- Email: [email protected]
Expression of RsMYB1 in Petunia enhances anthocyanin production in vegetative and floral tissues
Scientia Horticulturae 214 (2017) 58–65
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Expression of RsMYB1 in Petunia enhances anthocyanin production in vegetative and floral tissues Trinh Ngoc Ai a,b , Aung Htay Naing a,1 , Muthukrishnan Arun a , Su Min Jeon c , Chang Kil Kim a,∗ a
Department of Horticultural Science, Kyungpook National University, Daegu, 41566, Korea School of Agriculture and Aquaculture, Tra Vinh University, Tra Vinh, Viet Nam c National Institute of Biological Resources, Incheon, 22689, South Korea b
a r t i c l e
i n f o
Article history: Received 2 September 2016 Received in revised form 7 October 2016 Accepted 17 November 2016 Keywords: Agrobacterium tumefaciens Anthocyanin Ornamental plants Transcription factor
a b s t r a c t Anthocyanin production enhanced by heterologous expression of R2R3 MYB transcription factors has been studied. However, little is known about validated information on the ability of RsMYB (an MYB gene from radish) to enhance anthocyanin production in a heterologous system. In the present study, heterologous expression of RsMYB1 in Petunia hybrida ‘Mirage Rose’ enhanced anthocyanin production in vegetative and floral tissues such as leaves, stems, roots, and petals by transcriptional activation of anthocyanin biosynthetic genes and endogenous antocyanin regulatory genes. Line PM6 expressed higher transcript levels of RsMYB1 than line PM2 and regulated transcript levels of the investigated genes largely than line PM2, whereas those regulated in wild type (WT) plants were the lowest. In addition, transcript levels of the genes detected using qualitative real-time polymerase chain reaction were found to be higher in petals, followed by leaves, stems and roots. Taken together, our results suggest that RsMYB1 enhances anthocyanin production in vegetative and floral tissues of this cultivar, thus, we expect that heterologous expression of RsMYB1 would help to modify flower color of other ornamental plants as well. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Anthocyanins, which are synthesized through the flavonoid biosynthetic pathway, are the most diverse group of plant pigments that impart colors ranging from red to violet and blue (van Tunen and Mol, 1991). Enhancement of anthocyanin accumulation in ornamental plants could result in the development of novel flower colors for commercial markets. Recently, a large number of ornamental plants with novel flower colors have been available in global flower markets. In plants, anthocyanins aid in ensuring protection against solar exposure and ultraviolet radiation and also act as potential antioxidants that may scavenge reactive oxygen species to display tolerance against cold temperatures (Christie et al., 1994; Sarma and Sharma 1999), plant pathogens (Kukula et al., 2005), salt (Tohge et al., 2005; Oh et al., 2011), and drought stress (Castellarin et al., 2007).
∗ Corresponding author at: Department of Horticultural Science, Kyungpook National University, Daegu, 41566, Korea. E-mail addresses: [email protected] (A.H. Naing), [email protected] (C.K. Kim). 1 Equally contributed to first author. http://dx.doi.org/10.1016/j.scienta.2016.11.016 0304-4238/© 2016 Elsevier B.V. All rights reserved.
The role of R2R3 MYB transcription factors in the enhancement of anthocyanin pigmentation has been confirmed by characterization of the anthocyanin biosynthetic pathway in several plant species. Heterologous expression of R2R3 MYB transcription factors is considered vital in inducing spatial and temporal anthocyanin production in several plant species. Of the transcription factors, the MYB transcription factor (PAP1), which is mostly known as the anthocyanin regulatory gene, has been used in heterologous systems to enhance anthocyanin production in several plant species, including Arabidopsis (Borevitz et al., 2000), tomato (Zuluaga et al., 2008), tobacco (Xie et al., 2006), and petunia (Ben Zvi et al., 2008). Recently, heterologous expression of PAP1 in rose exerted transcriptional activation of anthocyanin biosynthetic genes and increased accumulation of anthocyanins (Ben Zvi et al., 2012). Park et al. (2011) reported that RsMYB1 shared high sequence similarity to the MYB transcription factors (PAP1), and which expressed in red radish was higher than in common white radish. In addition, over-expression of RsMYB1 in tobacco and Arabidopsis enhanced anthocyanin production by regulating transcription of anthocyanin biosynthetic and endogenous anthocyanin regulatory genes (Lim et al., 2016). According to the results of our previous study, heterologous expression of RsMYB1 could enhance key anthocyanin biosynthetic genes in the chrysanthemum
T.N. Ai et al. / Scientia Horticulturae 214 (2017) 58–65
cultivar Shinma (Naing et al., 2015), although enhanced anthocyanin accumulation was not observed. Petunia (Petunia × hybrida) is a popular ornamental bedding plant and is widely grown throughout the world, in addition, it is considered model crop to be investigated for the functional roles of metabolically engineered genes. Thus, we introduced RsMYB1 in Petunia hybrida ‘Mirage Rose’ by using Agrobacterium-mediated transformation to determine whether the transcription factor could enhance transcript levels of anthocyanin biosynthetic and endogenous regulatory genes that can modify flower color of the cultivar. In addition, we investigated anthocyanin regulation of RsMYB1 in different vegetative and floral tissues of the transgenic Petunia. 2. Materials and methods 2.1. Plant material Leaves of 5-week-old P. hybrida ‘Mirage Rose’ grown in a greenhouse were collected and sterilized with 0.1% sodium hypochlorite (Yuhan Co, Ltd., Seoul, South Korea) solution containing 0.01% Tween 20 (Duchefa, Haarlem, The Netherlands) for 10 min. The surface-sterilized leaves were then rinsed several times with sterile distilled water, and leaf explants that were 0.5–0.75 cm in length (mid-rib region) were excised. 2.2. Agrobacterium strains and plasmid construction Agrobacterium tumefaciens strains C58C1 harboring the plasmid pB7WG2D were used in this study. The plasmid contains the transcription factor (TF) RsMYB1 isolated from Raphanus sativus ‘Bordeaux’ (Lim et al., 2016), which was under the control of the cauliflower mosaic virus 35S promoter and terminator (Supplementary Fig. 1). The bar gene, which confers phosphinothricin (PPT) resistance, was used as the selection marker. 2.3. Genetic transformation The leaf explants (about 300 explants) were initially precultured on regeneration medium (MS medium supplemented with 4.44 M N6 -benzyladenine and 2.47 M indole-3-butyric acid) and incubated under total darkness for 2 days at 25 ± 2 ◦ C. The pre-cultured explants were then transferred to Agrobacterium suspension adjusted to an OD600 of 1 and incubated at room temperature for 30 min. Then, the explants were blot-dried on a sterile filter paper, placed horizontally in MS medium containing 200 M acetosyringone (pH 5.4), and incubated for 2 days under darkness. The explants were then transferred to the regeneration medium containing 250 mg l−1 Clavamox and 0.5 mg l−1 PPT and sub-cultured 3 times at 10-day intervals. Shoots that showed resistance to PPT and visible anthocyanin pigmentation were excised and transferred to hormone-free MS medium supplemented with 250 mg l−1 Clavamox and 1 mg l−1 PPT. After 20 days of culture, the shoots were further transferred to hormone-free MS medium containing a higher concentration of PPT (1.5 mg l−1 ), and incubated for 21 days. Adventitious roots that developed from the shoots were
completely removed and washed thoroughly with sterile distilled water before being transferred to plastic pots containing peatbased soil. The plantlets were initially grown in a growth chamber (25 ± 2 ◦ C and 85% relative humidity) for 2–3 days. The plantlets were then transferred to the plastic pots, containing peat-based soil and grown in the greenhouse under controlled conditions.
2.4. Detection of the presence of RsMYB1 by using polymerase chain reaction (PCR) Total genomic DNA from the leaves of PPT-resistant and wild type (WT) plants was isolated using the HiYieldTM Genomic DNA Mini Kit (plant), according to the manufacturer’s instructions (Real Biotech Corporation, Taipei, Taiwan). The plasmid pB7WG2DRsMYB1 was used as the positive control. Polymerase chain reaction (PCR) was performed using primers, and the PCR conditions have been described in Table 1. The amplified products were analyzed using electrophoresis in 1% (w/v) agarose gels.
2.5. Quantitative realtime – PCR Of the PCR-positive transgenic plants, lines (PM1–PM6) showing anthocyanin pigmentation in vegetative tissues were selected by visual screening and analyzed to detect the transcript levels of RsMYB1 by using quantitative real-time (qRT)-PCR. Total RNA was isolated from leaves, stems, and roots of the lines and WT plantlets by using the RNAqueous Kit (Ambion Inc., Austin, USA). Reverse transcription was performed according to the manufacturer’s instructions (ReverTra Ace-a´ı, Toyobo, Japan) by using 1 g of total RNA and oligo dT20 primer. Tubulin (SGN-U207876) was used as the internal control [16]. Transcript levels of RsMYB1 were analyzed using the Step One Plus Real-Time PCR system, USA. Realtime- PCR was performed using a 20-l reaction volume containing 0.5 M of each primer and Power SYBR® Green PCR Master Mix (Woolston Warrington, UK). The primers and PCR conditions for the detection of RsMYB1 transcripts are listed in Table 1. Lines showing the highest (PM6) and lowest (PM2) RsMYB1 transcripts along with WT plantlets were further selected to determine the expression levels of biosynthetic and endogenous regulatory genes contained in the vegetative (leaf, stem, and root) involved in anthocyanin biosynthetic pathway. Primers of the tested genes were designed based on the Petunia genomic sequences in GenBank: PAL, AY705976; CHS, AF233638; CHI, AF233637; F3H, X70786; DFR, KC140107; ANS, AB910267, AN1, AN2, and AN4 (Table 2). As mentioned above, Tubulin (SGN-U207876) was used as the internal control (Mallona et al., 2010), and qRTPCR conditions are the same as those listed in Table 1. To determine the expression levels of RsMYB1, biosynthetic genes, and regulatory genes in floral tissues, RNA was isolated from petal and transcriptional analysis of the genes were performed as done in vegetative tissues.
