- Email: [email protected]
Expression of the Apolipoprotein E Gene Does Not Affect Motor Recovery After Sensorimotor Cortex Injury in the Mouse
ApoE and motor recovery
Pergamon PII: S0306-4522(00)00234-7
Neuroscience Vol. 99, No. 4, pp. 705–710, 2000 705 䉷 2000 IBRO. Published by Elsevier Science Ltd Printed in Great Britain. All rights reserved 0306-4522/00 $20.00+0.00
www.elsevier.com/locate/neuroscience
EXPRESSION OF THE APOLIPOPROTEIN E GENE DOES NOT AFFECT MOTOR RECOVERY AFTER SENSORIMOTOR CORTEX INJURY IN THE MOUSE L. B. GOLDSTEIN,*†‡§ M. P. VITEK,* H. DAWSON* and S. BULLMAN*‡ *Department of Medicine (Neurology) and †Duke Center for Cerebrovascular Disease, Box 3651, Duke University Medical Center, Durham, NC 27710, USA ‡Durham Department of Veterans Affairs Medical Center, Durham, NC, USA
Abstract—Motor recovery after unilateral sensorimotor cortex ablation or sham-injury was measured in apolipoprotein E knockout and wild-type mice by testing their abilities to traverse a narrow beam. All mice trained without difficulty. Sham-operated mice performed perfectly regardless of genotype throughout testing. There was no difference in motor scores between lesioned apolipoprotein E knockout and wild-type mice on a first trial 24 h after injury (P ⬎ 0.05). There was a significant overall effect of lesion on motor performance (two-way repeated measures analysis of variance F1,42 304, P ⬍ 0.0001), a significant time effect (F17,714 58, P ⬍ 0.0001) and a lesion by time interaction (F17,714 58, P ⬍ 0.0001). However, there was no effect of apolipoprotein E genotype group on recovery rate (i.e. there was no lesion group by genotype group by time interaction, F17,714 0.33, P 1.00) and no effect of genotype on the final level of motor performance 12 days after the lesion (Kruskal–Wallis H 5.79, P 0.12). These data suggest that motor recovery after unilateral injury to the sensorimotor cortex does not vary with apolipoprotein E genotype. 䉷 2000 IBRO. Published by Elsevier Science Ltd. All rights reserved. Key words: motor cortex, recovery, knockout mice, locomotion.
Apolipoprotein E (apoE) is a 299 amino acid glycoprotein that was originally described as a lipid-binding molecule with initial studies establishing its important role in cholesterol metabolism. 59 Interest in the neurobiology of apoE increased dramatically with the demonstration that possession of an apoE4 allele increased susceptibility to the development of late onset familial and sporadic Alzheimer’s Disease.5,44,52,54 More recent laboratory and clinical studies suggested that apoE genotype may also play an important role in modulating neurological outcome following different types of brain injury. For example, apoE-deficient mice had poorer outcome after closed head injury 4 as well as focal 23 and global cerebral ischemia. 48 Additional experimental studies indicated that this poorer outcome was isoform specific. For example, the hemiparesis following focal cerebral ischemia was less severe in apoE3 as compared with apoE4 transgenic mice. 47 Consistent with these observations, clinical studies have found an association between the presence of the apoE4 allele and poorer outcome in humans with intracerebral hemorrhage 1 and closed head injury. 30,46,50,57 Chronic traumatic brain injury was found to be more severe in boxers who carried the apoE4 genotype 57 and neurocognitive deficits were greater in patients with an apoE4 allele who underwent cardiopulmonary bypass surgery 56 or who had an ischemic stroke. 49 Outcome after brain injury is affected by factors related to both the initial lesion and to subsequent recovery. 12,13,16,24,32,34,39 The effects of apoE genotype on outcome have been ascribed to both sets of processes. 21,22 For example, apoE may modulate the CNS inflammatory response to injury 22, which depending on genotype, can potentially result
in a less or more severe neurological deficit. In addition, secretion of tumor necrosis factor a, which has been implicated in release of nitric oxide and other reactive oxygen species, 27 was reduced by apoE in mixed glial cultures. 20 Thus, apoE may affect outcome by modulating the pathophysiological consequences of brain damage. These potential effects of apoE, as well as the severity of the initial neurological deficit, must be controlled in clinical studies and experiments designed to investigate its potential impact on the recovery process. Of necessity, clinical studies associating apoE genotype with functional outcome have largely been cross sectional and retrospective, and therefore could not adequately control for these effects. Studies in laboratory animals that have included behavioral measures have generally carried out neurological assessments at a single timepoint and have similar limitations. In the present study, we controlled for the initial severity of the neurological deficit and the potential injury-related secondary modulatory effects of apoE by choosing an injury model minimizing these differences and responses. We thereby isolated the impact of the expression of the apoE gene on behavioral recovery. The behavioral task was adapted from one previously developed in rats and focuses on locomotor function. It was hypothesized that mice lacking apoE would have poorer recoveries as compared to wild-type mice.
EXPERIMENTAL PROCEDURES
Subjects Four-month old male apoE-deficient (apoE knockout, n 23) 35 mice, backcrossed 10 times to the C57BL/6J strain to control for effects of background strain, were obtained from Jackson Labs, Bar Harbor, Maine (strain 002052) for use in this experiment. Age and sex matched wild-type C57BL/6J mice (n 23) served as controls. Mice were housed in a vivarium with a 12-h light/dark cycle and provided with both food and water ad libitum.
§To whom correspondence should be addressed at: Duke Center for Cerebrovascular Disease. Tel.: ⫹1-919-684-3801; fax: ⫹1-919-684-6514. E-mail address: [email protected] (L. B. Goldstein). Abbreviations: apoE, apolipoprotein E; PCR, polymerase chain reaction. 705
706
L. B. Goldstein et al.
right-sided craniotomy extending from approximately 1 mm rostral to 2 mm caudal to the coronal suture and from 1 mm lateral of the sagittal suture to the temporal ridge. For half of the wild-type and half of the apoE-knockout mice, the hindlimb sensorimotor cortex underlying the craniotomy site was removed by gentle suction through a fine glass Pasteur pipette until the underlying white matter was visualized. Shamoperated control wild-type and apoE-knockout mice underwent the identical surgical procedure, but craniotomy was not performed. Thus, there were four groups of mice: wild-type, cortex lesion (n 12); wild-type, sham-cortex lesion (n 11); apoE-knockout, cortex lesion (n 12); and apoE-knockout, sham-cortex lesion (n 11). Beginning 24 h after cortex lesion surgery, the mice were tested on the beam at 1-h intervals for 6 h and then daily over the subsequent 12 days. This testing schedule was selected to facilitate comparisons with our previous work. 6,10,11 The mice were not stimulated in any way during a trial other than with light-noise activation as described above. Lesion extent/histology
Fig. 1. Effects of apoE genotype on beam-walking scores after a right sensorimotor cortex lesion (KO-LES, apoE-knockout, cortex-lesion, n 12; KO-SHAM, apoE-knockout, sham cortex lesion, n 11; WTLES, wild-type, cortex lesion, n 12; WT-SHAM, wild-type, sham cortex lesion, n 11). Time in “hours” and “days” refers to time after the first post-operative beam-walking trial. The first trial, H1, was given 24 h following cortex lesion or sham cortex surgery. The symbols represent the mean (^S.E.M.) beam-walking scores for each trial. Motor performance was rated on a seven-point scale as previously described: 6,8,11 (1) the mouse is unable to place the affected hindpaw on the horizontal surface of the beam; (2) the mouse places the affected hindpaw on the horizontal surface of the beam and maintains balance for at least 5 s; (3) the mouse traverses the beam while dragging the affected hindpaw; (4) the mouse traverses the beam and at least once places the affected hindpaw on the horizontal surface of the beam; (5) the mouse crosses the beam and places the affected hindlimb on the horizontal surface of the beam to aid less than half its steps; (6) the mouse uses the affected hindpaw to aid more than half its steps; and (7) the mouse traverses the beam with no more than two footslips.
