Expression of the chicken GDNF family receptor α-1 as a marker of spermatogonial stem cells

Animal Reproduction Science 142 (2013) 75–83

Contents lists available at ScienceDirect

Animal Reproduction Science journal homepage: www.elsevier.com/locate/anireprosci

Expression of the chicken GDNF family receptor ␣-1 as a marker of spermatogonial stem cells J. Mucksová a , J. Kalina a , M. Bakst b , H. Yan c , J.P.Brillard d , B. Beneˇsová a , B. Fafílek e , J. Hejnar e , P. Trefil a,∗ a

BIOPHARM, Research Institute of Biopharmacy and Veterinary Drugs, a.s., 254 49 Jilove u Prahy, Czech Republic Animal Biotechnology and Biosciences Laboratory, Agricultural Research Service, US Department of Agriculture, Beltsville, MD 20705, USA c HIAVS (Hunan Institute of Animal and Veterinary Science), Quantang, Changsha 410131, Hunan, China d FERTILAVI, 10, rue du 8 Mai, 37360 Rouziers de Touraine, France e IMG, Institute of Molecular Genetics, Academy of Sciences of the Czech Republic, Videnska 1083, CZ-14220 Prague 4, Czech Republic b

a r t i c l e

i n f o

Article history: Received 20 September 2012 Received in revised form 26 July 2013 Accepted 8 August 2013 Available online 4 September 2013 Keywords: GFR␣1 Chicken spermatogonial stem cell Male germ line transplantation

a b s t r a c t The identification, enrichment and subsequent isolation of spermatogonial stem cells (SSCs) are integral to the success of SCC transplants between fertile donor and sterilized recipient males. In birds generally and particularly in chicken, SSC-specific has yet to be identified. The receptor for glial cell-derived neurotrophic factor (GDNF), i.e. GDNF family receptor alpha-1 (GFR␣1), has been identified as a potential marker for different mouse spermatogonial subtypes. In the present study, we characterized the chicken cGFR␣1 receptor and compared its predicted amino-acid sequence with mouse, rat and human GFR␣1 proteins. Using specific polyclonal mouse anti-cGFR␣1 serum, a total of 2.8% cells were recognized as cGFR␣1positive among isolated testicular cells recovered from sexually mature cockerels. The percentages of cGFR␣1-positive testicular cells with haploid, diploid, tetraploid and SP DNA content were 1.6%, 2.5%, 39.3% and 76.8%, respectively. The presence of cGFR␣1 protein on the surfaces of all cells of the seminiferous epithelium was confirmed by immunocytochemical and immunohistochemical analyses. Tissue specificity of cGFR␣1 mRNA expression was significantly higher in adult testes compared to brain tissue which itself was several times higher than tissues prepared from the spleen, liver and heart. No expression was observed in muscular tissue. At last, we demonstrated the successful repopulation of sterilized recipient’s testes with transplanted cGFR␣1-positive donor testicular cells. Recipient males subsequently produced functional heterologous spermatozoa capable of fertilizing an ovum and obtaining chicks with donor cell genotypes. © 2013 Elsevier B.V. All rights reserved.

1. Introduction Spermatogonial stem cell (SSC) transplantation has proven to be an alternative technology of transgenesis in species where blastocyst-mediated transgenic approach

∗ Corresponding author. Tel.: +420 241 950 383; fax: +420 241 950 503. E-mail address: trefi[email protected] (P. Trefil). 0378-4320/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.anireprosci.2013.08.006

has not been developed. Particularly in birds, the success in male germ cell transplantation could open new ways to the preservation of rare breeds or endangered species and more efficient production of transgenic poultry. Allogeneic or even xenogeneic transplantation of testicular cells including the SSCs has already been demonstrated (Lee et al., 2006; Trefil et al., 2006; Pereira et al., 2013) and the possibility of SSC genetic manipulation, at least in vitro, was shown (Kalina et al., 2007). Techniques of enrichment