Table 1 Primer and PCR conditions used for detection of RsMYB1 gene. Genes
Primer sequences
Condition
RsMYB1 (PCR)
FP: 5 -ATG GAG GGT TCG TCC AAA GG-3 RP: 5 -GAA ACA CTA ATC AAA TTA CAC AGT CTC TCC-3 FP: 5 -TCT TTG GTT TGT CGT TCA GTA A-3 RP: 5 -ACA CAC GGG TTC GTG CAA-3 FP: 5 -TGGAAACTCAACCTCCATCCA-3 RP: 5 -TTTCGTCCATTCCTTCACCTG-3
95 ◦ C for 2 min, followed by 25 cycles of 95 ◦ C for 20 s, 60 ◦ C for 40 s, 72 ◦ C for 1 min and 72 ◦ C for 5 min ◦ ◦ ◦ 95 ◦ C (10 min)-[95 C (30 s)- 60 C (30 s)] followed by 40 cycles − 95 C (15 s)◦ ◦ 60 C (30 s)- 95 C (15 s) ◦ ◦ ◦ ◦ 95 C (10 min)-[95 C (30 s)- 60 C (30 s)] followed by 40 cycles − 95 C (15 s)◦ ◦ 60 C (30 s)- 95 C (15 s)
RsMYB1(qRT-PCR) TUB* (qRT-PCR) *
TUB tubulin gene (Mallona et al., 2010).
59
60
T.N. Ai et al. / Scientia Horticulturae 214 (2017) 58–65
Table 2 List of primers used in quantitative real-time polymerase chain reaction (qRT-PCR) analysis. Gene
Gene accession no.
Primers sequences Forward primer
Reverse primer
PAL CHS CHI F3H DFR ANS AN1 AN2 AN4 TUB*
AY705976 AF233638 AF233637 X70786 KC140107 HQ428109.1 AF260918 AF146702 HQ428105 SGN-U207876
5 -AGGGGGTGAGACGCTAACAGT-3 5 -GAGGCACGGTTCTTCGGTTA-3 5 -TCTCCTGCGGCAAAGTGTAA-3 5 -AAGTGCCCCCAACCAGAAC-3 5 -CTACCCGAAGTGCTGAAGACAA-3 5 - GGGGAAGGAAAGTGGCATCA −3 5 -AAGAATTCATGCAGCTGCAAACCATG-3 5 -AGCAGCAGCAGTCAATCTCTTTT-3 5 -GGGAAGGAAAGTGGCATCAA-3 5 -TGGAAACTCAACCTCCATCCA-3
5 -CGTCCGTGCCCGATTG-3 5 -GTGACCGCGGTGATTTCTG-3 5 -TCTCGGTCTCCGGTTTTCC-3 5 -TCAGTGCGCTGACATCTGTATG-3 5 -TGATTTGCAACTGGTGCATTC-3 5 - TGGAGAGGAGCCAAGTCTCA −3 5 -ATCTCGAGGGACAAAGTGAGAGATC-3 5 - AGAGCATCCGAGAGCGTTTC −3 5 -GTTCCTTATAGAGGGTTAGCCAGAGA-3 5 -TTTCGTCCATTCCTTCACCTG-3
PAL- phenylalanine ammonia-lyase; CHS- chalcone synthase; CHI- chalcone isomerase; F3H- flavanone-3-hydroxylase; DFR- dihydroflavonol 4-reductase; ANS- anthocyanidin synthase; AN1- anthocyanin1; AN2- anthocyanin2; AN4- anthocyanin4; * TUB: tubulin gene (Mallona et al., 2010). PCR conditions: 95 ◦ C (10 min)–95 ◦ C (30 s)–60 ◦ C (30 s)–95 ◦ C (15 s)–60 ◦ C (30 s)–95 ◦ C (15 s).
2.6. Analysis of anthocyanin content Total anthocyanin content in vegetative (leaves, stems, and roots) and floral (petal) tissues of the lines (PM2 and PM6) were determined and compared with WT counterparts. About 0.5 g (fresh weight) of each tissue was ground using liquid nitrogen and transferred to 15-ml dry Falcon tubes. Anthocyanins from the fine powder were extracted by adding 5 ml of the extraction solution (99:1 v/v methanol/HCl; Sigma, St. Louis, USA), followed by 24 h of incubation at 4 ◦ C. The content was then centrifuged at 13000 rpm for 20 min at 4 ◦ C, and the supernatant was collected in a fresh tube. Total anthocyanin content was determined according to the method reported by Chu et al. (2013). 2.7. Experimental conditions and statistical analysis All the cultures were incubated at 25 ± 2 ◦ C under a 16-h photoperiod and an intensity of 50 mol m−2 s−1 . Data were statistically analyzed using SAS version 9.4. Data are presented as mean ± standard error values. The significance was determined at 5% level by using Duncan’s multiple range test. Each analysis was carried out using at least three biological samples. 3. Results The co-cultivated leaf explants cultured on the shoot regeneration medium containing 250 mg l−1 Clavamox and 0.5 mg l−1 PPT initiated shoot buds within 10 days of the initial culture. Thirtyday-old shoots showing resistance to 0.5 mg l−1 PPT and purple color survived on hormone-free MS medium containing 250 mg l−1 Clavamox and 1 mg l−1 PPT. Most of the shoots that survived developed roots in the same medium containing a higher concentration of PPT (1.5 mg l−1 ). The rooted plantlets survived well when transferred to plastic pots containing peat-based soil under controlled greenhouse conditions. The presence of RsMYB1 in 1-month-old greenhouse-grown putative transformants that showed resistance to 1.5 mg l−1 PPT was detected using PCR, amplified products of expected size (700 bp) could be detected in the genomic DNA of all the tested plants (Fig. 1, lanes PM1–6), which was the same as that when plasmid pB7WG2D-RsMYB1 used as the positive control (Fig. 1, lane P) and was not observed in WT plants (Fig. 1, lane WT). Transgenic plants carrying RsMYB1 exhibited anthocyanin accumulation in vegetative tissues; however, accumulation due to RsMYB1 was different among the transgenic plants (data not shown). In addition, in some lines, accumulation seemed to be tissue-specific because contents that accumulated in the leaves, stems, and roots were found to be seemingly different (data not shown). To reveal the reasons why the different accumulation
patterns were observed in the transgenic lines, transcript levels of RsMYB1 were detected using qRT-PCR. Results presented in Fig. 2 (a–c) indicated that the transcript level significantly varied among the independent lines (PM1–PM6). Moreover, its different expression levels corresponding to different vegetative tissues were clearly observed in some transgenic lines. In general, the expression levels were the highest in the leaves (Fig. 2 a), followed by stems (Fig. 2 b) and roots (Fig. 2 c). Of the tested lines, transcript level of RsMYB1 in vegetative tissues (leaves, stems, and roots of line PM-6 was significantly higher than that in line PM-2, wherein visual anthocyanin accumulation was also observed to be more purple in line PM-6 than in line PM-2 (Fig. 3A–C). Therefore, we were interested in comparing the transcript levels of biosynthetic and endogenous anthocyanin regulatory genes in the vegetative tissues of the two different lines regulated by RsMYB1, along with WT plantlets. Expectedly, transcript levels of the biosynthetic (PAL, CHS, CHI, F3H, DFR, and ANS) and the endogenous regulatory (AN1, AN2, and AN4) genes detected in the vegetative tissues were significantly higher in PM6 than in PM2, while those in WT were the lowest (Fig. 4). In the both lines, the detected genes were significantly higher at transcriptional levels in the leaves than in the stems and roots. In general, transcript levels of ANS, AN1, and AN4 were highly elevated in the leaves, stems, and roots of PM6. According to the results of qRT-PCR analysis of transcript levels of RsMYB1 and anthocyanin biosynthetic and endogenous
Fig. 1. Detection of RsMYB1 in the transgenic lines by PCR, (a) Lane L, 100 bp plus DNA ladder; Lane P, pB7WG2D-RsMYB1 as the positive control; Lane WT, wild type (WT) plant genomic DNA as the negative control; Lanes PM1–6, the different transgenic lines showing RsMYB1 (700 bp).
T.N. Ai et al. / Scientia Horticulturae 214 (2017) 58–65
61
Fig. 2. Assessment of expression levels of RsMYB1 in (a) leaves, (b) stems, and (c) roots of the six independent lines by qRT-PCR analysis. The bars represent expression levels of genes relative to the level of tubulin (±) with standard error (n = 3).
regulatory genes, transcript levels of the detected genes in the vegetative tissues (leaves, stems, and roots) were higher in PM6 than in PM2, which were associated with the anthocyanin contents detected in the whole plant because the contents accumulated in different vegetative parts were higher in PM6 than in PM2, however, the lowest contents were observed in WT plants (Fig. 3D). Considering the effect of RsMYB1 on anthocyanin accumulation in flowers of the two transgenic lines relative to that of WT, there was a large variation in flower color phenotype between the transgenic lines and WT plants, resulting in higher anthocyanin accumulation in petals of the transgenic lines than WT plants (Fig. 5A). In addition, there was little variations in petal color between the two transgenic lines as well, in which the flower color of PM6 line had slightly more red color than that of PM2. When expression level of RsMYB1 was analyzed by qRT-PCR, it was observed that its transcript levels in the floral tissues of PM6 were higher than in those of PM2 lines (Fig. 5B). According to analysis of anthocyanin contents in the floral tissue (petal), the contents were found to be the highest in PM6 followed by PM2 and WT (Fig. 5C), which were associated with visual accumulation in the plants.
