with peroxidase-conjugated antihuman IgG (Ht L) (b). Lane 1, M, ( x 103) of standards; lane 2, purified Fln75; lane 3, polyclonal human IgG purified from human serum; lane 4, monoclonal murine IgG: lane 5. monoclonal murine IgM.

the FCS-containing conditioned medium of CHFln was l-3 mg/l. This is almost the same as those of other recombinant proteins in the conditioned medium of CHO cell transformant, but is roughly tenfold less compared with the hybridoma-secreted antibody. As for the culture supernatant of COSl cells transfected with the same mixture, weak antigen binding activity was observed (data not shown). This may be explained by the fact that the concentration of the recombinant protein in the supernatant of COSl cells transfected with expression plasmids was lo-100 ng/ml, which is roughly one hundred times less than that in the conditioned medium of the CHO transformant. Another reason that the binding affinity of Fla75 to its antigen Flw is likely to be weak might be related to the fact that antigen binding activity was observed in the culture supernatant of COSl

408

TAKAGI

J. FERMENT. BIOENG.,

ET AL. (a) 1 CAG Q

2 GTC V

3 CAG Q

4 CTG L

5 6 CAG GAG Q E

7 TCT S

18 19 20 GTG AAG CTG V K L

21 TCC S

22 23 TGC AAG C K

24 25 26 27 28 29 30 31 32 33 34 GCT TCT GGC TAC ACA TTC ACC AGC TAC TGG ATG A S G Y T F T S Y W M

8 GGG G

9 10 11 12 13 14 15 16 17 ACT GAG CTG GTG AGG CCT GGA GCT TCA T E L V R P G A S

35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 CAC TGG GTG AAG CAG AGG CAT GGA CAA GGC CTT GAG TGG ATT GGA AAT ATT H W V K Q R H G Q G L E W I G N I 52 52A 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 TAT CCT GGT AGT GGT AGT ACT MC TAC GAT GAG AAG TTC MG AGC AAG GGC Y P G S G S T N Y D E K F K S K G 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 82A 82B ACA CTG ACT GTA GAC ACA TCC TCC AGC ACA GCC TAC ATG CAC CTC AGC AGC T L T V D T S S S T A Y M H L S S 82C 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 CTG ACA TCT GAG GAC TCT GCG GTC TAT TAC TGT ACA AGA GAA GGG GAT GGT L T S E D S A V Y Y C T R E G D G 99 100 1OOJ TAC CAC TAC Y H Y

(b) 1 2 GAC ATC D I

3 GAG E

1OOK TTT F

4 CTC L

101 102 103 104 105 106 107 108 109 110 111 112 113 GAC TAC TGG GGC CAA GGG ACC ACG GTC ATC GTC TCC TCA D Y W G Q G T T V I V S S

5 ACT T

6 CAG Q

7 TCT S

8 CCA P

9 GCA A

10 11 12 13 14 15 16 17 18 ATC ATG TTT GCA TCT CTA GGG GAG AAG I M F A S L G E K

19 20 21 22 23 24 25 26 27 29 30 31 32 33 34 35 36 37 GTC ACC ATG AGC TGC AGG GCC AGC TCA AGT GTA AAT TAC ATG TAC TGG TAC CAG V T M S C R A S S S V N Y M Y W Y Q 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 CAG AAG TCA GAT GCC TCC CCC AAA CTA TGG ATT TAT TAC ACA TCC AAC CTG GCT Q K S D A S P K L W I Y Y T S N L A 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 CCT GGA GTC CCA GCT CGC TTC AGT GGC AGT GGG TCT GGG AAC TCT TAT TCT CTC P G V P A R F S G S G S G N S Y S L 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 ACA ATC AGC AGC ATG GAG GGT GAA GAT GCT GCC ACT TAT TAC TGC CAG CAG TTT T I S S M E G E D A A T Y Y C Q Q F 92

93

94

ACT T

AGT S

TCG S

97

98

TAC ACG Y T

96

TTC F

FIG. 4. The nucleotide and deduced sequences represent the site to be annealed

99 100 101 102 103 104 105 106 107 108 GGA GGG GGG ACC AAG CTG GAA ATA AAA CGG G G G T K L E I K R

amino acid sequences of variable regions by FlnVHlBACK (a, upper), VHFORSALl

cells transfected with the mixture of these expression vectors containing genes of anti-thyroid stimulating hormone antibody (6; and unpublished data). This also might indicate why we were unable to isolate genes for Fln75 using the phage display method. Large-scale production of the recombinant Fla75 We purified 4mg of recombinant Fln75 from 8 I of FCS-free culture medium of the CHO cell transformant. As shown in Fig. 3a, upon SDS-PAGE under reducing conditions, the purified Fln75 yielded two bands with molecular mass values of 52 and 31 kDa, which corre-

of heavy (a) and light (b) chains of Fln75. Underlined (a, lower), VnlBACK (b, upper), and VlilFOR (b, lower).