Apparatus The behavioral testing apparatus and procedures employed in this experiment were adapted from those used with rats in a series of preliminary studies. Briefly, the apparatus consisted of a 15 × 15 × 15-cm goal box located at one end of a 60 × 0.64-cm elevated wooden beam. The width of the beam was calibrated in preliminary experiments so that lesioned animals would have a consistent, measurable deficit while controls would have normal performance (see below). A switch-activated source of bright light and white noise were located at the start-end of the beam and served as avoidance/activating stimuli. 8 Surgery and behavioral procedures Mice were acclimated to the housing facility and handled daily for at least one-week prior to training at the beam-walking task. For each training or testing trial, the mouse was placed at the start-end of the beam opposite to the goal box. If the animal did not begin to traverse the beam after 10 s, the light and noise stimuli were activated and continued until the mouse’s nose entered the goal box or for a total of 80 s at which time the trial was terminated. On the first day of training, each mouse was given a series of three approximate trials. Motor performance was rated on a seven-point scale as described in the legend for Fig. 1. Subsequent training consisted of one trial on the beam each day until the mouse achieved the maximum possible score. Following training, mice were anesthetized for cortex lesion surgery (pentobarbital sodium 50 mg/kg, i.p.; additional doses were administered as necessary to maintain anesthesia). The mice then underwent a
The day following completion of the behavioral measurements, mice were anesthetized with pentobarbital sodium, killed by decapitation, and the brains were dissected, immediately placed on ice, and then frozen. For histology, the frozen tissue was cryoprotected by immersion in a solution of 25% sucrose in phospahte-buffered saline at 4⬚C. Serial 16-mm coronal sections were then cut on a cryostat. The tissue was mounted, immersed in Cresyl Violet stain, rinsed in water, and then dehydrated by passing through graded ethanol and xylene. Lesion areas were measured for every 10 sections with image analysis software and lesion volumes calculated. Statistical analysis Two-way repeated-measures analysis of variance was used to test the overall significance of differences between groups, the significance of changes in beam-walking scores over time (i.e., recovery rate), and whether there was a group–time interaction (i.e., variation in the rate of recovery among the groups). The Fisher LSD test was subsequently applied in order to determine the significance of differences between groups. For ordinal data, the Kruskal–Wallis test was used to determine the significance of differences among more than two groups and the Dunn Procedure 42 was used for post hoc pairwise comparisons. Cortex lesion size data were analysed by unpaired t-tests for two group comparisons. A P ⬍ 0.05 (two-tailed) was considered statistically significant. Genotype confirmation The genotype of each animal was confirmed with polymerase chain reaction (PCR) on genomic DNA extracted individually from 0.5 cm of the tip of the tail of each animal that were removed and frozen at the time of killing. Mouse genomic DNA was extracted from each tail with a Big Blue DNA isolation kit (Stratagene) according to instructions provided by the manufacturer. For each genomic DNA preparation, 0.01% was used as a template in a 20-ml PCR employing the oligonucleotide primer pairs GTCTCGGCTCTGAACTACATAG (mouseknockout-forward primer) and GCAAGAGGTGATGGTACTCG (mouse-knockout-reverse primer). PCR was performed with AmpliTaq DNA polymerase (AmpliTaq kit, Perkin Elmer Cetus) according to instructions provided by the manufacturer. In this reaction, genomic DNA from C57BL/6J mice permits amplification of a 617 bp DNA fragment with a sequence matching positions 2264–2881 of the mouse apoE gene (Genebank accession number d00466). In contrast, genomic DNA from apoE-knockout mice contains the neomycin resistance gene that has been inserted to disrupt the apoE gene sequence thereby blocking the expression of the apoE protein. Thus, genomic DNA from apoE-knockout mice permits amplification of about a 1400 bp DNA fragment with a sequence that includes the neomycin resistance gene. Using this information, the DNA from each animal that amplified a 600 bp band was scored as a wild-type and those that amplified a 1400 bp band were scored as an apoE-knockout as shown in Fig. 2. Animal care and use committee approval This study was approved by the Animal Care and Use Committees of Duke University and the Durham VA Medical Center and experiments were carried out in accordance with the National Institutes
ApoE and motor recovery
of Health Guide for the Care and Use of Laboratory Animals (NIH Publications 80-23, revised 1978). The experiments were performed with a minimum number of animals and all efforts were made to minimize animal suffering. RESULTS
apoE genotype (wild-type vs knockout) was confirmed for all mice (Fig. 2). Behaviorally, all of the animals were able to master the beam-walking task without difficulty (i.e. apoEknockouts had no difficulty with training). Figure 1 gives the mean (^S.E.M.) motor scores for each group at each time-point. Sham-operated mice continued to perform perfectly throughout testing regardless of apoE genotype. Cortex-lesioned mice had a significant motor deficit on the first testing trial 24 h after the lesion (Kruskal–Wallis H 44.04, P ⬍ 0.0001). However, there was no significant difference in motor scores of cortex-lesioned mice based on apoE genotype (Dunn Procedure, P ⬎ 0.05 for wild-type, cortex-lesioned mice vs apoE-knockout, cortex-lesioned mice). There was a significant overall effect of lesion on motor performance (two-way repeated measures analysis of variance F1,42 304, P ⬍ 0.0001, comparison of cortex lesion vs sham cortex lesion), a significant time effect (F17,714 58, P ⬍ 0.0001, i.e. at least one group had a significant change in scores over time) and a lesion–time interaction (F17,714 58, P ⬍ 0.0001, i.e. motor scores of cortex-lesioned mice changed over time as compared with sham cortex-lesioned mice). However, there was no effect of apoE genotype on either recovery rate (i.e. there was no lesion group–genotype– time interaction, F17,714 0.33, P 1.00) and no effect of genotype on the final level of motor performance 12 days after the lesion (Kruskal–Wallis H 5.79, P 0.12). Measurement of lesion volumes comparing wild-type vs apoE-knockout mice revealed similar lesion extents (mean lesion volume for wild-type mice, 4.17 ^ 0.39 mm 3 vs mean lesion volume for apoE-knockout mice, 3.25 ^ 0.51 mm 3, P 0.18). Given this narrow range of lesion sizes, there was no overall correlation between lesion volume and recovery rate as measured by the areas under the timeeffect curves (r ⫺.013, P ⬍ 0.56) and no correlations between lesion volume and recovery rate for wild-type (r 0.20, P ⬍ 0.55) or apoE-knockout (r ⫺0.27, P ⬍ 0.39) mice. DISCUSSION
Although it was hypothesized that recovery of motor function after injury to the sensorimotor cortex would be impaired in apoE-knockout mice, the main finding of the present
707
experiment was that there was no difference in recovery based on apoE genotype. apoE-knockout and wild-type mice had similar initial motor deficits, virtually identical recovery rates, and indistinguishable final levels of functional ability. This unexpected finding may have important implications for understanding the neurobiological processes underlying apoE-related differences in functional outcome following brain injury. Outcome after a brain injury may be affected by a variety of factors including those associated with the lesion (e.g. lesion size, lesion location), pathophysiological sequellae of the injury (e.g. edema, increased intracranial pressure), potential secondary effects (e.g. delayed neuronal death), and processes related to recovery. The cortex lesion in the present experiment was produced by a suction-ablation technique. This method was chosen for several reasons: (i) it permits highly reproducible lesions of the hindlimb sensorimotor cortex; 9 (ii) because the lesion is the result of actual removal of brain tissue and pathological sequellae are limited, 33,55 lesion size and the accompanying behavioral deficit are maximal at onset and recovery is primarily related to compensatory processes; and (iii) secondary processes associated with other types of injuries such as ischemia, 39,45 concussive trauma, 38 and electrolytic lesions 55 are minimized. Thus, by using a suction-ablation lesion, both the size of the lesion and the initial neurological deficit could be controlled and those processes related to recovery relatively isolated. An effect of apoE on recovery after brain injury (as distinguished from functional outcome alone) is plausible based on evidence from several in vitro studies. Since there are rapid increases in apoE mRNA in the hippocampus after entorhinal cortex lesions, apoE is temporally positioned to participate in recovery processes. 37 apoE may also participate mechanistically in the salvage and re-utilization of non-esterified cholesterol released during terminal breakdown. 36 Estradiolmediated enhancement of synaptic sprouting in the hippocampus in response to entorhinal cortex lesions is absent in apoE-knockout mice, further supporting such a mechanism. 51 Mossy fiber sprouting in hippocampal slice culture, which is absent in apoE-knockout mice, is apparently modulated based on apoE isotype with sprouting in E4 transgenic mice being nearly 60% less effective than in E3 transgenics. 58 Furthermore, in vitro experiments have demonstrated apoE may have neurotrophic effects. 15 These effects may also be isoformspecific, with E3 enhancing and E4 retarding neurite outgrowth. 17,28,29 Based on biochemical studies showing interactions between apoE and tau protein, 41,53 this neurotrophic effect has been hypothesized to be due to differential
Fig. 2. PCR of genomic DNA from individual mice reveals whether their apoE gene is intact (wild-type) or disrupted (knocked-out). Genomic DNA extracted from the tails of mice is used as a template in a standard PCR with primers that amplify a 617 bp DNA fragment from the intact mouse apoE gene from wildtype mice that express mouse apoE protein or a 1400 bp DNA fragment from the disrupted apoE gene found in apoE-knockout mice that fail to express apoE protein. Lane M is for DNA size markers, lanes marked Wild-Type contain the 617 bp DNA fragment found in wild-type mice and Lanes marked ApoEknockout contain the 1400 bp DNA fragment found in apoE-knockout mice.