Data in Fig. 6 also indicate that the biosynthetic genes (PAL, CHS, CHI, F3H, DFR, and ANS) and the regulatory genes (AN1, AN2, and AN4) expressed in the floral tissues of PM6 were higher than those in PM2, followed by WT were. Specifically, in petal of PM6, transcript levels of PAL, CHS, F3H, and AN4 were highly elevated, however, similar elevations were observed in only CHS and AN4 of PM2. In term of DFR, there was little variation in its expression between WT and PM2, but its significant high transcript level was observed in PM6. 4. Discussion In this study, we showed that heterologous expression of RsMYB1, a member of the R2R3MYB type gene family, in Petunia leads to enhancement of anthocyanin production in vegetative tissues (leaves, stems, and roots) and floral tissue (petal). Such enhancement resulted in a distinguishable phenotype in the transgenic plants when compared with the WT plants. The results of the present study were similar to those of previous studies on other crops; An et al. (2015) reported that expression of IbMYB1a (MYB) enhanced anthocyanin pigmentation in leaves, stems, roots,
Fig. 3. Comparison of visual anthocyanin accumulation in vegetative tissues (A; leaves, B; stem, and C; root) and D; their total anthocyanin contents of WT and the transgenic lines (PM2 and PM6) expressing RsMYB1. The bars represent mean values of samples tested in triplicate (±) with standard error.
62
T.N. Ai et al. / Scientia Horticulturae 214 (2017) 58–65
Fig. 4. Assessment of transcript levels of anthocyanin biosynthetic and regulatory genes in leaves, stems, and roots of the lines (PM2 and PM6) expressing RsMYB1. The bars represent expression levels of genes relative to the level of tubulin (±) with standard error (n = 3).
and flowers of transformed tobacco plants. Pattanaik et al. (2010) showed that ectopic expression of NtAn2 (MYB) improved anthocyanin production in the whole plant of tobacco and Arabidopsis. Geekiyanage et al. (2007) reported that overexpression of VlmybA2 (MVB) induced anthocyanin pigmentation in the whole plant of transformed tobacco and Arabidopsis. Recently, Lim et al. (2016) also claimed that transient expression of the same gene, RsMYB1, in tobacco and its overexpression in Arabidopsis showed enhanced anthocyanin production in vegetative and floral tissues. In this study, we found that expression levels of RsMYB1 differed in the transgenic lines (PM1–6), wherein the line PM6 showed the highest transcript level while the line PM2 exhibited the lowest. In addition, transcript levels of RsMYB1 expressed in the vegetative (leaves, stems, and roots) and the floral (petal) were different. In the both lines, particular in PM6, transcript level of RsMYB1 was the highest in leaves, followed by petal, stems and roots, thus, visual anthocyanin accumulations in leaves and petals were found to be stronger than other tissues. Different expression levels of RsMYB1 in vegetative and floral tissues of the lines appeared to be attributable to tissue-specific expression of RsMYB1. Similar expression of NtAn2 (MYB) has been reported in transgenic tobacco, in which NtAn2 was highly expressed in flowers but could not be detected in leaves (Pattanaik et al., 2010). Lim et al. (2016) also reported that RsMYB1 expressed in leaves was higher than in roots of red radish. According to the qRT-PCR results, in the vegetative tissues, high transcript levels of RsMYB1 regulated high expression levels of the anthocyanin biosynthetic genes (PAL, CHS, CHI, F3H, DFR, and
ANS) involved in the anthocyanin synthetic pathway because the detected genes were expressed largely in line PM6 than in line PM2. Similarly, they were generally expressed largely in the leaves than in the stems followed by roots in the both lines. More obviously, the lowest detected gene expression was observed in WT plants, whereas ANS was not expressed at all while the other genes were relatively lowered in expression. This study confirmed the finding of Lim et al. (2016), who reported that transcript levels of all biosynthetic genes expressed in transgenic Arabidopsis expressing RsMYB1 with strong anthocyanin accumulation were higher than that with moderate anthocyanin accumulation. Moreover, in all vegetative tissues of the lines, expression of the late biosynthetic gene ANS was the highest, thus enhanced expression of ANS appeared to be important for the production of anthocyanins in transgenic Petunia. Lim et al. (2016) also claimed that RsMYB1 strongly upregulated AtANS and induced strong anthocyanin accumulation in transgenic Arabidopsis plants. In addition, they further claimed that RsMYB1 could regulate endogenous regulatory genes besides the biosynthetic genes, which was also confirmed by this study, resulting in up-regulation of endogenous anthocyanin regulatory genes such as AN1, AN2, and AN4, which are essential for anthocyanin production in Petunia. Hence, in this study, enhancement of anthocyanin in the transgenic lines could also be due to upregulation of the anthocyanin regulatory genes because interaction of AN1 (bHLH transcription factor) with AN2 (MYB transcription factor) had shown to activate anthocyanin biosynthesis in Petunia (Spelt et al., 2000). Quattrocchio et al. (1993) also described AN1 as
T.N. Ai et al. / Scientia Horticulturae 214 (2017) 58–65
63
Fig. 5. Comparisons of A) flower phenotype, B) transcript levels of RsMYB1, and C) anthocyanin contents in wild type (WT) and the lines (PM2 and PM6) expressing RsMYB1.The bars represent mean values of samples tested in triplicate (±) with standard error.
essential regulator of anthocynin synthesis throughout the plant. Moreover, correlations between low levels of AN1 transcripts and weak pigmentation phenotype had been reported (Bradley et al., 1998; Albert et al., 2009). Our study confirmed findings of the previous reports by resulting in stronger anthocyanin accumulation in PM6 with high transcript levels of the endogenous regulatory genes followed by in PM2 with moderate levels and in WT with lowest transcript levels of the genes. Flowers of RsMYB1-transgenic Petunia showed more reddish color than those of WT plants. Lim et al. (2016) observed that over-expression of RsMYB1 in Arabidopsis distinctly showed reddish flowers and stigmas, compared with WT plants. In contrast to Arabidopsis, no red color was observed in the stigma of Petunia, but which was noticed in the stamen (data not shown). However, Lim et al. (2016) did not examine transcript levels of the biosynthetic and endogenous regulatory genes in floral tissues induced by RsMYB1. In this study, we revealed why different pigmentation patterns were occurred in floral tissues by determining expression levels of the biosynthetic and regulatory genes between transgenic and WT flowers, in which transcript levels of the detected genes expressed in floral tissues were generally higher in PM6 followed by PM2 and WT plant. Specifically, expression of early biosynthetic (PAL, CHS, and F3H) and late biosynthetic (DFR and ANS) genes are highly elevated in PM6 relative to those of WT, while except CHS and ANS similar elevations were not noticed in PM2. In addition, high transcript levels of the endogenous regulatory genes (AN1, AN2, and AN4) induced by RsMYB1 were observed, but
which were not highly different at transcription levels in the both lines, compared with those biosynthetic genes. Hence, although the biosynthetic genes are differently expressed in the both lines, slightly different pigmentations in the petals are likely due to upregulations of AN1, AN2 and AN4 rather than the biosynthetic genes. Specifically, occurrence of slightly more reddish color in petal of PM6 than in that of PM2 might also be due to higher transcript levels of AN1, AN2 and AN4 expressed in PM6. In previous reports, influence of AN2 and AN4 in anthocyanin pigmentation in petal and flower tube of Petunia was observed (de Vetten et al., 1997; Quattrocchio et al., 1998, 1999; Spelt et al., 2000). Albert et al. (2011) also recently reported that AN2 and AN4 displays anthocyanin venation patterning of the flower tube of Mitchell petunia. In addition, the similar influences of AN2 and AN4 had been reported in Antirrhinum (Schwinn et al., 2006) and maize as well (Piazza et al., 2002). Recently, Boase et al. (2015) claimed high influence of AN1 in pigmentation of Petunia flower. Although overexpression of MYB transcription factors in several plant species had been shown to enhance anthocyanin production in vegetative and floral tissues by up-regulation of the biosynthetic and regulatory genes (Chiu et al., 2010), there had been some studies reporting about resultant of very weak anthocyanin production in Zea mays (maize), tomato, apple, and Chinese bayberry by single expression of MYB transcription factor alone (Bovy et al., 2002; Espley et al., 2007; Huang et al., 2013). In this study, these results proved that single expression of RsMYB1 without bHLH transcription factor in Petunia enhanced anthocyanin
64
T.N. Ai et al. / Scientia Horticulturae 214 (2017) 58–65
Fig. 6. Comparisons of transcript levels of anthocyanin biosynthetic and regulatory genes in wild type (WT) and the lines (PM2 and PM6) expressing RsMYB1.
accumulation in the whole plant including floral tissues by upregulating the biosynthetic and endogenous regulatory genes involved in the anthocyanin biosynthetic pathway. Tohge et al. (2005) and Oh et al. (2011) observed that plants transformed with anthocyanin-regulating transcription factors showed increased tolerance to abiotic stress when compared with the WT. Lim et al. (2016) also claimed that enhancement of anthocyanin due to heterologous expression of RsMYB1 improves antioxidant activities that can scavenge reactive oxygen species (ROS) induced during abiotic stress period. Based on those studies; we expect that heterologous expression of RsMYB1 in Petunia plants not only enhances anthocyanin content in the whole plant but also will be resistant to abiotic stresses. In addition, another advantage of RsMYB1 is that it can be used as a visible selection marker to select transformants without the need for antibiotic- or herbicide-resistant genes or PCR. 5. Conclusion We revealed that heterologous expression of RsMYB1 enhanced the transcriptional activation of biosynthetic and regulatory genes, resulting in enhanced anthocyanin contents in vegetative and floral tissues of the transgenic Petunia plants, thus, we can suggest that heterologous expression of RsMYB1 would help to modify flower color of other ornamental plants. In addition, it can be expected that enhancement of anthocyanin pigmentation would also help
in resistance against abiotic stresses, such as salt, drought, and temperature. Acknowledgements This work was supported by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries (IPET) through Agri-Bio industry Technology Development Program, funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA) (315002-5). We wish to thank Dr. Sun-Hyung Lim (RDA, Korea) for kindly providing the plasmid. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.scienta.2016. 11.016. References Albert, N.W., Lewis, D.H., Zhang, H., Irving, L.J., Jameson, P.E., Davies, K.M., 2009. Light-induced vegetative anthocyanin pigmentation in Petunia. J. Exp. Bot. 60, 2191–2202. Albert, N.W., Lewis, D.H., Zhang, H., Schwinn, K.E., Jameson, P.E., Davies, K.M., 2011. Members of an R2R3-MYB transcription factor family in Petunia are developmentally and environmentally regulated to control complex floral and vegetative pigmentation patterning. Plant J. 65, 771–784.