sponded to the heavy chain and light chain of the recombinant Fln75, respectively. As shown in Fig. 3b, Western blot analysis showed that purified Fltr75 was recognized by anti-human IgG (H+L) antibody, indicating that the Fln75 was composed of human Fc as designed. Evaluation of possible clinical application is under way. In this manner, we obtained the purified recombinant Fla75, which was not obtained from the culture medium or the ascites fluid as the original Fln75 of IgM class due to aggregation. In general, the Fc region of IgM is heavily glycosylated (11). This may ex-

EXPRESSION

VOL. 79, 1995

plain why the recombinant gregation.

Fln75

of IgG showed no ag-

Sequencing analysis The epitopes of anti-carbohydrate antibody are sometimes restricted to the terminal sugar residue. Figure 4 shows the sequences encoding variable regions of Fla75. Because the terminal carbohydrate residue of Fla is galactose, one possibility is that the Fln epitope is restricted to the terminal galactose residue. Sequence analysis, however, showed no strong homology to anti-galactose antibody (12). This is in agreement with the findings that Fla75 recognizes a region covering several residues as expected (unpublished data). REFERENCES Magnani, J., Steplewskl, Z., Koprowski, H., and Ginsburg, V.: Identification of the gastrointestinal and pancreatic cancerassociated antigen detected by monoclonal antibody 19-9 in the sera of patients as a mucin. Cancer Res., 43, 5489-5492 (1983). Horie, R., Hara, K., and Nakano, K.: Synthesis of neoglycolipid containing a mucin-type core unit. Carbohydr. Res., 230, Cll-Cl5 (1992). Yamashita, Y., Chung, Y. S., Sawada, T., Kondo, Y., Hirayama, K., Inui, A., Nakata, B., Okuno, M., Horle, R., Saito, T., Murayama, K., Kannagi, R., and Sowa, M.: A new cancerassociated antigen defined by a monoclonal antibody against a synthetic carbohydrate chain. Int. J. Cancer, 58, 349-355 (1994). Orlandi, R., Gussow, D. H., Jones, P. T., and Winter, G.: Cloning immunoglobulin variable domains for expression by the polymerase chain reaction. Proc. Natl. Acad. Sci. USA,

OF RECOMBINANT

ANTIBODY

409

86, 3833-3837 (1989). 5. Clackson, T., Hoogenboom, H. R., Grifiths, A. D., and Winter, G.: Making antibody fragments using phage display libraries. Nature, 352, 624-628 (1991). 6. Iba, Y., Kaneko, T., Ekida, T., Miyata, K., Inoue, K., Kurosawa, Y., and Yasukawa, K.: A new system for the expression of recombinant antibody in mammalian cells. Biotech. Lett., 17, 135-138 (1995). 7. Yasukawa, K., Saito, T., Fukunaga, T., Sekimori, Y., Koishihara, Y., Fukui, H., Ohsugi, Y., Matsuda, T., Yawata, H., Hirano, T., Taga, T., and Kishimoto, T.: Purification and characterization of soluble human IL-6 receptor expressed in CHO cells. J. Biochem., 108, 673-676 (1990). 8. Urland, G. and Chesin, L. A.: Isolation of Chinese hamster cell mutants deficient in dihydrofolate reductase activity. Proc. Natl. Acad. Sci. USA, 77, 4216-4220 (1980). 9. Kaneko, T., Iba, Y., Zenita, K., Shigeta, K., Nakano, K., Itoh, W., Kurosawa, Y., Kannagi, R., and Yasukawa, K.: Preparation of mouse-human chimeric antibody to an embryonic carbohydrate antigen, Lewis Y. J. Biochem., 113, 114-l 17 (1993). 10. Kabat, E. A., Wu, T. T., Perry, H. M., Gottesman, K. S., and Foeller, C. (ed.): Sequence of proteins of immunological interest. U.S. Department of Health and Human Services, NIH, Bethesda (1991). 11. Inouye, K. and Morlmoto, K.: Single-step purification of F(ab’)2m fragmens of mouse monoclonal antibodies (immunoglobulin M) by hydrophobic interaction high-performance liquid chromatography using TSKgel Ether-SPW. J. Biochem. Biophys. Methods, 26, 27-30 (1993). 12. Jarvis, C. D., Cannon, L. E., and Stavnezer, J.: Mouse antibody response to group A streptococcal carbohydrate. J. Immunol., 143, 4213-4220 (1989).