708
L. B. Goldstein et al.
interactions of the apoE isoforms with microtubules. 29 However, another study found that both apoE3 and apoE4 acted as similar neurotrophic factors in vitro. 40 These differing results might be reconciled based on differences in the culture systems or in the lipid constituents associated with the lipoprotein particle. 58 Such disparate findings, however, underscore the difficulty of extrapolating the results of in vitro studies to the conditions that are found in vivo. There is also some disagreement in published reports regarding the presence or absence of baseline behavioral, physiological and morphological differences between wildtype and apoE-knockout mice. One laboratory was unable to demonstrate any evidence of impaired learning in a study of female apoE-knockout mice. 3 This same laboratory found no differences based on apoE genotype in male mice in a series of neurological tests, water-maze learning, hippocampal ultrastructure, CNS plasticity (hippocampal longterm potentiation and amygdaloid kindling) and no difference in synaptic recovery in the hippocampus after deafferentation. 2 These results led the authors to conclude that either the apoE genotype was of no importance in the maintenance of synaptic integrity and in the processes of CNS repair, or that alternative apolipoproteins compensate for the loss of apoE in the knockout mice. However, another laboratory found severe deficits in spatial learning and memory in sixmonth-old apoE-deficient mice based on testing in the Morris Water Maze. 31 Others have also reported cognitive deficits in apoE-knockout mice 14 which can be ameliorated by infusion of recombinant apoE. 25 Consistent with these findings, electrophysiological experiments demonstrated impaired long-term potentiation in the hippocampus of apoE-deficient mice. 19 Potential explanations for these disparate findings include differences in the sources of the transgenic lines and the types of controls that were used in individual experiments. Many of the studies reporting differences in outcome related to apoE genotype could not, or did not, adequately control for differences in initial severity and/or secondary lesion-related pathophysiological responses; factors that have a critical influence on final outcome. For example, apoE deficient mice have poorer outcome after focal 23 and global cerebral ischemia. 48 Additional experimental studies suggest that this poorer outcome is isoform specific with the hemiparesis following focal cerebral ischemia being less severe in apoE3 as compared with apoE4 transgenic mice. 47 However, these studies lacked serial neurological assessments with functional outcome measured at a single time-point shortly (24 h in two of the studies and 72 h in the third) after injury. Furthermore, histological assessments demonstrated more extensive damage in animals lacking the apoE gene (i.e. the difference in functional outcome may have been related to differences in the extent of injury rather than an effect on their subsequent recovery). A study of motor and cognitive deficits after closed head injury in apoE-deficient mice did include serial behavioral assessments. 4 apoEdeficient mice exhibited more severe motor and learning deficits when compared to non-injured controls. Memory deficits were first assessed 21 days after the injury, and no data are available regarding earlier differences in cognitive function. Motor function was assessed between 1 h and 40 days after injury. The percentage of apoE-deficient mice able to perform these motor tasks was lower than that of controls at all timepoints indicating a differential initial effect of the injury. The
groups diverged after seven days in a neurological severity score, potentially suggesting a difference in late recovery. However, this may have been related to the sensitivity of the tests to detect early differences in view of the differences in motor performance in these same animals. In addition, on histological assessment, brain-injured apoE-deficient mice had greater neuronal loss than brain-injured controls with no difference in the sham-operated animals. Therefore, although the behavioral data from this experiment are consistent with others showing apoE-related differences in outcome, they can not be interpreted as supporting an independent effect on recovery. Several clinical studies have demonstrated differences in outcome following a variety of brain injuries related to apoE genotype. For example, mortality was found to be higher in patients with intracerebral hemorrhage who carried an apoE4 allele. 1 In a second study, there was a trend towards reduced survival in patients with intracerebral hemorrhage with an apoE4 allele. 26 Interestingly, there was improved survival in those apoE4 carriers with ischemic stroke. However, the studies were both retrospective, there was no measure of initial severity and the sole outcome measures were mortality and institutionalization. apoE4 genotype has also been associated with poor outcome after traumatic brain injury. A case report noted an unusual prominence of b-amyloid protein deposition in an individual with dementia pugilistica who was an apoE3/4 heterozygote. 18 This observation was consistent with an earlier report that noted b-amyloid protein deposition following acute, fatal head trauma in patients with the E4 allele. 30 Neither study contained any controlled outcome data. In a prospective study, an association was found between the apoE4 allele and length of unconsciousness and poor clinical outcome six months after traumatic brain injury. 7 Initial Glasgow Coma Scale, a gross measure of injury severity, was worse in patients with the apoE4 allele, partially confounding the analysis. There were no other measures of injury extent or in change of extent over time. Similarly, a higher frequency of the apoE4 allele was found in patients having a poor outcome following prolonged posttraumatic unawareness. 50 Another retrospective study attempting to adjust for injury severity with length of coma, noted a trend towards greater disability in patients with an apoE4 allele. 46 These studies, reported in abstract form, also could not adequately control for injury extent or secondary pathological changes. A prospective study of the effects of apoE polymorphisms in traumatic head injury patients used the Glasgow Coma Scale to assess initial severity and the Glasgow Outcome Scale to assess outcome after six months. 57 Using data provided in the report, patients with the E4 allele had significantly more severe initial deficits than those without the E4 allele. A higher proportion of those with apoE4 had an unfavorable outcome with the association remaining significant after controlling for age, Glasgow Coma Scale score, and brain CT findings (focal mass vs diffuse injury). A significant limitation was that serial brain imaging and serial measures of neurological function were not obtained to exclude the potential contribution of secondary injury. Therefore, although these clinical studies support, to varying degrees, an association between apoE genotype and outcome after intracerebral hemorrhage and traumatic brain injury, none can directly address the specific impact of genotype on the recovery process.
ApoE and motor recovery CONCLUSIONS
There is considerable evidence supporting an effect of apoE on outcome after brain injury. However, the available literature does not provide unequivocal support for the hypothesis that apoE plays a critical role in the recovery process, and we were unable to demonstrate a difference in functional motor recovery after focal injury to the cerebral cortex based on apoE genotype. It should be noted that different strains of inbred mice may respond differently to injury and behave differently in behavioral tests. 43 In addition, it is possible that other apolipoproteins compensated for the absence of apoE in these knockout mice. However, the present data
709
suggest that apoE is not specifically required for motor recovery after cortex injury. The present data can not exclude the possibility that apoE may play a role in recovery after other types of lesions located in other regions of the nervous system. Although apoE plays an important role in the response to brain injury, additional studies are required to determine its precise role in influencing recovery from that injury.
Acknowledgements—Supported by the Department of Veterans Affairs, National Institute on Aging and the Alzheimer’s Association.
REFERENCES
1. Alberts M. J., Graffagnino C., McClenny C., DeLong D., Strittmatter W., Saunders A. M. and Roses A. D. (1995) ApoE genotype and survival from intracerebral haemorrhage. Lancet 346, 575. 2. Anderson R., Barnes J. C., Bliss T. V., Cain D. P., Cambon K., Davies H. A., Errington M. L., Fellows L. A., Gray R. A., Hoh T., Stewart M., Large C. H. and Higgins G. A. (1998) Behavioural, physiological and morphological analysis of a line of apolipoprotein E knockout mouse. Neuroscience 85, 93–110. 3. Anderson R. and and Higgins G. A. (1997) Absence of central cholinergic deficits in ApoE knockout mice. Psychopharmacology 132, 135–144. 4. Chen Y., Lomnitski L., Michaelson D. M. and Shohami E. (1997) Motor and cognitive deficits in apolipoprotein E-deficient mice after closed head injury. Neuroscience 80, 1255–1262. 5. Corder E. H., Saunders A. M., Strittmatter W. J., Schmechel D. E., Gaskell P. C., Small G. W., Roses A. D., Haines J. L. and Pericak-Vance M. A. (1993) Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer’s disease in late onset families. Science 261, 921–923. 6. Feeney D. M., Gonzalez A. and Law W. A. (1982) Amphetamine, haloperidol, and experience interact to affect the rate of recovery after motor cortex injury. Science 217, 855–857. 7. Friedman G., Froom P., Sazbon L., Grinblatt I., Shochina M., Tsenter J., Babaey S., Ben Yehuda A. and Groswasser Z. (1999) Apolipoprotein E-14 genotype predicts a poor outcome in survivors of traumatic brain injury. Neurology 52, 244–248. 8. Goldstein L. B. (1993) Beam-walking in rats: the measurement of motor recovery after injury to the cerebral cortex. Neurosci. Protocols 10, 1–13. 9. Goldstein L. B. (1993) Rapid reliable measurement of lesion parameters for studies of motor recovery after sensorimotor cortex injury in the rat. J. Neurosci. Meth. 48, 35–42. 10. Goldstein L. B. and Davis J. N. (1990) Beam-walking in rats: studies towards developing an animal model of functional recovery after brain injury. J. Neurosci. Meth. 31, 101–107. 11. Goldstein L. B. and Davis J. N. (1990) Influence of lesion size and location on amphetamine-facilitated recovery of beam-walking in rats. Behav. Neurosci. 104, 318–325. 12. Goldstein L. B., Matchar D. B., Morgenlander J. C. and Davis J. N. (1990) Influence of drugs on the recovery of sensorimotor function after stroke. J. Neuro. Rehab. 4, 137–144. 13. Goldstein, L.B. and Sygen in Acute Stroke Study Investigators (1995) Common drugs may influence motor recovery after stroke. Neurology 45, 865–871. 14. Gordon I., Grauer E., Genis I., Sehayek E. and Michaelson D. M. (1995) Memory deficits and cholinergic impairments in apolipoprotein E-deficient mice. Neurosci. Lett. 199, 1–4. 15. Handelmann G. E., Boyles J. K., Weisgraber K. H., Mahley R. W. and Pitas R. E. (1992) Effects of apolipoprotein E, beta-very low density lipoproteins, and cholesterol on the extension of neurites by rabbit dorsal root ganglion neurons in vitro. J. Lip. Res. 33, 1677–1688. 16. Heinemann A. W., Roth E. J., Cichowski K. and Betts H. B. (1989) Multivariate analysis of improvement and outcome following stroke rehabilitation. Arch. Neurol. 44, 1167–1172. 17. Holtzman D. M., Pitas R. E., Kilbridge J., Nathan B., Mahley R. W., Bu G. and Schwartz A. L. (1995) Low density lipoprotein receptor-related protein mediates apolipoprotein E-dependent neurite outgrowth in a central nervous system-derived neuronal cell line. Proc. natn. Acad. Sci. USA 92, 9480–9484. 18. Jordan B. D., Kanik A. B., Horwich M. S., Sweeney D., Relkin N. R., Petito C. K. and Gandy S. (1995) Apolipoprotein E e4 and fatal cerebral amyloid angiopathy associated with dementia pugilistica. Ann. Neurol. 38, 698–699. 19. Krugers H. J., Mulder M., Korf J., Havekes L., de Kloet E. R. and Joels M. (1997) Altered synaptic plasticity in hippocampal CA1 area of apolipoprotein E deficient mice. NeuroReport 8, 2505–2510. 20. Laskowitz D. T., Goel S., Bennett E. R. and Matthew W. D. (1997) Apolipoprotein E suppresses glial cell secretion of TNF alpha. J. Neuroimmunol. 76, 70–74. 21. Laskowitz D. T., Horsburgh K. and Roses A. D. (1998) Apolipoprotein E and the CNS response to injury. J. cereb. Blood Flow Metab. 18, 465–471. 22. Laskowitz D. T. and Roses A. D. (1998) Apolipoprotein E: an expanding role in the neurobiology of disease. Alzheimer’s Reports 1, 5–12. 23. Laskowitz D. T., Sheng H., Bart R. D., Joyner K. A., Roses A. D. and Warner D. S. (1997) Apolipoprotein E-deficient mice have increased susceptibility to focal cerebral ischemia. J. cereb. Blood Flow Metab. 17, 753–758. 24. Lincoln N. B., Blackburn M., Ellis S., Jackson J., Edmans J. A., Nouri F. M., Walrer M. F. and Haworth H. (1989) An investigation of factors affecting progress of patients on a stroke unit. J. Neurol. Neurosurg. Psychiatry 52, 493–496. 25. Masliah E., Samuel W., Veinbergs I., Mallory M., Mante M. and Saitoh T. (1997) Neurodegeneration and cognitive impairment in apoE-deficient mice is ameliorated by infusion of recombinant apoE. Brain Res. 751, 307–314. 26. McCarron M. O., Muir K. W., Weir C. J., Dyker A. G., Bone I., Nicoll J. A. R. and Lees K. R. (1998) The apolipoprotein E 14 allele and outcome in cerebrovascular disease. Stroke 29, 1882–1887. 27. Merrill J. E., Ignarro L. J., Sherman M. P., Melinek J. and Lane T. E. (1993) Microglial cell cytotoxicity of oligodendrocytes is mediated through nitric oxide. J. Immun. 151, 2132–2141. 28. Nathan B. P., Bellosta S., Sanan D. A., Weisgraber K. H., Mahley R. W. and Pitas R. E. (1994) Differential effects of apolipoproteins E3 and E4 on neuronal growth in vitro. Science 264, 850–852. 29. Nathan B. P., Chang K. C., Bellosta S., Brisch E., Ge N., Mahley R. W. and Pitas R. E. (1995) The inhibitory effect of apolipoprotein E4 on neurite outgrowth is associated with microtubule depolymerization. J. biol. Chem. 270, 19,791–19,799. 30. Nicoll J. A. R., Roberts G. W. and Graham D. I. (1995) Apolipoprotein E e4 allele is associated with deposition of amyloid b-protein following head injury. Nature Medicine 1, 135–137. 31. Oitzl M. S., Mulder M., Lucassen P. J., Havekes L. M., Grootendorst J. and de Kloet E. R. (1997) Severe learning deficits in apolipoprotein E-knockout mice in a water maze task. Brain Res. 752, 189–196. 32. Oxbury J. M., Greenhall R. C. D. and Grainger K. M. R. (1975) Predicting the outcome of stroke: acute stage after cerebral infarction. Br. Med. J. 3, 125–127.