T.N. Ai et al. / Scientia Horticulturae 214 (2017) 58–65 An, C.H., Lee, K.W., Lee, S.H., Jeong, Y.J., Woo, S.G., Chun, H., Park, Y.I., Kwak, S.S., Kim, C.Y., 2015. Heterologous expression of IbMYB1a by different promoters exhibits different patterns of anthocyanin accumulation in tobacco. Plant Physiol. Biochem. 89, 1–10. Ben Zvi, M.M., Negre-Zakharov, F., Masci, T., Ovadis, M., Shklarman, E., 2008. Interlinking showy traits: co-engineering of scent and colour biosynthesis in flowers. Plant Biotechnol. J. 6, 403–415. Ben Zvi, M.M., Shklarman, E., Masci, T., Kalev, H., Debener, T., 2012. PAP1 transcription factor enhances production of phenylpropanoid and terpenoid scent compounds in rose flowers. New Phytol. 194, 430–439. Boase, M.R., Brendolise, C., Wang, L., Ngo, H., Espley, R.V., Hellens, R.V., Schwinn, K.E., Davies, K.M., Albert, N.W., 2015. Failure to launch: the self-regulating Md-MYB10R6 gene from apple is active in flowers but not leaves of Petunia. Plant Cell Rep. 34, 1817–1823, 2015. Borevitz, J.O., Xia, Y., Blount, J., Dixon, R.A., Lamb, C., 2000. Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. Plant Cell 12, 2383–2394. Bovy, A., de Vos, R., Kemper, M., Schijlen, E., Almenar Pertejo, M., Muir, S., Collins, G., Robinson, S., Verhoeyen, M., Hughes, S., Santos- Buelga, C., van Tuinen, A., 2002. High-flavonol tomatoes resulting from the heterologous expression of the maize transcription factor genes LC and C1. Plant Cell 14, 2509–2526. Bradley, J.M., Davies, K.M., Deroles, S.C., Bloor, S.J., Lewis, D.H., 1998. The maize Lc regulatory gene up-regulates the flavonoid biosynthetic pathway of Petunia. Plant J. 13, 381–392. Castellarin, S.D., Pfeiffer, A., Sivilotti, P., Degan, M., Peterlunger, E., Gaspero, G.D., 2007. Transcriptional regulation of anthocyanin biosynthesis in ripening fruits of grapevine under seasonal water deficit. Plant Cell Environ. 30, 1381–1399. Chiu, L.W., Zhou, X.J., Burke, S., Wu, X.L., Prior, R.L., Li, L., 2010. The purple cauliflower arises from activation of a MYB transcription factor. Plant Physiol. 154, 1470–1480. Christie, P.J., Alfenito, M.R., Walbot, V., 1994. Impact of low-temperature stress on general phenylpropanoid and anthocyanin pathways: enhancement of transcript abundance and anthocyanin pigmentation in maize seedlings. Planta 194, 541–549. Chu, H., Jeong, J.C., Kim, W.J., Chung, D.M., Jeon, H.K., Ahn, Y.O., Kim, S.H., Lee, H.S., Kwak, S.S., Kim, Y., 2013. Expression of the sweetpotato R2R3-type IbMYB1a gene induces anthocyanin accumulation in Arabidopsis. Physiol. Plant. 148, 189–199. Espley, R.V., Hellens, R.P., Putterill, J., Stevenson, D.E., Kutty-Amma, S., Allan, A.C., 2007. Red colouration in apple fruit is due to the activity of the MYB transcription factor, MdMYB10. Plant J. 49, 414–427. Geekiyanage, S., Takase, T., Ogura, Y., Kiyosue, T., 2007. Anthocyanin production by over-expression of grape transcription factor gene VlmybA2 in transgenic tobacco and Arabidopsis. Plant Biotechnol. Rep. 1, 11–18. Huang, Y.J., Song, S., Allan, A.C., Liu, X.F., Yin, X.R., Xu, C.J., Chen, K.S., 2013. Differential activation of anthocyanin biosynthesis in Arabidopsis and tobacco over-expressing an R2R3 MYB from Chinese bayberry. Plant Cell Tissue Organ Cult. 113, 491–499. Kukula, K.L., Jafra, S., Oszmianski, J., Szopa, J., 2005. Ectopic expression of anthocyanin 5-O-glucosyltransferase in potato tuber causes increased resistance to bacteria. J. Agric. Food Chem. 53, 272–281. Lim, S.H., Song, J.H., Kim, D.H., Kim, J.K., Lee, J.Y., Kim, Y.M., Ha, S.H., 2016. Activation of anthocyanin biosynthesis by expression of the radish R2R3-MYB transcription factor gene RsMYB1. Plant Cell Rep. 35 (3), 641–653.
65
Mallona, I., Lischewski, S., Weiss, J., Hause, B., Cortines, M.E., 2010. Validation of reference genes for quantitative real-time PCR during leaf and flower development in Petunia hybrida. BMC Plant Biol. 10, 4. Naing, A.H., Ai, T.N., Jeon, S.M., Park, K.L., Lim, K.B., Kim, C.K., 2015. Expression of RsMYB1 in chrysanthemum regulates key anthocyanin biosynthetic genes. Electron. J. Biotechnol. 18, 359–364. Oh, J.E., Kim, Y.H., Kim, J.H., Kwon, Y.R., Lee, H., 2011. Enhanced level of anthocyanin leads to increased salt tolerance in arabidopsisPAP1-D plants upon sucrose treatment. J. Korean Soc. Appl. Biol. Chem. 54, 79–88. Park, N.L., Xu, H., Li, X., Jang, I.H., Park, S.H., Ahn, G.H., Lim, Y.P., Kim, S.J., Park, S.U., 2011. Anthocyanin accumulation and expression of anthocyanin biosynthetic genes in radish (Raphanus sativus). J. Agric. Food Chem. 59, 6034–6039. Pattanaik, S., Kong, Q., Zaitlin, D., Werkman, J., Xie, C., Patra, B., Yuan, L., 2010. Isolation and functional characterization of a floral tissue-specific R2R3 MYB regulator from tobacco. Planta 231, 1061–1076. Piazza, P., Procissi, A., Jenkins, G.I., Tonelli, C., 2002. Members of the c1/pl1 regulatory gene family mediate the response of maize aleurone and mesocotyl to different light qualities and cytokinins. Plant Physiol. 128, 1077–1086. Quattrocchio, F., Wing, J.F., Leppen, H.T.C., Mol, J.N.M., Koes, R.E., 1993. Regulatory genes controlling anthocyanin pigmentation are functionally conserved among plant species and have distinct sets of target genes. Plant Cell 5, 1497–1512. de Vetten, N., Quattrocchio, F., Mol, J., Koes, R., 1997. The an11 locus controlling flower pigmentation in petunia encodes a novel WD-repeat protein conserved in yeast, plants, and animals. Genes Dev. 11, 1422–1434. Quattrocchio, F., Wing, J.F., van der Woude, K., Mol, J.N.M., Koes, R., 1998. Analysis of bHLH and MYB domain proteins: species-specific regulatory differences are caused by divergent evolution of target anthocyanin genes. Plant J. 13, 475–488. Quattrocchio, F., Wing, J., van der Woude, K., Souer, E., de Vetten, N., Mol, J., Koes, R., 1999. Molecular analysis of the anthocyanin2 gene of petunia and its role in the evolution of flower color. Plant Cell 11, 1433–1444. Sarma, A.D., Sharma, R., 1999. Anthocyanin-DNA copigmentation complex: mutual protection against oxidative damage. Phytochemistry 52, 1313–1318. Schwinn, K., Venail, J., Shang, Y., Mackay, S., Alm, V., Butelli, E., Oyama, R., Bailey, P., Davies, K., Martin, C., 2006. A small family of MYB-regulatory genes controls floral pigmentation intensity and patterning in the genus Antirrhinum. Plant Cell 18, 831–851. Spelt, C., Quattrocchio, F., Mol, J.N.M., Koes, R., 2000. Anthocyanin1 of petunia encodes a basic helix-loop-helix protein that directly activates transcription of structural anthocyanin genes. Plant Cell 12, 1619–1631. Tohge, T., Matsui, K., Ohme-Takagi, M., Yamazaki, M., Saito, K., 2005. Enhanced radical scavenging activity of genetically modified Arabidopsis seeds. Biotechnol. Lett. 27, 297–303. van Tunen, A.J., Mol, J.N.M., 1991. Control of flavonoids synthesis and manipulation of flower color. Plant Biotechnol. 2, 94–125. Xie, D.Y., Sharma, S.B., Wright, E., Wang, Z.Y., Dixon, R.A., 2006. Metabolic engineering of proanthocyanidins through co-expression of anthocyanidin reductase and the PAP1 MYB transcription factor. Plant J. 45, 895–907. Zuluaga, D.L., Gonzali, S., Loreti, E., Pucciariello, C., Degl’Innocenti, E., Guidi, L., Alpi, A., Perata, P., 2008. Arabidopsis thaliana MYB75/PAP1 transcription factor induces anthocyanin production in transgenic tomato plants. Funct. Plant Biol. 35, 606–618.
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Expression of RsMYB1 in Petunia enhances anthocyanin production in vegetative and floral tissues Trinh Ngoc Ai a,b , Aung Htay Naing a,1 , Muthukrishnan Arun a , Su Min Jeon c , Chang Kil Kim a,∗ a
Department of Horticultural Science, Kyungpook National University, Daegu, 41566, Korea School of Agriculture and Aquaculture, Tra Vinh University, Tra Vinh, Viet Nam c National Institute of Biological Resources, Incheon, 22689, South Korea b
a r t i c l e
i n f o
Article history: Received 2 September 2016 Received in revised form 7 October 2016 Accepted 17 November 2016 Keywords: Agrobacterium tumefaciens Anthocyanin Ornamental plants Transcription factor
a b s t r a c t Anthocyanin production enhanced by heterologous expression of R2R3 MYB transcription factors has been studied. However, little is known about validated information on the ability of RsMYB (an MYB gene from radish) to enhance anthocyanin production in a heterologous system. In the present study, heterologous expression of RsMYB1 in Petunia hybrida ‘Mirage Rose’ enhanced anthocyanin production in vegetative and floral tissues such as leaves, stems, roots, and petals by transcriptional activation of anthocyanin biosynthetic genes and endogenous antocyanin regulatory genes. Line PM6 expressed higher transcript levels of RsMYB1 than line PM2 and regulated transcript levels of the investigated genes largely than line PM2, whereas those regulated in wild type (WT) plants were the lowest. In addition, transcript levels of the genes detected using qualitative real-time polymerase chain reaction were found to be higher in petals, followed by leaves, stems and roots. Taken together, our results suggest that RsMYB1 enhances anthocyanin production in vegetative and floral tissues of this cultivar, thus, we expect that heterologous expression of RsMYB1 would help to modify flower color of other ornamental plants as well. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Anthocyanins, which are synthesized through the flavonoid biosynthetic pathway, are the most diverse group of plant pigments that impart colors ranging from red to violet and blue (van Tunen and Mol, 1991). Enhancement of anthocyanin accumulation in ornamental plants could result in the development of novel flower colors for commercial markets. Recently, a large number of ornamental plants with novel flower colors have been available in global flower markets. In plants, anthocyanins aid in ensuring protection against solar exposure and ultraviolet radiation and also act as potential antioxidants that may scavenge reactive oxygen species to display tolerance against cold temperatures (Christie et al., 1994; Sarma and Sharma 1999), plant pathogens (Kukula et al., 2005), salt (Tohge et al., 2005; Oh et al., 2011), and drought stress (Castellarin et al., 2007).
∗ Corresponding author at: Department of Horticultural Science, Kyungpook National University, Daegu, 41566, Korea. E-mail addresses: [email protected] (A.H. Naing), [email protected] (C.K. Kim). 1 Equally contributed to first author. http://dx.doi.org/10.1016/j.scienta.2016.11.016 0304-4238/© 2016 Elsevier B.V. All rights reserved.
The role of R2R3 MYB transcription factors in the enhancement of anthocyanin pigmentation has been confirmed by characterization of the anthocyanin biosynthetic pathway in several plant species. Heterologous expression of R2R3 MYB transcription factors is considered vital in inducing spatial and temporal anthocyanin production in several plant species. Of the transcription factors, the MYB transcription factor (PAP1), which is mostly known as the anthocyanin regulatory gene, has been used in heterologous systems to enhance anthocyanin production in several plant species, including Arabidopsis (Borevitz et al., 2000), tomato (Zuluaga et al., 2008), tobacco (Xie et al., 2006), and petunia (Ben Zvi et al., 2008). Recently, heterologous expression of PAP1 in rose exerted transcriptional activation of anthocyanin biosynthetic genes and increased accumulation of anthocyanins (Ben Zvi et al., 2012). Park et al. (2011) reported that RsMYB1 shared high sequence similarity to the MYB transcription factors (PAP1), and which expressed in red radish was higher than in common white radish. In addition, over-expression of RsMYB1 in tobacco and Arabidopsis enhanced anthocyanin production by regulating transcription of anthocyanin biosynthetic and endogenous anthocyanin regulatory genes (Lim et al., 2016). According to the results of our previous study, heterologous expression of RsMYB1 could enhance key anthocyanin biosynthetic genes in the chrysanthemum
T.N. Ai et al. / Scientia Horticulturae 214 (2017) 58–65
cultivar Shinma (Naing et al., 2015), although enhanced anthocyanin accumulation was not observed. Petunia (Petunia × hybrida) is a popular ornamental bedding plant and is widely grown throughout the world, in addition, it is considered model crop to be investigated for the functional roles of metabolically engineered genes. Thus, we introduced RsMYB1 in Petunia hybrida ‘Mirage Rose’ by using Agrobacterium-mediated transformation to determine whether the transcription factor could enhance transcript levels of anthocyanin biosynthetic and endogenous regulatory genes that can modify flower color of the cultivar. In addition, we investigated anthocyanin regulation of RsMYB1 in different vegetative and floral tissues of the transgenic Petunia. 2. Materials and methods 2.1. Plant material Leaves of 5-week-old P. hybrida ‘Mirage Rose’ grown in a greenhouse were collected and sterilized with 0.1% sodium hypochlorite (Yuhan Co, Ltd., Seoul, South Korea) solution containing 0.01% Tween 20 (Duchefa, Haarlem, The Netherlands) for 10 min. The surface-sterilized leaves were then rinsed several times with sterile distilled water, and leaf explants that were 0.5–0.75 cm in length (mid-rib region) were excised. 2.2. Agrobacterium strains and plasmid construction Agrobacterium tumefaciens strains C58C1 harboring the plasmid pB7WG2D were used in this study. The plasmid contains the transcription factor (TF) RsMYB1 isolated from Raphanus sativus ‘Bordeaux’ (Lim et al., 2016), which was under the control of the cauliflower mosaic virus 35S promoter and terminator (Supplementary Fig. 1). The bar gene, which confers phosphinothricin (PPT) resistance, was used as the selection marker. 2.3. Genetic transformation The leaf explants (about 300 explants) were initially precultured on regeneration medium (MS medium supplemented with 4.44 M N6 -benzyladenine and 2.47 M indole-3-butyric acid) and incubated under total darkness for 2 days at 25 ± 2 ◦ C. The pre-cultured explants were then transferred to Agrobacterium suspension adjusted to an OD600 of 1 and incubated at room temperature for 30 min. Then, the explants were blot-dried on a sterile filter paper, placed horizontally in MS medium containing 200 M acetosyringone (pH 5.4), and incubated for 2 days under darkness. The explants were then transferred to the regeneration medium containing 250 mg l−1 Clavamox and 0.5 mg l−1 PPT and sub-cultured 3 times at 10-day intervals. Shoots that showed resistance to PPT and visible anthocyanin pigmentation were excised and transferred to hormone-free MS medium supplemented with 250 mg l−1 Clavamox and 1 mg l−1 PPT. After 20 days of culture, the shoots were further transferred to hormone-free MS medium containing a higher concentration of PPT (1.5 mg l−1 ), and incubated for 21 days. Adventitious roots that developed from the shoots were
completely removed and washed thoroughly with sterile distilled water before being transferred to plastic pots containing peatbased soil. The plantlets were initially grown in a growth chamber (25 ± 2 ◦ C and 85% relative humidity) for 2–3 days. The plantlets were then transferred to the plastic pots, containing peat-based soil and grown in the greenhouse under controlled conditions.
2.4. Detection of the presence of RsMYB1 by using polymerase chain reaction (PCR) Total genomic DNA from the leaves of PPT-resistant and wild type (WT) plants was isolated using the HiYieldTM Genomic DNA Mini Kit (plant), according to the manufacturer’s instructions (Real Biotech Corporation, Taipei, Taiwan). The plasmid pB7WG2DRsMYB1 was used as the positive control. Polymerase chain reaction (PCR) was performed using primers, and the PCR conditions have been described in Table 1. The amplified products were analyzed using electrophoresis in 1% (w/v) agarose gels.
2.5. Quantitative realtime – PCR Of the PCR-positive transgenic plants, lines (PM1–PM6) showing anthocyanin pigmentation in vegetative tissues were selected by visual screening and analyzed to detect the transcript levels of RsMYB1 by using quantitative real-time (qRT)-PCR. Total RNA was isolated from leaves, stems, and roots of the lines and WT plantlets by using the RNAqueous Kit (Ambion Inc., Austin, USA). Reverse transcription was performed according to the manufacturer’s instructions (ReverTra Ace-a´ı, Toyobo, Japan) by using 1 g of total RNA and oligo dT20 primer. Tubulin (SGN-U207876) was used as the internal control [16]. Transcript levels of RsMYB1 were analyzed using the Step One Plus Real-Time PCR system, USA. Realtime- PCR was performed using a 20-l reaction volume containing 0.5 M of each primer and Power SYBR® Green PCR Master Mix (Woolston Warrington, UK). The primers and PCR conditions for the detection of RsMYB1 transcripts are listed in Table 1. Lines showing the highest (PM6) and lowest (PM2) RsMYB1 transcripts along with WT plantlets were further selected to determine the expression levels of biosynthetic and endogenous regulatory genes contained in the vegetative (leaf, stem, and root) involved in anthocyanin biosynthetic pathway. Primers of the tested genes were designed based on the Petunia genomic sequences in GenBank: PAL, AY705976; CHS, AF233638; CHI, AF233637; F3H, X70786; DFR, KC140107; ANS, AB910267, AN1, AN2, and AN4 (Table 2). As mentioned above, Tubulin (SGN-U207876) was used as the internal control (Mallona et al., 2010), and qRTPCR conditions are the same as those listed in Table 1. To determine the expression levels of RsMYB1, biosynthetic genes, and regulatory genes in floral tissues, RNA was isolated from petal and transcriptional analysis of the genes were performed as done in vegetative tissues.