710
L. B. Goldstein et al.
33. Pearlson G. D. and Robinson R. G. (1981) Suction lesions of the frontal cerebral cortex in the rat induce assymetrical behavioral and catecholaminergic responses. Brain Res. 218, 233–242. 34. Petito C. K., Feldmann E., Pulsinelli W. A. and Plum F. (1987) Delayed hippocampal damage in humans following cardiopulmonary arrest. Neurology 37, 1281–1286. 35. Piedrahita J. A., Zhang S. H., Hagaman J. R., Oliver P. M. and Maeda N. (1992) Generation of mice carrying a mutant apolipoprotein E gene inactivated by gene targeting in embryonic stem cells. Proc. natn. Acad. Sci. USA 15, 4471–4475. 36. Poirier J., Baccichet A., Dea D. and Gauthier S. (1993) Cholesterol synthesis and lipoprotein reuptake during synaptic remodelling in hippocampus in adult rats. Neuroscience 55, 81–90. 37. Poirier J., Hess M., May P. C. and Finch C. E. (1991) Astrocytic apolipoprotein E mRNA and GFAP mRNA in hippocampus after entorhinal cortex lesioning. Molec. Brain Res. 11, 97–106. 38. Povlishock J. T., Erb D. E. and Arstruc J. (1992) Axonal response to traumatic brain injury: reactive axonal change, deafferentation, and neuroplasticity. J. Neurotrauma 9, S189–S200. 39. Pulsinelli W. A., Brierly J. B. and Plum F. (1982) Temporal profile of neuronal damage in a model of transient forebrain ischemia. Ann. Neurol. 11, 491–498. 40. Puttfarcken P. S., Manelli A. M., Falduto M. T., Getz G. S. and LaDu M. J. (1997) Effect of apolipoprotein E on neurite outgrowth and beta-amyloidinduced toxicity in developing rat primary hippocampal cultures. J. Neurochem. 68, 760–769. 41. Roses A. D. (1994) Apolipoprotein E affects the rate of Alzheimer disease expression: beta-amyloid burden is a secondary consequence dependent on APOE genotype and duration of disease. J. Neuropath. exp. Neurol. 53, 429–437. 42. Rosner B. (1986) Fundamentals of Biostatistics. Duxbury, Boston. 43. Royle S. J., Collins F. C., Rupniak H. T., Barnes J. C. and Anderson R. (1999) Behavioural analysis and susceptibility to CNS injury of four inbred strains of mice. Brain Res. 816, 337–349. 44. Saunders A. M., Strittmatter W. J., Schmechel D., George-Hyslop P. H., Pericak-Vance M. A., Joo S. H., Rosi B. L., Gusella J. F., Crapper-MacLachlan D. R., Alberts M. J., Hulette C., Crain B., Goldgaker D. and Roses A. D. (1993) Association of apolipoprotein E allele epsilon 4 with late-onset familial and sporadic Alzheimer’s disease. Neurology 43, 1467–1472. 45. Saunders D. E., Howe F. A., Van den Boogaart A., McLean M. A., Griffiths J. R. and Brown M. M. (1995) Continuing ischemic damage after acute middle cerebral artery infarction in humans demonstrated by short-echo proton spectroscopy. Stroke 26, 1007–1013. 46. Seliger G., Lichtman S. W., Polsky T. and Riley J. (1997) The effect of apolipoprotein E on short-term recovery from head injury (Abstract). Neurology 48, A213. 47. Sheng H., Laskowitz D. T., Bennett E., Schmechel D. E., Bart R. D., Saunders A. M., Pearlstein R. D., Roses A. D. and Warner D. S. (1998) Apolipoprotein E isoform-specific differences in outcome from focal ischemia in transgenic mice. J. cereb. Blood Flow Metab. 18, 361–366. 48. Sheng H., Laskowitz D. T., Mackensen G. B., Kudo M., Pearlstein R. D. and Warner D. S. (1999) Apolipoprotein E deficiency worsens outcome from global cerebral ischemia in the mouse. Stroke 30, 1118–1124. 49. Slooter A. J., Tang M. X., van Duijn C. M., Stern Y., Ott A., Bell K., Breteler M. M., Van Broeckhoven C., Tatemichi T. K., Tycko B., Hofman A. and Mayeux R. (1997) Apolipoprotein E epsilon4 and the risk of dementia with stroke. A population-based investigation. Jap. Am. med. Ass. 277, 818–821. 50. Sorbi S., Nacmias B., Piancentini S., Repice A., Latorraca S., Forleo P. and Amaducci L. (1996) Apolipoprotein E genotypes and outcome of posttraumatic coma (Abstract). Neurology 46, A307. 51. Stone D. J., Rozovsky I., Morgan T. E., Anderson C. P. and Finch C. E. (1998) Increased synaptic sprouting in response to estrogen via an apolipoprotein E-dependent mechanism: implications for Alzheimer’s disease. J. Neurosci. 18, 3180–3185. 52. Strittmatter W. J., Saunders A. M., Schmechel D., Pericak-Vance M., Enghild J., Salvesen G. S. and Roses A. D. (1993) Apolipoprotein E: high-avidity binding to beta-amyloid and increased frequency of type 4 allele in late-onset familial Alzheimer disease. Proc. natn. Acad. Sci. USA 90, 1977–1981. 53. Strittmatter W. J., Weisgraber K. H., Goedert M., Saunders A. M., Huang D., Corder E. H., Dong L. M., Jakes R., Alberts M. J., Gilbert J. R., Han S.-H., Hulette C., Einstein G., Schmechel D. E., Pericak-Vance M. A. and Roses A. D. (1994) Hypothesis: microtubule instability and paired helical filament formation in the Alzheimer disease brain are related to apolipoprotein E genotype. Expl Neurol. 125, 163–171. 54. Strittmatter W. J., Weisgraber K. H., Huang D. Y., Dong L. M., Salvesen G. S., Pericak-Vance M., Schmechel D., Saunders A. M., Goldgaber D. and Roses A. D. (1993) Binding of human apolipoprotein E to synthetic amyloid beta peptide: isoform-specific effects and implications for late-onset Alzheimer disease. Proc. natn. Acad. Sci. USA 90, 8098–8102. 55. Szele F. G., Alexander C. and Chesselet M. F. (1995) Expression of molecules associated with neuronal plasticity in the striatum after aspiration and thermocoagulatory lesions of the cerebral cortex in adult rats. J. Neurosci. 15, 4429–4448. 56. Tardiff B. E., Newman M. F., Saunders A. M., Strittmatter W. J., Blumenthal J. A., White W. D., Croughwell N. D., Davis R. D. Jr, Roses A. D. and Reves J. G. (1997) Preliminary report of a genetic basis for cognitive decline after cardiac operations. The Neurologic Outcome Research Group of the Duke Heart Center. Ann. Thoracic Surgery 64, 715–720. 57. Teasdale G. M., Nicoll J. A., Murray G. and Fiddes M. (1997) Association of apolipoprotein E polymorphism with outcome after head injury. Lancet 350, 1069–1071. 58. Teter B., Gilbert J. R., Roses A. D., Xu P. -T., Galasko D., Bu G. and Cole G. M. (1999) Human apoE isotypes differentially modulate mossy fiber sprouting in organotypic hippocamplal slice culture (Abstract). Soc. Neurosci. Abstr. 25, 1346. 59. Weisgraber K. H. (1994) Apolipoprotein E: structure–function relationships. Adv. Prot. Chem. 45, 249–302. (Accepted 8 May 2000)
Pergamon PII: S0306-4522(00)00234-7
Neuroscience Vol. 99, No. 4, pp. 705–710, 2000 705 䉷 2000 IBRO. Published by Elsevier Science Ltd Printed in Great Britain. All rights reserved 0306-4522/00 $20.00+0.00
www.elsevier.com/locate/neuroscience
EXPRESSION OF THE APOLIPOPROTEIN E GENE DOES NOT AFFECT MOTOR RECOVERY AFTER SENSORIMOTOR CORTEX INJURY IN THE MOUSE L. B. GOLDSTEIN,*†‡§ M. P. VITEK,* H. DAWSON* and S. BULLMAN*‡ *Department of Medicine (Neurology) and †Duke Center for Cerebrovascular Disease, Box 3651, Duke University Medical Center, Durham, NC 27710, USA ‡Durham Department of Veterans Affairs Medical Center, Durham, NC, USA
Abstract—Motor recovery after unilateral sensorimotor cortex ablation or sham-injury was measured in apolipoprotein E knockout and wild-type mice by testing their abilities to traverse a narrow beam. All mice trained without difficulty. Sham-operated mice performed perfectly regardless of genotype throughout testing. There was no difference in motor scores between lesioned apolipoprotein E knockout and wild-type mice on a first trial 24 h after injury (P ⬎ 0.05). There was a significant overall effect of lesion on motor performance (two-way repeated measures analysis of variance F1,42 304, P ⬍ 0.0001), a significant time effect (F17,714 58, P ⬍ 0.0001) and a lesion by time interaction (F17,714 58, P ⬍ 0.0001). However, there was no effect of apolipoprotein E genotype group on recovery rate (i.e. there was no lesion group by genotype group by time interaction, F17,714 0.33, P 1.00) and no effect of genotype on the final level of motor performance 12 days after the lesion (Kruskal–Wallis H 5.79, P 0.12). These data suggest that motor recovery after unilateral injury to the sensorimotor cortex does not vary with apolipoprotein E genotype. 䉷 2000 IBRO. Published by Elsevier Science Ltd. All rights reserved. Key words: motor cortex, recovery, knockout mice, locomotion.