Table 1 Primer and PCR conditions used for detection of RsMYB1 gene. Genes
Primer sequences
Condition
RsMYB1 (PCR)
FP: 5 -ATG GAG GGT TCG TCC AAA GG-3 RP: 5 -GAA ACA CTA ATC AAA TTA CAC AGT CTC TCC-3 FP: 5 -TCT TTG GTT TGT CGT TCA GTA A-3 RP: 5 -ACA CAC GGG TTC GTG CAA-3 FP: 5 -TGGAAACTCAACCTCCATCCA-3 RP: 5 -TTTCGTCCATTCCTTCACCTG-3
95 ◦ C for 2 min, followed by 25 cycles of 95 ◦ C for 20 s, 60 ◦ C for 40 s, 72 ◦ C for 1 min and 72 ◦ C for 5 min ◦ ◦ ◦ 95 ◦ C (10 min)-[95 C (30 s)- 60 C (30 s)] followed by 40 cycles − 95 C (15 s)◦ ◦ 60 C (30 s)- 95 C (15 s) ◦ ◦ ◦ ◦ 95 C (10 min)-[95 C (30 s)- 60 C (30 s)] followed by 40 cycles − 95 C (15 s)◦ ◦ 60 C (30 s)- 95 C (15 s)
RsMYB1(qRT-PCR) TUB* (qRT-PCR) *
TUB tubulin gene (Mallona et al., 2010).
59
60
T.N. Ai et al. / Scientia Horticulturae 214 (2017) 58–65
Table 2 List of primers used in quantitative real-time polymerase chain reaction (qRT-PCR) analysis. Gene
Gene accession no.
Primers sequences Forward primer
Reverse primer
PAL CHS CHI F3H DFR ANS AN1 AN2 AN4 TUB*
AY705976 AF233638 AF233637 X70786 KC140107 HQ428109.1 AF260918 AF146702 HQ428105 SGN-U207876
5 -AGGGGGTGAGACGCTAACAGT-3 5 -GAGGCACGGTTCTTCGGTTA-3 5 -TCTCCTGCGGCAAAGTGTAA-3 5 -AAGTGCCCCCAACCAGAAC-3 5 -CTACCCGAAGTGCTGAAGACAA-3 5 - GGGGAAGGAAAGTGGCATCA −3 5 -AAGAATTCATGCAGCTGCAAACCATG-3 5 -AGCAGCAGCAGTCAATCTCTTTT-3 5 -GGGAAGGAAAGTGGCATCAA-3 5 -TGGAAACTCAACCTCCATCCA-3
5 -CGTCCGTGCCCGATTG-3 5 -GTGACCGCGGTGATTTCTG-3 5 -TCTCGGTCTCCGGTTTTCC-3 5 -TCAGTGCGCTGACATCTGTATG-3 5 -TGATTTGCAACTGGTGCATTC-3 5 - TGGAGAGGAGCCAAGTCTCA −3 5 -ATCTCGAGGGACAAAGTGAGAGATC-3 5 - AGAGCATCCGAGAGCGTTTC −3 5 -GTTCCTTATAGAGGGTTAGCCAGAGA-3 5 -TTTCGTCCATTCCTTCACCTG-3
PAL- phenylalanine ammonia-lyase; CHS- chalcone synthase; CHI- chalcone isomerase; F3H- flavanone-3-hydroxylase; DFR- dihydroflavonol 4-reductase; ANS- anthocyanidin synthase; AN1- anthocyanin1; AN2- anthocyanin2; AN4- anthocyanin4; * TUB: tubulin gene (Mallona et al., 2010). PCR conditions: 95 ◦ C (10 min)–95 ◦ C (30 s)–60 ◦ C (30 s)–95 ◦ C (15 s)–60 ◦ C (30 s)–95 ◦ C (15 s).
2.6. Analysis of anthocyanin content Total anthocyanin content in vegetative (leaves, stems, and roots) and floral (petal) tissues of the lines (PM2 and PM6) were determined and compared with WT counterparts. About 0.5 g (fresh weight) of each tissue was ground using liquid nitrogen and transferred to 15-ml dry Falcon tubes. Anthocyanins from the fine powder were extracted by adding 5 ml of the extraction solution (99:1 v/v methanol/HCl; Sigma, St. Louis, USA), followed by 24 h of incubation at 4 ◦ C. The content was then centrifuged at 13000 rpm for 20 min at 4 ◦ C, and the supernatant was collected in a fresh tube. Total anthocyanin content was determined according to the method reported by Chu et al. (2013). 2.7. Experimental conditions and statistical analysis All the cultures were incubated at 25 ± 2 ◦ C under a 16-h photoperiod and an intensity of 50 mol m−2 s−1 . Data were statistically analyzed using SAS version 9.4. Data are presented as mean ± standard error values. The significance was determined at 5% level by using Duncan’s multiple range test. Each analysis was carried out using at least three biological samples. 3. Results The co-cultivated leaf explants cultured on the shoot regeneration medium containing 250 mg l−1 Clavamox and 0.5 mg l−1 PPT initiated shoot buds within 10 days of the initial culture. Thirtyday-old shoots showing resistance to 0.5 mg l−1 PPT and purple color survived on hormone-free MS medium containing 250 mg l−1 Clavamox and 1 mg l−1 PPT. Most of the shoots that survived developed roots in the same medium containing a higher concentration of PPT (1.5 mg l−1 ). The rooted plantlets survived well when transferred to plastic pots containing peat-based soil under controlled greenhouse conditions. The presence of RsMYB1 in 1-month-old greenhouse-grown putative transformants that showed resistance to 1.5 mg l−1 PPT was detected using PCR, amplified products of expected size (700 bp) could be detected in the genomic DNA of all the tested plants (Fig. 1, lanes PM1–6), which was the same as that when plasmid pB7WG2D-RsMYB1 used as the positive control (Fig. 1, lane P) and was not observed in WT plants (Fig. 1, lane WT). Transgenic plants carrying RsMYB1 exhibited anthocyanin accumulation in vegetative tissues; however, accumulation due to RsMYB1 was different among the transgenic plants (data not shown). In addition, in some lines, accumulation seemed to be tissue-specific because contents that accumulated in the leaves, stems, and roots were found to be seemingly different (data not shown). To reveal the reasons why the different accumulation
patterns were observed in the transgenic lines, transcript levels of RsMYB1 were detected using qRT-PCR. Results presented in Fig. 2 (a–c) indicated that the transcript level significantly varied among the independent lines (PM1–PM6). Moreover, its different expression levels corresponding to different vegetative tissues were clearly observed in some transgenic lines. In general, the expression levels were the highest in the leaves (Fig. 2 a), followed by stems (Fig. 2 b) and roots (Fig. 2 c). Of the tested lines, transcript level of RsMYB1 in vegetative tissues (leaves, stems, and roots of line PM-6 was significantly higher than that in line PM-2, wherein visual anthocyanin accumulation was also observed to be more purple in line PM-6 than in line PM-2 (Fig. 3A–C). Therefore, we were interested in comparing the transcript levels of biosynthetic and endogenous anthocyanin regulatory genes in the vegetative tissues of the two different lines regulated by RsMYB1, along with WT plantlets. Expectedly, transcript levels of the biosynthetic (PAL, CHS, CHI, F3H, DFR, and ANS) and the endogenous regulatory (AN1, AN2, and AN4) genes detected in the vegetative tissues were significantly higher in PM6 than in PM2, while those in WT were the lowest (Fig. 4). In the both lines, the detected genes were significantly higher at transcriptional levels in the leaves than in the stems and roots. In general, transcript levels of ANS, AN1, and AN4 were highly elevated in the leaves, stems, and roots of PM6. According to the results of qRT-PCR analysis of transcript levels of RsMYB1 and anthocyanin biosynthetic and endogenous
Fig. 1. Detection of RsMYB1 in the transgenic lines by PCR, (a) Lane L, 100 bp plus DNA ladder; Lane P, pB7WG2D-RsMYB1 as the positive control; Lane WT, wild type (WT) plant genomic DNA as the negative control; Lanes PM1–6, the different transgenic lines showing RsMYB1 (700 bp).
T.N. Ai et al. / Scientia Horticulturae 214 (2017) 58–65
61
Fig. 2. Assessment of expression levels of RsMYB1 in (a) leaves, (b) stems, and (c) roots of the six independent lines by qRT-PCR analysis. The bars represent expression levels of genes relative to the level of tubulin (±) with standard error (n = 3).
regulatory genes, transcript levels of the detected genes in the vegetative tissues (leaves, stems, and roots) were higher in PM6 than in PM2, which were associated with the anthocyanin contents detected in the whole plant because the contents accumulated in different vegetative parts were higher in PM6 than in PM2, however, the lowest contents were observed in WT plants (Fig. 3D). Considering the effect of RsMYB1 on anthocyanin accumulation in flowers of the two transgenic lines relative to that of WT, there was a large variation in flower color phenotype between the transgenic lines and WT plants, resulting in higher anthocyanin accumulation in petals of the transgenic lines than WT plants (Fig. 5A). In addition, there was little variations in petal color between the two transgenic lines as well, in which the flower color of PM6 line had slightly more red color than that of PM2. When expression level of RsMYB1 was analyzed by qRT-PCR, it was observed that its transcript levels in the floral tissues of PM6 were higher than in those of PM2 lines (Fig. 5B). According to analysis of anthocyanin contents in the floral tissue (petal), the contents were found to be the highest in PM6 followed by PM2 and WT (Fig. 5C), which were associated with visual accumulation in the plants.
Data in Fig. 6 also indicate that the biosynthetic genes (PAL, CHS, CHI, F3H, DFR, and ANS) and the regulatory genes (AN1, AN2, and AN4) expressed in the floral tissues of PM6 were higher than those in PM2, followed by WT were. Specifically, in petal of PM6, transcript levels of PAL, CHS, F3H, and AN4 were highly elevated, however, similar elevations were observed in only CHS and AN4 of PM2. In term of DFR, there was little variation in its expression between WT and PM2, but its significant high transcript level was observed in PM6. 4. Discussion In this study, we showed that heterologous expression of RsMYB1, a member of the R2R3MYB type gene family, in Petunia leads to enhancement of anthocyanin production in vegetative tissues (leaves, stems, and roots) and floral tissue (petal). Such enhancement resulted in a distinguishable phenotype in the transgenic plants when compared with the WT plants. The results of the present study were similar to those of previous studies on other crops; An et al. (2015) reported that expression of IbMYB1a (MYB) enhanced anthocyanin pigmentation in leaves, stems, roots,
Fig. 3. Comparison of visual anthocyanin accumulation in vegetative tissues (A; leaves, B; stem, and C; root) and D; their total anthocyanin contents of WT and the transgenic lines (PM2 and PM6) expressing RsMYB1. The bars represent mean values of samples tested in triplicate (±) with standard error.
62
T.N. Ai et al. / Scientia Horticulturae 214 (2017) 58–65
Fig. 4. Assessment of transcript levels of anthocyanin biosynthetic and regulatory genes in leaves, stems, and roots of the lines (PM2 and PM6) expressing RsMYB1. The bars represent expression levels of genes relative to the level of tubulin (±) with standard error (n = 3).
and flowers of transformed tobacco plants. Pattanaik et al. (2010) showed that ectopic expression of NtAn2 (MYB) improved anthocyanin production in the whole plant of tobacco and Arabidopsis. Geekiyanage et al. (2007) reported that overexpression of VlmybA2 (MVB) induced anthocyanin pigmentation in the whole plant of transformed tobacco and Arabidopsis. Recently, Lim et al. (2016) also claimed that transient expression of the same gene, RsMYB1, in tobacco and its overexpression in Arabidopsis showed enhanced anthocyanin production in vegetative and floral tissues. In this study, we found that expression levels of RsMYB1 differed in the transgenic lines (PM1–6), wherein the line PM6 showed the highest transcript level while the line PM2 exhibited the lowest. In addition, transcript levels of RsMYB1 expressed in the vegetative (leaves, stems, and roots) and the floral (petal) were different. In the both lines, particular in PM6, transcript level of RsMYB1 was the highest in leaves, followed by petal, stems and roots, thus, visual anthocyanin accumulations in leaves and petals were found to be stronger than other tissues. Different expression levels of RsMYB1 in vegetative and floral tissues of the lines appeared to be attributable to tissue-specific expression of RsMYB1. Similar expression of NtAn2 (MYB) has been reported in transgenic tobacco, in which NtAn2 was highly expressed in flowers but could not be detected in leaves (Pattanaik et al., 2010). Lim et al. (2016) also reported that RsMYB1 expressed in leaves was higher than in roots of red radish. According to the qRT-PCR results, in the vegetative tissues, high transcript levels of RsMYB1 regulated high expression levels of the anthocyanin biosynthetic genes (PAL, CHS, CHI, F3H, DFR, and
ANS) involved in the anthocyanin synthetic pathway because the detected genes were expressed largely in line PM6 than in line PM2. Similarly, they were generally expressed largely in the leaves than in the stems followed by roots in the both lines. More obviously, the lowest detected gene expression was observed in WT plants, whereas ANS was not expressed at all while the other genes were relatively lowered in expression. This study confirmed the finding of Lim et al. (2016), who reported that transcript levels of all biosynthetic genes expressed in transgenic Arabidopsis expressing RsMYB1 with strong anthocyanin accumulation were higher than that with moderate anthocyanin accumulation. Moreover, in all vegetative tissues of the lines, expression of the late biosynthetic gene ANS was the highest, thus enhanced expression of ANS appeared to be important for the production of anthocyanins in transgenic Petunia. Lim et al. (2016) also claimed that RsMYB1 strongly upregulated AtANS and induced strong anthocyanin accumulation in transgenic Arabidopsis plants. In addition, they further claimed that RsMYB1 could regulate endogenous regulatory genes besides the biosynthetic genes, which was also confirmed by this study, resulting in up-regulation of endogenous anthocyanin regulatory genes such as AN1, AN2, and AN4, which are essential for anthocyanin production in Petunia. Hence, in this study, enhancement of anthocyanin in the transgenic lines could also be due to upregulation of the anthocyanin regulatory genes because interaction of AN1 (bHLH transcription factor) with AN2 (MYB transcription factor) had shown to activate anthocyanin biosynthesis in Petunia (Spelt et al., 2000). Quattrocchio et al. (1993) also described AN1 as
T.N. Ai et al. / Scientia Horticulturae 214 (2017) 58–65
63
Fig. 5. Comparisons of A) flower phenotype, B) transcript levels of RsMYB1, and C) anthocyanin contents in wild type (WT) and the lines (PM2 and PM6) expressing RsMYB1.The bars represent mean values of samples tested in triplicate (±) with standard error.
essential regulator of anthocynin synthesis throughout the plant. Moreover, correlations between low levels of AN1 transcripts and weak pigmentation phenotype had been reported (Bradley et al., 1998; Albert et al., 2009). Our study confirmed findings of the previous reports by resulting in stronger anthocyanin accumulation in PM6 with high transcript levels of the endogenous regulatory genes followed by in PM2 with moderate levels and in WT with lowest transcript levels of the genes. Flowers of RsMYB1-transgenic Petunia showed more reddish color than those of WT plants. Lim et al. (2016) observed that over-expression of RsMYB1 in Arabidopsis distinctly showed reddish flowers and stigmas, compared with WT plants. In contrast to Arabidopsis, no red color was observed in the stigma of Petunia, but which was noticed in the stamen (data not shown). However, Lim et al. (2016) did not examine transcript levels of the biosynthetic and endogenous regulatory genes in floral tissues induced by RsMYB1. In this study, we revealed why different pigmentation patterns were occurred in floral tissues by determining expression levels of the biosynthetic and regulatory genes between transgenic and WT flowers, in which transcript levels of the detected genes expressed in floral tissues were generally higher in PM6 followed by PM2 and WT plant. Specifically, expression of early biosynthetic (PAL, CHS, and F3H) and late biosynthetic (DFR and ANS) genes are highly elevated in PM6 relative to those of WT, while except CHS and ANS similar elevations were not noticed in PM2. In addition, high transcript levels of the endogenous regulatory genes (AN1, AN2, and AN4) induced by RsMYB1 were observed, but
which were not highly different at transcription levels in the both lines, compared with those biosynthetic genes. Hence, although the biosynthetic genes are differently expressed in the both lines, slightly different pigmentations in the petals are likely due to upregulations of AN1, AN2 and AN4 rather than the biosynthetic genes. Specifically, occurrence of slightly more reddish color in petal of PM6 than in that of PM2 might also be due to higher transcript levels of AN1, AN2 and AN4 expressed in PM6. In previous reports, influence of AN2 and AN4 in anthocyanin pigmentation in petal and flower tube of Petunia was observed (de Vetten et al., 1997; Quattrocchio et al., 1998, 1999; Spelt et al., 2000). Albert et al. (2011) also recently reported that AN2 and AN4 displays anthocyanin venation patterning of the flower tube of Mitchell petunia. In addition, the similar influences of AN2 and AN4 had been reported in Antirrhinum (Schwinn et al., 2006) and maize as well (Piazza et al., 2002). Recently, Boase et al. (2015) claimed high influence of AN1 in pigmentation of Petunia flower. Although overexpression of MYB transcription factors in several plant species had been shown to enhance anthocyanin production in vegetative and floral tissues by up-regulation of the biosynthetic and regulatory genes (Chiu et al., 2010), there had been some studies reporting about resultant of very weak anthocyanin production in Zea mays (maize), tomato, apple, and Chinese bayberry by single expression of MYB transcription factor alone (Bovy et al., 2002; Espley et al., 2007; Huang et al., 2013). In this study, these results proved that single expression of RsMYB1 without bHLH transcription factor in Petunia enhanced anthocyanin
64
T.N. Ai et al. / Scientia Horticulturae 214 (2017) 58–65
Fig. 6. Comparisons of transcript levels of anthocyanin biosynthetic and regulatory genes in wild type (WT) and the lines (PM2 and PM6) expressing RsMYB1.
accumulation in the whole plant including floral tissues by upregulating the biosynthetic and endogenous regulatory genes involved in the anthocyanin biosynthetic pathway. Tohge et al. (2005) and Oh et al. (2011) observed that plants transformed with anthocyanin-regulating transcription factors showed increased tolerance to abiotic stress when compared with the WT. Lim et al. (2016) also claimed that enhancement of anthocyanin due to heterologous expression of RsMYB1 improves antioxidant activities that can scavenge reactive oxygen species (ROS) induced during abiotic stress period. Based on those studies; we expect that heterologous expression of RsMYB1 in Petunia plants not only enhances anthocyanin content in the whole plant but also will be resistant to abiotic stresses. In addition, another advantage of RsMYB1 is that it can be used as a visible selection marker to select transformants without the need for antibiotic- or herbicide-resistant genes or PCR. 5. Conclusion We revealed that heterologous expression of RsMYB1 enhanced the transcriptional activation of biosynthetic and regulatory genes, resulting in enhanced anthocyanin contents in vegetative and floral tissues of the transgenic Petunia plants, thus, we can suggest that heterologous expression of RsMYB1 would help to modify flower color of other ornamental plants. In addition, it can be expected that enhancement of anthocyanin pigmentation would also help
in resistance against abiotic stresses, such as salt, drought, and temperature. Acknowledgements This work was supported by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries (IPET) through Agri-Bio industry Technology Development Program, funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA) (315002-5). We wish to thank Dr. Sun-Hyung Lim (RDA, Korea) for kindly providing the plasmid. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.scienta.2016. 11.016. References Albert, N.W., Lewis, D.H., Zhang, H., Irving, L.J., Jameson, P.E., Davies, K.M., 2009. Light-induced vegetative anthocyanin pigmentation in Petunia. J. Exp. Bot. 60, 2191–2202. Albert, N.W., Lewis, D.H., Zhang, H., Schwinn, K.E., Jameson, P.E., Davies, K.M., 2011. Members of an R2R3-MYB transcription factor family in Petunia are developmentally and environmentally regulated to control complex floral and vegetative pigmentation patterning. Plant J. 65, 771–784.