Apolipoprotein E (apoE) is a 299 amino acid glycoprotein that was originally described as a lipid-binding molecule with initial studies establishing its important role in cholesterol metabolism. 59 Interest in the neurobiology of apoE increased dramatically with the demonstration that possession of an apoE4 allele increased susceptibility to the development of late onset familial and sporadic Alzheimer’s Disease.5,44,52,54 More recent laboratory and clinical studies suggested that apoE genotype may also play an important role in modulating neurological outcome following different types of brain injury. For example, apoE-deficient mice had poorer outcome after closed head injury 4 as well as focal 23 and global cerebral ischemia. 48 Additional experimental studies indicated that this poorer outcome was isoform specific. For example, the hemiparesis following focal cerebral ischemia was less severe in apoE3 as compared with apoE4 transgenic mice. 47 Consistent with these observations, clinical studies have found an association between the presence of the apoE4 allele and poorer outcome in humans with intracerebral hemorrhage 1 and closed head injury. 30,46,50,57 Chronic traumatic brain injury was found to be more severe in boxers who carried the apoE4 genotype 57 and neurocognitive deficits were greater in patients with an apoE4 allele who underwent cardiopulmonary bypass surgery 56 or who had an ischemic stroke. 49 Outcome after brain injury is affected by factors related to both the initial lesion and to subsequent recovery. 12,13,16,24,32,34,39 The effects of apoE genotype on outcome have been ascribed to both sets of processes. 21,22 For example, apoE may modulate the CNS inflammatory response to injury 22, which depending on genotype, can potentially result
in a less or more severe neurological deficit. In addition, secretion of tumor necrosis factor a, which has been implicated in release of nitric oxide and other reactive oxygen species, 27 was reduced by apoE in mixed glial cultures. 20 Thus, apoE may affect outcome by modulating the pathophysiological consequences of brain damage. These potential effects of apoE, as well as the severity of the initial neurological deficit, must be controlled in clinical studies and experiments designed to investigate its potential impact on the recovery process. Of necessity, clinical studies associating apoE genotype with functional outcome have largely been cross sectional and retrospective, and therefore could not adequately control for these effects. Studies in laboratory animals that have included behavioral measures have generally carried out neurological assessments at a single timepoint and have similar limitations. In the present study, we controlled for the initial severity of the neurological deficit and the potential injury-related secondary modulatory effects of apoE by choosing an injury model minimizing these differences and responses. We thereby isolated the impact of the expression of the apoE gene on behavioral recovery. The behavioral task was adapted from one previously developed in rats and focuses on locomotor function. It was hypothesized that mice lacking apoE would have poorer recoveries as compared to wild-type mice.
EXPERIMENTAL PROCEDURES
Subjects Four-month old male apoE-deficient (apoE knockout, n 23) 35 mice, backcrossed 10 times to the C57BL/6J strain to control for effects of background strain, were obtained from Jackson Labs, Bar Harbor, Maine (strain 002052) for use in this experiment. Age and sex matched wild-type C57BL/6J mice (n 23) served as controls. Mice were housed in a vivarium with a 12-h light/dark cycle and provided with both food and water ad libitum.
§To whom correspondence should be addressed at: Duke Center for Cerebrovascular Disease. Tel.: ⫹1-919-684-3801; fax: ⫹1-919-684-6514. E-mail address: [email protected] (L. B. Goldstein). Abbreviations: apoE, apolipoprotein E; PCR, polymerase chain reaction. 705
706
L. B. Goldstein et al.
right-sided craniotomy extending from approximately 1 mm rostral to 2 mm caudal to the coronal suture and from 1 mm lateral of the sagittal suture to the temporal ridge. For half of the wild-type and half of the apoE-knockout mice, the hindlimb sensorimotor cortex underlying the craniotomy site was removed by gentle suction through a fine glass Pasteur pipette until the underlying white matter was visualized. Shamoperated control wild-type and apoE-knockout mice underwent the identical surgical procedure, but craniotomy was not performed. Thus, there were four groups of mice: wild-type, cortex lesion (n 12); wild-type, sham-cortex lesion (n 11); apoE-knockout, cortex lesion (n 12); and apoE-knockout, sham-cortex lesion (n 11). Beginning 24 h after cortex lesion surgery, the mice were tested on the beam at 1-h intervals for 6 h and then daily over the subsequent 12 days. This testing schedule was selected to facilitate comparisons with our previous work. 6,10,11 The mice were not stimulated in any way during a trial other than with light-noise activation as described above. Lesion extent/histology
Fig. 1. Effects of apoE genotype on beam-walking scores after a right sensorimotor cortex lesion (KO-LES, apoE-knockout, cortex-lesion, n 12; KO-SHAM, apoE-knockout, sham cortex lesion, n 11; WTLES, wild-type, cortex lesion, n 12; WT-SHAM, wild-type, sham cortex lesion, n 11). Time in “hours” and “days” refers to time after the first post-operative beam-walking trial. The first trial, H1, was given 24 h following cortex lesion or sham cortex surgery. The symbols represent the mean (^S.E.M.) beam-walking scores for each trial. Motor performance was rated on a seven-point scale as previously described: 6,8,11 (1) the mouse is unable to place the affected hindpaw on the horizontal surface of the beam; (2) the mouse places the affected hindpaw on the horizontal surface of the beam and maintains balance for at least 5 s; (3) the mouse traverses the beam while dragging the affected hindpaw; (4) the mouse traverses the beam and at least once places the affected hindpaw on the horizontal surface of the beam; (5) the mouse crosses the beam and places the affected hindlimb on the horizontal surface of the beam to aid less than half its steps; (6) the mouse uses the affected hindpaw to aid more than half its steps; and (7) the mouse traverses the beam with no more than two footslips.
Apparatus The behavioral testing apparatus and procedures employed in this experiment were adapted from those used with rats in a series of preliminary studies. Briefly, the apparatus consisted of a 15 × 15 × 15-cm goal box located at one end of a 60 × 0.64-cm elevated wooden beam. The width of the beam was calibrated in preliminary experiments so that lesioned animals would have a consistent, measurable deficit while controls would have normal performance (see below). A switch-activated source of bright light and white noise were located at the start-end of the beam and served as avoidance/activating stimuli. 8 Surgery and behavioral procedures Mice were acclimated to the housing facility and handled daily for at least one-week prior to training at the beam-walking task. For each training or testing trial, the mouse was placed at the start-end of the beam opposite to the goal box. If the animal did not begin to traverse the beam after 10 s, the light and noise stimuli were activated and continued until the mouse’s nose entered the goal box or for a total of 80 s at which time the trial was terminated. On the first day of training, each mouse was given a series of three approximate trials. Motor performance was rated on a seven-point scale as described in the legend for Fig. 1. Subsequent training consisted of one trial on the beam each day until the mouse achieved the maximum possible score. Following training, mice were anesthetized for cortex lesion surgery (pentobarbital sodium 50 mg/kg, i.p.; additional doses were administered as necessary to maintain anesthesia). The mice then underwent a
The day following completion of the behavioral measurements, mice were anesthetized with pentobarbital sodium, killed by decapitation, and the brains were dissected, immediately placed on ice, and then frozen. For histology, the frozen tissue was cryoprotected by immersion in a solution of 25% sucrose in phospahte-buffered saline at 4⬚C. Serial 16-mm coronal sections were then cut on a cryostat. The tissue was mounted, immersed in Cresyl Violet stain, rinsed in water, and then dehydrated by passing through graded ethanol and xylene. Lesion areas were measured for every 10 sections with image analysis software and lesion volumes calculated. Statistical analysis Two-way repeated-measures analysis of variance was used to test the overall significance of differences between groups, the significance of changes in beam-walking scores over time (i.e., recovery rate), and whether there was a group–time interaction (i.e., variation in the rate of recovery among the groups). The Fisher LSD test was subsequently applied in order to determine the significance of differences between groups. For ordinal data, the Kruskal–Wallis test was used to determine the significance of differences among more than two groups and the Dunn Procedure 42 was used for post hoc pairwise comparisons. Cortex lesion size data were analysed by unpaired t-tests for two group comparisons. A P ⬍ 0.05 (two-tailed) was considered statistically significant. Genotype confirmation The genotype of each animal was confirmed with polymerase chain reaction (PCR) on genomic DNA extracted individually from 0.5 cm of the tip of the tail of each animal that were removed and frozen at the time of killing. Mouse genomic DNA was extracted from each tail with a Big Blue DNA isolation kit (Stratagene) according to instructions provided by the manufacturer. For each genomic DNA preparation, 0.01% was used as a template in a 20-ml PCR employing the oligonucleotide primer pairs GTCTCGGCTCTGAACTACATAG (mouseknockout-forward primer) and GCAAGAGGTGATGGTACTCG (mouse-knockout-reverse primer). PCR was performed with AmpliTaq DNA polymerase (AmpliTaq kit, Perkin Elmer Cetus) according to instructions provided by the manufacturer. In this reaction, genomic DNA from C57BL/6J mice permits amplification of a 617 bp DNA fragment with a sequence matching positions 2264–2881 of the mouse apoE gene (Genebank accession number d00466). In contrast, genomic DNA from apoE-knockout mice contains the neomycin resistance gene that has been inserted to disrupt the apoE gene sequence thereby blocking the expression of the apoE protein. Thus, genomic DNA from apoE-knockout mice permits amplification of about a 1400 bp DNA fragment with a sequence that includes the neomycin resistance gene. Using this information, the DNA from each animal that amplified a 600 bp band was scored as a wild-type and those that amplified a 1400 bp band were scored as an apoE-knockout as shown in Fig. 2. Animal care and use committee approval This study was approved by the Animal Care and Use Committees of Duke University and the Durham VA Medical Center and experiments were carried out in accordance with the National Institutes
ApoE and motor recovery
of Health Guide for the Care and Use of Laboratory Animals (NIH Publications 80-23, revised 1978). The experiments were performed with a minimum number of animals and all efforts were made to minimize animal suffering. RESULTS
apoE genotype (wild-type vs knockout) was confirmed for all mice (Fig. 2). Behaviorally, all of the animals were able to master the beam-walking task without difficulty (i.e. apoEknockouts had no difficulty with training). Figure 1 gives the mean (^S.E.M.) motor scores for each group at each time-point. Sham-operated mice continued to perform perfectly throughout testing regardless of apoE genotype. Cortex-lesioned mice had a significant motor deficit on the first testing trial 24 h after the lesion (Kruskal–Wallis H 44.04, P ⬍ 0.0001). However, there was no significant difference in motor scores of cortex-lesioned mice based on apoE genotype (Dunn Procedure, P ⬎ 0.05 for wild-type, cortex-lesioned mice vs apoE-knockout, cortex-lesioned mice). There was a significant overall effect of lesion on motor performance (two-way repeated measures analysis of variance F1,42 304, P ⬍ 0.0001, comparison of cortex lesion vs sham cortex lesion), a significant time effect (F17,714 58, P ⬍ 0.0001, i.e. at least one group had a significant change in scores over time) and a lesion–time interaction (F17,714 58, P ⬍ 0.0001, i.e. motor scores of cortex-lesioned mice changed over time as compared with sham cortex-lesioned mice). However, there was no effect of apoE genotype on either recovery rate (i.e. there was no lesion group–genotype– time interaction, F17,714 0.33, P 1.00) and no effect of genotype on the final level of motor performance 12 days after the lesion (Kruskal–Wallis H 5.79, P 0.12). Measurement of lesion volumes comparing wild-type vs apoE-knockout mice revealed similar lesion extents (mean lesion volume for wild-type mice, 4.17 ^ 0.39 mm 3 vs mean lesion volume for apoE-knockout mice, 3.25 ^ 0.51 mm 3, P 0.18). Given this narrow range of lesion sizes, there was no overall correlation between lesion volume and recovery rate as measured by the areas under the timeeffect curves (r ⫺.013, P ⬍ 0.56) and no correlations between lesion volume and recovery rate for wild-type (r 0.20, P ⬍ 0.55) or apoE-knockout (r ⫺0.27, P ⬍ 0.39) mice. DISCUSSION
Although it was hypothesized that recovery of motor function after injury to the sensorimotor cortex would be impaired in apoE-knockout mice, the main finding of the present
707
experiment was that there was no difference in recovery based on apoE genotype. apoE-knockout and wild-type mice had similar initial motor deficits, virtually identical recovery rates, and indistinguishable final levels of functional ability. This unexpected finding may have important implications for understanding the neurobiological processes underlying apoE-related differences in functional outcome following brain injury. Outcome after a brain injury may be affected by a variety of factors including those associated with the lesion (e.g. lesion size, lesion location), pathophysiological sequellae of the injury (e.g. edema, increased intracranial pressure), potential secondary effects (e.g. delayed neuronal death), and processes related to recovery. The cortex lesion in the present experiment was produced by a suction-ablation technique. This method was chosen for several reasons: (i) it permits highly reproducible lesions of the hindlimb sensorimotor cortex; 9 (ii) because the lesion is the result of actual removal of brain tissue and pathological sequellae are limited, 33,55 lesion size and the accompanying behavioral deficit are maximal at onset and recovery is primarily related to compensatory processes; and (iii) secondary processes associated with other types of injuries such as ischemia, 39,45 concussive trauma, 38 and electrolytic lesions 55 are minimized. Thus, by using a suction-ablation lesion, both the size of the lesion and the initial neurological deficit could be controlled and those processes related to recovery relatively isolated. An effect of apoE on recovery after brain injury (as distinguished from functional outcome alone) is plausible based on evidence from several in vitro studies. Since there are rapid increases in apoE mRNA in the hippocampus after entorhinal cortex lesions, apoE is temporally positioned to participate in recovery processes. 37 apoE may also participate mechanistically in the salvage and re-utilization of non-esterified cholesterol released during terminal breakdown. 36 Estradiolmediated enhancement of synaptic sprouting in the hippocampus in response to entorhinal cortex lesions is absent in apoE-knockout mice, further supporting such a mechanism. 51 Mossy fiber sprouting in hippocampal slice culture, which is absent in apoE-knockout mice, is apparently modulated based on apoE isotype with sprouting in E4 transgenic mice being nearly 60% less effective than in E3 transgenics. 58 Furthermore, in vitro experiments have demonstrated apoE may have neurotrophic effects. 15 These effects may also be isoformspecific, with E3 enhancing and E4 retarding neurite outgrowth. 17,28,29 Based on biochemical studies showing interactions between apoE and tau protein, 41,53 this neurotrophic effect has been hypothesized to be due to differential
Fig. 2. PCR of genomic DNA from individual mice reveals whether their apoE gene is intact (wild-type) or disrupted (knocked-out). Genomic DNA extracted from the tails of mice is used as a template in a standard PCR with primers that amplify a 617 bp DNA fragment from the intact mouse apoE gene from wildtype mice that express mouse apoE protein or a 1400 bp DNA fragment from the disrupted apoE gene found in apoE-knockout mice that fail to express apoE protein. Lane M is for DNA size markers, lanes marked Wild-Type contain the 617 bp DNA fragment found in wild-type mice and Lanes marked ApoEknockout contain the 1400 bp DNA fragment found in apoE-knockout mice.