T.N. Ai et al. / Scientia Horticulturae 214 (2017) 58–65 An, C.H., Lee, K.W., Lee, S.H., Jeong, Y.J., Woo, S.G., Chun, H., Park, Y.I., Kwak, S.S., Kim, C.Y., 2015. Heterologous expression of IbMYB1a by different promoters exhibits different patterns of anthocyanin accumulation in tobacco. Plant Physiol. Biochem. 89, 1–10. Ben Zvi, M.M., Negre-Zakharov, F., Masci, T., Ovadis, M., Shklarman, E., 2008. Interlinking showy traits: co-engineering of scent and colour biosynthesis in flowers. Plant Biotechnol. J. 6, 403–415. Ben Zvi, M.M., Shklarman, E., Masci, T., Kalev, H., Debener, T., 2012. PAP1 transcription factor enhances production of phenylpropanoid and terpenoid scent compounds in rose flowers. New Phytol. 194, 430–439. Boase, M.R., Brendolise, C., Wang, L., Ngo, H., Espley, R.V., Hellens, R.V., Schwinn, K.E., Davies, K.M., Albert, N.W., 2015. Failure to launch: the self-regulating Md-MYB10R6 gene from apple is active in flowers but not leaves of Petunia. Plant Cell Rep. 34, 1817–1823, 2015. Borevitz, J.O., Xia, Y., Blount, J., Dixon, R.A., Lamb, C., 2000. Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. Plant Cell 12, 2383–2394. Bovy, A., de Vos, R., Kemper, M., Schijlen, E., Almenar Pertejo, M., Muir, S., Collins, G., Robinson, S., Verhoeyen, M., Hughes, S., Santos- Buelga, C., van Tuinen, A., 2002. High-flavonol tomatoes resulting from the heterologous expression of the maize transcription factor genes LC and C1. Plant Cell 14, 2509–2526. Bradley, J.M., Davies, K.M., Deroles, S.C., Bloor, S.J., Lewis, D.H., 1998. The maize Lc regulatory gene up-regulates the flavonoid biosynthetic pathway of Petunia. Plant J. 13, 381–392. Castellarin, S.D., Pfeiffer, A., Sivilotti, P., Degan, M., Peterlunger, E., Gaspero, G.D., 2007. Transcriptional regulation of anthocyanin biosynthesis in ripening fruits of grapevine under seasonal water deficit. Plant Cell Environ. 30, 1381–1399. Chiu, L.W., Zhou, X.J., Burke, S., Wu, X.L., Prior, R.L., Li, L., 2010. The purple cauliflower arises from activation of a MYB transcription factor. Plant Physiol. 154, 1470–1480. Christie, P.J., Alfenito, M.R., Walbot, V., 1994. Impact of low-temperature stress on general phenylpropanoid and anthocyanin pathways: enhancement of transcript abundance and anthocyanin pigmentation in maize seedlings. Planta 194, 541–549. Chu, H., Jeong, J.C., Kim, W.J., Chung, D.M., Jeon, H.K., Ahn, Y.O., Kim, S.H., Lee, H.S., Kwak, S.S., Kim, Y., 2013. Expression of the sweetpotato R2R3-type IbMYB1a gene induces anthocyanin accumulation in Arabidopsis. Physiol. Plant. 148, 189–199. Espley, R.V., Hellens, R.P., Putterill, J., Stevenson, D.E., Kutty-Amma, S., Allan, A.C., 2007. Red colouration in apple fruit is due to the activity of the MYB transcription factor, MdMYB10. Plant J. 49, 414–427. Geekiyanage, S., Takase, T., Ogura, Y., Kiyosue, T., 2007. Anthocyanin production by over-expression of grape transcription factor gene VlmybA2 in transgenic tobacco and Arabidopsis. Plant Biotechnol. Rep. 1, 11–18. Huang, Y.J., Song, S., Allan, A.C., Liu, X.F., Yin, X.R., Xu, C.J., Chen, K.S., 2013. Differential activation of anthocyanin biosynthesis in Arabidopsis and tobacco over-expressing an R2R3 MYB from Chinese bayberry. Plant Cell Tissue Organ Cult. 113, 491–499. Kukula, K.L., Jafra, S., Oszmianski, J., Szopa, J., 2005. Ectopic expression of anthocyanin 5-O-glucosyltransferase in potato tuber causes increased resistance to bacteria. J. Agric. Food Chem. 53, 272–281. Lim, S.H., Song, J.H., Kim, D.H., Kim, J.K., Lee, J.Y., Kim, Y.M., Ha, S.H., 2016. Activation of anthocyanin biosynthesis by expression of the radish R2R3-MYB transcription factor gene RsMYB1. Plant Cell Rep. 35 (3), 641–653.
65
Mallona, I., Lischewski, S., Weiss, J., Hause, B., Cortines, M.E., 2010. Validation of reference genes for quantitative real-time PCR during leaf and flower development in Petunia hybrida. BMC Plant Biol. 10, 4. Naing, A.H., Ai, T.N., Jeon, S.M., Park, K.L., Lim, K.B., Kim, C.K., 2015. Expression of RsMYB1 in chrysanthemum regulates key anthocyanin biosynthetic genes. Electron. J. Biotechnol. 18, 359–364. Oh, J.E., Kim, Y.H., Kim, J.H., Kwon, Y.R., Lee, H., 2011. Enhanced level of anthocyanin leads to increased salt tolerance in arabidopsisPAP1-D plants upon sucrose treatment. J. Korean Soc. Appl. Biol. Chem. 54, 79–88. Park, N.L., Xu, H., Li, X., Jang, I.H., Park, S.H., Ahn, G.H., Lim, Y.P., Kim, S.J., Park, S.U., 2011. Anthocyanin accumulation and expression of anthocyanin biosynthetic genes in radish (Raphanus sativus). J. Agric. Food Chem. 59, 6034–6039. Pattanaik, S., Kong, Q., Zaitlin, D., Werkman, J., Xie, C., Patra, B., Yuan, L., 2010. Isolation and functional characterization of a floral tissue-specific R2R3 MYB regulator from tobacco. Planta 231, 1061–1076. Piazza, P., Procissi, A., Jenkins, G.I., Tonelli, C., 2002. Members of the c1/pl1 regulatory gene family mediate the response of maize aleurone and mesocotyl to different light qualities and cytokinins. Plant Physiol. 128, 1077–1086. Quattrocchio, F., Wing, J.F., Leppen, H.T.C., Mol, J.N.M., Koes, R.E., 1993. Regulatory genes controlling anthocyanin pigmentation are functionally conserved among plant species and have distinct sets of target genes. Plant Cell 5, 1497–1512. de Vetten, N., Quattrocchio, F., Mol, J., Koes, R., 1997. The an11 locus controlling flower pigmentation in petunia encodes a novel WD-repeat protein conserved in yeast, plants, and animals. Genes Dev. 11, 1422–1434. Quattrocchio, F., Wing, J.F., van der Woude, K., Mol, J.N.M., Koes, R., 1998. Analysis of bHLH and MYB domain proteins: species-specific regulatory differences are caused by divergent evolution of target anthocyanin genes. Plant J. 13, 475–488. Quattrocchio, F., Wing, J., van der Woude, K., Souer, E., de Vetten, N., Mol, J., Koes, R., 1999. Molecular analysis of the anthocyanin2 gene of petunia and its role in the evolution of flower color. Plant Cell 11, 1433–1444. Sarma, A.D., Sharma, R., 1999. Anthocyanin-DNA copigmentation complex: mutual protection against oxidative damage. Phytochemistry 52, 1313–1318. Schwinn, K., Venail, J., Shang, Y., Mackay, S., Alm, V., Butelli, E., Oyama, R., Bailey, P., Davies, K., Martin, C., 2006. A small family of MYB-regulatory genes controls floral pigmentation intensity and patterning in the genus Antirrhinum. Plant Cell 18, 831–851. Spelt, C., Quattrocchio, F., Mol, J.N.M., Koes, R., 2000. Anthocyanin1 of petunia encodes a basic helix-loop-helix protein that directly activates transcription of structural anthocyanin genes. Plant Cell 12, 1619–1631. Tohge, T., Matsui, K., Ohme-Takagi, M., Yamazaki, M., Saito, K., 2005. Enhanced radical scavenging activity of genetically modified Arabidopsis seeds. Biotechnol. Lett. 27, 297–303. van Tunen, A.J., Mol, J.N.M., 1991. Control of flavonoids synthesis and manipulation of flower color. Plant Biotechnol. 2, 94–125. Xie, D.Y., Sharma, S.B., Wright, E., Wang, Z.Y., Dixon, R.A., 2006. Metabolic engineering of proanthocyanidins through co-expression of anthocyanidin reductase and the PAP1 MYB transcription factor. Plant J. 45, 895–907. Zuluaga, D.L., Gonzali, S., Loreti, E., Pucciariello, C., Degl’Innocenti, E., Guidi, L., Alpi, A., Perata, P., 2008. Arabidopsis thaliana MYB75/PAP1 transcription factor induces anthocyanin production in transgenic tomato plants. Funct. Plant Biol. 35, 606–618.