708
L. B. Goldstein et al.
interactions of the apoE isoforms with microtubules. 29 However, another study found that both apoE3 and apoE4 acted as similar neurotrophic factors in vitro. 40 These differing results might be reconciled based on differences in the culture systems or in the lipid constituents associated with the lipoprotein particle. 58 Such disparate findings, however, underscore the difficulty of extrapolating the results of in vitro studies to the conditions that are found in vivo. There is also some disagreement in published reports regarding the presence or absence of baseline behavioral, physiological and morphological differences between wildtype and apoE-knockout mice. One laboratory was unable to demonstrate any evidence of impaired learning in a study of female apoE-knockout mice. 3 This same laboratory found no differences based on apoE genotype in male mice in a series of neurological tests, water-maze learning, hippocampal ultrastructure, CNS plasticity (hippocampal longterm potentiation and amygdaloid kindling) and no difference in synaptic recovery in the hippocampus after deafferentation. 2 These results led the authors to conclude that either the apoE genotype was of no importance in the maintenance of synaptic integrity and in the processes of CNS repair, or that alternative apolipoproteins compensate for the loss of apoE in the knockout mice. However, another laboratory found severe deficits in spatial learning and memory in sixmonth-old apoE-deficient mice based on testing in the Morris Water Maze. 31 Others have also reported cognitive deficits in apoE-knockout mice 14 which can be ameliorated by infusion of recombinant apoE. 25 Consistent with these findings, electrophysiological experiments demonstrated impaired long-term potentiation in the hippocampus of apoE-deficient mice. 19 Potential explanations for these disparate findings include differences in the sources of the transgenic lines and the types of controls that were used in individual experiments. Many of the studies reporting differences in outcome related to apoE genotype could not, or did not, adequately control for differences in initial severity and/or secondary lesion-related pathophysiological responses; factors that have a critical influence on final outcome. For example, apoE deficient mice have poorer outcome after focal 23 and global cerebral ischemia. 48 Additional experimental studies suggest that this poorer outcome is isoform specific with the hemiparesis following focal cerebral ischemia being less severe in apoE3 as compared with apoE4 transgenic mice. 47 However, these studies lacked serial neurological assessments with functional outcome measured at a single time-point shortly (24 h in two of the studies and 72 h in the third) after injury. Furthermore, histological assessments demonstrated more extensive damage in animals lacking the apoE gene (i.e. the difference in functional outcome may have been related to differences in the extent of injury rather than an effect on their subsequent recovery). A study of motor and cognitive deficits after closed head injury in apoE-deficient mice did include serial behavioral assessments. 4 apoEdeficient mice exhibited more severe motor and learning deficits when compared to non-injured controls. Memory deficits were first assessed 21 days after the injury, and no data are available regarding earlier differences in cognitive function. Motor function was assessed between 1 h and 40 days after injury. The percentage of apoE-deficient mice able to perform these motor tasks was lower than that of controls at all timepoints indicating a differential initial effect of the injury. The
groups diverged after seven days in a neurological severity score, potentially suggesting a difference in late recovery. However, this may have been related to the sensitivity of the tests to detect early differences in view of the differences in motor performance in these same animals. In addition, on histological assessment, brain-injured apoE-deficient mice had greater neuronal loss than brain-injured controls with no difference in the sham-operated animals. Therefore, although the behavioral data from this experiment are consistent with others showing apoE-related differences in outcome, they can not be interpreted as supporting an independent effect on recovery. Several clinical studies have demonstrated differences in outcome following a variety of brain injuries related to apoE genotype. For example, mortality was found to be higher in patients with intracerebral hemorrhage who carried an apoE4 allele. 1 In a second study, there was a trend towards reduced survival in patients with intracerebral hemorrhage with an apoE4 allele. 26 Interestingly, there was improved survival in those apoE4 carriers with ischemic stroke. However, the studies were both retrospective, there was no measure of initial severity and the sole outcome measures were mortality and institutionalization. apoE4 genotype has also been associated with poor outcome after traumatic brain injury. A case report noted an unusual prominence of b-amyloid protein deposition in an individual with dementia pugilistica who was an apoE3/4 heterozygote. 18 This observation was consistent with an earlier report that noted b-amyloid protein deposition following acute, fatal head trauma in patients with the E4 allele. 30 Neither study contained any controlled outcome data. In a prospective study, an association was found between the apoE4 allele and length of unconsciousness and poor clinical outcome six months after traumatic brain injury. 7 Initial Glasgow Coma Scale, a gross measure of injury severity, was worse in patients with the apoE4 allele, partially confounding the analysis. There were no other measures of injury extent or in change of extent over time. Similarly, a higher frequency of the apoE4 allele was found in patients having a poor outcome following prolonged posttraumatic unawareness. 50 Another retrospective study attempting to adjust for injury severity with length of coma, noted a trend towards greater disability in patients with an apoE4 allele. 46 These studies, reported in abstract form, also could not adequately control for injury extent or secondary pathological changes. A prospective study of the effects of apoE polymorphisms in traumatic head injury patients used the Glasgow Coma Scale to assess initial severity and the Glasgow Outcome Scale to assess outcome after six months. 57 Using data provided in the report, patients with the E4 allele had significantly more severe initial deficits than those without the E4 allele. A higher proportion of those with apoE4 had an unfavorable outcome with the association remaining significant after controlling for age, Glasgow Coma Scale score, and brain CT findings (focal mass vs diffuse injury). A significant limitation was that serial brain imaging and serial measures of neurological function were not obtained to exclude the potential contribution of secondary injury. Therefore, although these clinical studies support, to varying degrees, an association between apoE genotype and outcome after intracerebral hemorrhage and traumatic brain injury, none can directly address the specific impact of genotype on the recovery process.
ApoE and motor recovery CONCLUSIONS
There is considerable evidence supporting an effect of apoE on outcome after brain injury. However, the available literature does not provide unequivocal support for the hypothesis that apoE plays a critical role in the recovery process, and we were unable to demonstrate a difference in functional motor recovery after focal injury to the cerebral cortex based on apoE genotype. It should be noted that different strains of inbred mice may respond differently to injury and behave differently in behavioral tests. 43 In addition, it is possible that other apolipoproteins compensated for the absence of apoE in these knockout mice. However, the present data
709
suggest that apoE is not specifically required for motor recovery after cortex injury. The present data can not exclude the possibility that apoE may play a role in recovery after other types of lesions located in other regions of the nervous system. Although apoE plays an important role in the response to brain injury, additional studies are required to determine its precise role in influencing recovery from that injury.
Acknowledgements—Supported by the Department of Veterans Affairs, National Institute on Aging and the Alzheimer’s Association.
REFERENCES
1. Alberts M. J., Graffagnino C., McClenny C., DeLong D., Strittmatter W., Saunders A. M. and Roses A. D. (1995) ApoE genotype and survival from intracerebral haemorrhage. Lancet 346, 575. 2. Anderson R., Barnes J. C., Bliss T. V., Cain D. P., Cambon K., Davies H. A., Errington M. L., Fellows L. A., Gray R. A., Hoh T., Stewart M., Large C. H. and Higgins G. A. (1998) Behavioural, physiological and morphological analysis of a line of apolipoprotein E knockout mouse. Neuroscience 85, 93–110. 3. Anderson R. and and Higgins G. A. (1997) Absence of central cholinergic deficits in ApoE knockout mice. Psychopharmacology 132, 135–144. 4. Chen Y., Lomnitski L., Michaelson D. M. and Shohami E. (1997) Motor and cognitive deficits in apolipoprotein E-deficient mice after closed head injury. Neuroscience 80, 1255–1262. 5. Corder E. H., Saunders A. M., Strittmatter W. J., Schmechel D. E., Gaskell P. C., Small G. W., Roses A. D., Haines J. L. and Pericak-Vance M. A. (1993) Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer’s disease in late onset families. Science 261, 921–923. 6. Feeney D. M., Gonzalez A. and Law W. A. (1982) Amphetamine, haloperidol, and experience interact to affect the rate of recovery after motor cortex injury. Science 217, 855–857. 7. Friedman G., Froom P., Sazbon L., Grinblatt I., Shochina M., Tsenter J., Babaey S., Ben Yehuda A. and Groswasser Z. (1999) Apolipoprotein E-14 genotype predicts a poor outcome in survivors of traumatic brain injury. Neurology 52, 244–248. 8. Goldstein L. B. (1993) Beam-walking in rats: the measurement of motor recovery after injury to the cerebral cortex. Neurosci. Protocols 10, 1–13. 9. Goldstein L. B. (1993) Rapid reliable measurement of lesion parameters for studies of motor recovery after sensorimotor cortex injury in the rat. J. Neurosci. Meth. 48, 35–42. 10. Goldstein L. B. and Davis J. N. (1990) Beam-walking in rats: studies towards developing an animal model of functional recovery after brain injury. J. Neurosci. Meth. 31, 101–107. 11. Goldstein L. B. and Davis J. N. (1990) Influence of lesion size and location on amphetamine-facilitated recovery of beam-walking in rats. Behav. Neurosci. 104, 318–325. 12. Goldstein L. B., Matchar D. B., Morgenlander J. C. and Davis J. N. (1990) Influence of drugs on the recovery of sensorimotor function after stroke. J. Neuro. Rehab. 4, 137–144. 13. Goldstein, L.B. and Sygen in Acute Stroke Study Investigators (1995) Common drugs may influence motor recovery after stroke. Neurology 45, 865–871. 14. Gordon I., Grauer E., Genis I., Sehayek E. and Michaelson D. M. (1995) Memory deficits and cholinergic impairments in apolipoprotein E-deficient mice. Neurosci. Lett. 199, 1–4. 15. Handelmann G. E., Boyles J. K., Weisgraber K. H., Mahley R. W. and Pitas R. E. (1992) Effects of apolipoprotein E, beta-very low density lipoproteins, and cholesterol on the extension of neurites by rabbit dorsal root ganglion neurons in vitro. J. Lip. Res. 33, 1677–1688. 16. Heinemann A. W., Roth E. J., Cichowski K. and Betts H. B. (1989) Multivariate analysis of improvement and outcome following stroke rehabilitation. Arch. Neurol. 44, 1167–1172. 17. Holtzman D. M., Pitas R. E., Kilbridge J., Nathan B., Mahley R. W., Bu G. and Schwartz A. L. (1995) Low density lipoprotein receptor-related protein mediates apolipoprotein E-dependent neurite outgrowth in a central nervous system-derived neuronal cell line. Proc. natn. Acad. Sci. USA 92, 9480–9484. 18. Jordan B. D., Kanik A. B., Horwich M. S., Sweeney D., Relkin N. R., Petito C. K. and Gandy S. (1995) Apolipoprotein E e4 and fatal cerebral amyloid angiopathy associated with dementia pugilistica. Ann. Neurol. 38, 698–699. 19. Krugers H. J., Mulder M., Korf J., Havekes L., de Kloet E. R. and Joels M. (1997) Altered synaptic plasticity in hippocampal CA1 area of apolipoprotein E deficient mice. NeuroReport 8, 2505–2510. 20. Laskowitz D. T., Goel S., Bennett E. R. and Matthew W. D. (1997) Apolipoprotein E suppresses glial cell secretion of TNF alpha. J. Neuroimmunol. 76, 70–74. 21. Laskowitz D. T., Horsburgh K. and Roses A. D. (1998) Apolipoprotein E and the CNS response to injury. J. cereb. Blood Flow Metab. 18, 465–471. 22. Laskowitz D. T. and Roses A. D. (1998) Apolipoprotein E: an expanding role in the neurobiology of disease. Alzheimer’s Reports 1, 5–12. 23. Laskowitz D. T., Sheng H., Bart R. D., Joyner K. A., Roses A. D. and Warner D. S. (1997) Apolipoprotein E-deficient mice have increased susceptibility to focal cerebral ischemia. J. cereb. Blood Flow Metab. 17, 753–758. 24. Lincoln N. B., Blackburn M., Ellis S., Jackson J., Edmans J. A., Nouri F. M., Walrer M. F. and Haworth H. (1989) An investigation of factors affecting progress of patients on a stroke unit. J. Neurol. Neurosurg. Psychiatry 52, 493–496. 25. Masliah E., Samuel W., Veinbergs I., Mallory M., Mante M. and Saitoh T. (1997) Neurodegeneration and cognitive impairment in apoE-deficient mice is ameliorated by infusion of recombinant apoE. Brain Res. 751, 307–314. 26. McCarron M. O., Muir K. W., Weir C. J., Dyker A. G., Bone I., Nicoll J. A. R. and Lees K. R. (1998) The apolipoprotein E 14 allele and outcome in cerebrovascular disease. Stroke 29, 1882–1887. 27. Merrill J. E., Ignarro L. J., Sherman M. P., Melinek J. and Lane T. E. (1993) Microglial cell cytotoxicity of oligodendrocytes is mediated through nitric oxide. J. Immun. 151, 2132–2141. 28. Nathan B. P., Bellosta S., Sanan D. A., Weisgraber K. H., Mahley R. W. and Pitas R. E. (1994) Differential effects of apolipoproteins E3 and E4 on neuronal growth in vitro. Science 264, 850–852. 29. Nathan B. P., Chang K. C., Bellosta S., Brisch E., Ge N., Mahley R. W. and Pitas R. E. (1995) The inhibitory effect of apolipoprotein E4 on neurite outgrowth is associated with microtubule depolymerization. J. biol. Chem. 270, 19,791–19,799. 30. Nicoll J. A. R., Roberts G. W. and Graham D. I. (1995) Apolipoprotein E e4 allele is associated with deposition of amyloid b-protein following head injury. Nature Medicine 1, 135–137. 31. Oitzl M. S., Mulder M., Lucassen P. J., Havekes L. M., Grootendorst J. and de Kloet E. R. (1997) Severe learning deficits in apolipoprotein E-knockout mice in a water maze task. Brain Res. 752, 189–196. 32. Oxbury J. M., Greenhall R. C. D. and Grainger K. M. R. (1975) Predicting the outcome of stroke: acute stage after cerebral infarction. Br. Med. J. 3, 125–127.
710
L. B. Goldstein et al.
33. Pearlson G. D. and Robinson R. G. (1981) Suction lesions of the frontal cerebral cortex in the rat induce assymetrical behavioral and catecholaminergic responses. Brain Res. 218, 233–242. 34. Petito C. K., Feldmann E., Pulsinelli W. A. and Plum F. (1987) Delayed hippocampal damage in humans following cardiopulmonary arrest. Neurology 37, 1281–1286. 35. Piedrahita J. A., Zhang S. H., Hagaman J. R., Oliver P. M. and Maeda N. (1992) Generation of mice carrying a mutant apolipoprotein E gene inactivated by gene targeting in embryonic stem cells. Proc. natn. Acad. Sci. USA 15, 4471–4475. 36. Poirier J., Baccichet A., Dea D. and Gauthier S. (1993) Cholesterol synthesis and lipoprotein reuptake during synaptic remodelling in hippocampus in adult rats. Neuroscience 55, 81–90. 37. Poirier J., Hess M., May P. C. and Finch C. E. (1991) Astrocytic apolipoprotein E mRNA and GFAP mRNA in hippocampus after entorhinal cortex lesioning. Molec. Brain Res. 11, 97–106. 38. Povlishock J. T., Erb D. E. and Arstruc J. (1992) Axonal response to traumatic brain injury: reactive axonal change, deafferentation, and neuroplasticity. J. Neurotrauma 9, S189–S200. 39. Pulsinelli W. A., Brierly J. B. and Plum F. (1982) Temporal profile of neuronal damage in a model of transient forebrain ischemia. Ann. Neurol. 11, 491–498. 40. Puttfarcken P. S., Manelli A. M., Falduto M. T., Getz G. S. and LaDu M. J. (1997) Effect of apolipoprotein E on neurite outgrowth and beta-amyloidinduced toxicity in developing rat primary hippocampal cultures. J. Neurochem. 68, 760–769. 41. Roses A. D. (1994) Apolipoprotein E affects the rate of Alzheimer disease expression: beta-amyloid burden is a secondary consequence dependent on APOE genotype and duration of disease. J. Neuropath. exp. Neurol. 53, 429–437. 42. Rosner B. (1986) Fundamentals of Biostatistics. Duxbury, Boston. 43. Royle S. J., Collins F. C., Rupniak H. T., Barnes J. C. and Anderson R. (1999) Behavioural analysis and susceptibility to CNS injury of four inbred strains of mice. Brain Res. 816, 337–349. 44. Saunders A. M., Strittmatter W. J., Schmechel D., George-Hyslop P. H., Pericak-Vance M. A., Joo S. H., Rosi B. L., Gusella J. F., Crapper-MacLachlan D. R., Alberts M. J., Hulette C., Crain B., Goldgaker D. and Roses A. D. (1993) Association of apolipoprotein E allele epsilon 4 with late-onset familial and sporadic Alzheimer’s disease. Neurology 43, 1467–1472. 45. Saunders D. E., Howe F. A., Van den Boogaart A., McLean M. A., Griffiths J. R. and Brown M. M. (1995) Continuing ischemic damage after acute middle cerebral artery infarction in humans demonstrated by short-echo proton spectroscopy. Stroke 26, 1007–1013. 46. Seliger G., Lichtman S. W., Polsky T. and Riley J. (1997) The effect of apolipoprotein E on short-term recovery from head injury (Abstract). Neurology 48, A213. 47. Sheng H., Laskowitz D. T., Bennett E., Schmechel D. E., Bart R. D., Saunders A. M., Pearlstein R. D., Roses A. D. and Warner D. S. (1998) Apolipoprotein E isoform-specific differences in outcome from focal ischemia in transgenic mice. J. cereb. Blood Flow Metab. 18, 361–366. 48. Sheng H., Laskowitz D. T., Mackensen G. B., Kudo M., Pearlstein R. D. and Warner D. S. (1999) Apolipoprotein E deficiency worsens outcome from global cerebral ischemia in the mouse. Stroke 30, 1118–1124. 49. Slooter A. J., Tang M. X., van Duijn C. M., Stern Y., Ott A., Bell K., Breteler M. M., Van Broeckhoven C., Tatemichi T. K., Tycko B., Hofman A. and Mayeux R. (1997) Apolipoprotein E epsilon4 and the risk of dementia with stroke. A population-based investigation. Jap. Am. med. Ass. 277, 818–821. 50. Sorbi S., Nacmias B., Piancentini S., Repice A., Latorraca S., Forleo P. and Amaducci L. (1996) Apolipoprotein E genotypes and outcome of posttraumatic coma (Abstract). Neurology 46, A307. 51. Stone D. J., Rozovsky I., Morgan T. E., Anderson C. P. and Finch C. E. (1998) Increased synaptic sprouting in response to estrogen via an apolipoprotein E-dependent mechanism: implications for Alzheimer’s disease. J. Neurosci. 18, 3180–3185. 52. Strittmatter W. J., Saunders A. M., Schmechel D., Pericak-Vance M., Enghild J., Salvesen G. S. and Roses A. D. (1993) Apolipoprotein E: high-avidity binding to beta-amyloid and increased frequency of type 4 allele in late-onset familial Alzheimer disease. Proc. natn. Acad. Sci. USA 90, 1977–1981. 53. Strittmatter W. J., Weisgraber K. H., Goedert M., Saunders A. M., Huang D., Corder E. H., Dong L. M., Jakes R., Alberts M. J., Gilbert J. R., Han S.-H., Hulette C., Einstein G., Schmechel D. E., Pericak-Vance M. A. and Roses A. D. (1994) Hypothesis: microtubule instability and paired helical filament formation in the Alzheimer disease brain are related to apolipoprotein E genotype. Expl Neurol. 125, 163–171. 54. Strittmatter W. J., Weisgraber K. H., Huang D. Y., Dong L. M., Salvesen G. S., Pericak-Vance M., Schmechel D., Saunders A. M., Goldgaber D. and Roses A. D. (1993) Binding of human apolipoprotein E to synthetic amyloid beta peptide: isoform-specific effects and implications for late-onset Alzheimer disease. Proc. natn. Acad. Sci. USA 90, 8098–8102. 55. Szele F. G., Alexander C. and Chesselet M. F. (1995) Expression of molecules associated with neuronal plasticity in the striatum after aspiration and thermocoagulatory lesions of the cerebral cortex in adult rats. J. Neurosci. 15, 4429–4448. 56. Tardiff B. E., Newman M. F., Saunders A. M., Strittmatter W. J., Blumenthal J. A., White W. D., Croughwell N. D., Davis R. D. Jr, Roses A. D. and Reves J. G. (1997) Preliminary report of a genetic basis for cognitive decline after cardiac operations. The Neurologic Outcome Research Group of the Duke Heart Center. Ann. Thoracic Surgery 64, 715–720. 57. Teasdale G. M., Nicoll J. A., Murray G. and Fiddes M. (1997) Association of apolipoprotein E polymorphism with outcome after head injury. Lancet 350, 1069–1071. 58. Teter B., Gilbert J. R., Roses A. D., Xu P. -T., Galasko D., Bu G. and Cole G. M. (1999) Human apoE isotypes differentially modulate mossy fiber sprouting in organotypic hippocamplal slice culture (Abstract). Soc. Neurosci. Abstr. 25, 1346. 59. Weisgraber K. H. (1994) Apolipoprotein E: structure–function relationships. Adv. Prot. Chem. 45, 249–302. (Accepted 8 May 2000)