76

J. Mucksová et al. / Animal Reproduction Science 142 (2013) 75–83

and isolation of SSCs are a pre-requisite for further progress in this field and markers for their identification are highly needed to be established. Dettin et al. (2003) first reported in mice that several subtypes of type A spermatogonia express the glial cellderived neurotrophic factor family membrane receptor ␣-1 (GFR␣1). Glial cell-derived neurotrophic factor (GDNF), a protein member of the transforming growth factor-␤ superfamily produced and secreted by Sertoli cells, binds to GFR␣1 (Viglietto et al., 2000; Meng et al., 2000). GDNF has been shown to activate the proliferation of undifferentiated type As spermatogonia in the mouse, making its receptor, GFR␣1, a candidate marker for the recognition of spermatogonial subtypes (Meng et al., 2000). SSCs express GDNF receptors, i.e., GFR␣1 and c-RET tyrosine kinase receptor which act downstream by activating phosphatidylinositol 3-kinases (PI3K) and/or the Src family of tyrosine kinases. The GDNF signaling pathway, which is regulated by folliclestimulating hormone (FSH), has been shown to be critical in deciding the pathway of daughter SSCs following mitosis (SSC renewal or progression to primary spermatocytes) (Jing et al., 1996). There are divergent reports regarding the expression of GFR␣1 receptor in mammalian testes. It has been suggested that GFR␣1 mRNA and protein are present in spermatogonia as well as in pachytene spermatocytes and round spermatids in the rat (Fouchécourt et al., 2006). In mouse, GFR␣1 protein was described mainly in the SSCs (He et al., 2010), but its presence at the surface of testicular cells in the chicken remains to be established. In the present study, we examined the structural similarities of predicted chicken GFR␣1 (cGFR␣1) with known GFR␣1 homologues previously described in the mouse, rat and human. The expression pattern of cGFR␣1 in several chicken tissues was also examined using quantitative real-time PCR (qRT-PCR). Finally, we cloned the cGFR␣1 transcript for the gene into a GST expression vector (pGEX-5x-3) in order to prepare specific mouse polyclonal antibodies for the selection of type A spermatogonia from cockerel testes, which were used in our transplantation model of germinal cell populations in the chicken (Trefil et al., 2003). 2. Materials and methods 2.1. Experimental animals and irradiation treatment One adult 21-week-old inbred Barred Leghorn (BL; genotype ii, Ee, B/b) male fowl was used as a donor. The six recipient males were 26 week-old (adult) White Leghorns (WL; genotype II). Two males, having the same genetic origin as the recipients, were kept as positive controls while the two other WL males of the same genetic origin were subjected to the same treatment as the recipient males but kept as negative controls. All birds used in these experiments were obtained from the Experimental Animal Farm of the Institute of Molecular Genetics, Prague, Czech Republic. All experiments were performed in accordance with the Czech and French legal requirements for animal handling and welfare. Birds were kept on deep litter floor pen (25,600 cm2 ) equipped with

automatic water nipples and feeders (both provided ad libitum) and subjected to standard husbandry conditions (12:12D photoperiod). Eggs were incubated in a forced air incubator (BIOS MIDI, Czech Republic) adjusted for fowl egg incubation conditions. To sterilize the recipient males, a Theratron T1000 radiation treatment unit (Theratronics International Ltd., Kanata, Ontario, Canada) was used to irradiate WL testes according to the previously described protocol (Trefil et al., 2006). Briefly, each male was subjected to five irradiations (8 Gy each) repeated at 3–4 day intervals. 2.2. Chicken germ line cell transplantation model Phenotypic identification of one-day-old chicks hatched from ova fertilized by heterologous spermatozoa was made possible by using feather markers (Trefil et al., 2006, 2010). Briefly, GFR␣1 positive testicular cells from BL donors possessed a barred phenotype due to homozygous recessive (ii) alleles at the I (white) locus while the WL sterilized males were homozygous dominant (II) at the I (white) locus. 2.3. Quantitative RT-PCR analysis In order to examine the organ-specific expression pattern of cGFR␣1, qRT-PCR was carried out with cDNA samples prepared from various chicken organs. Organ samples were isolated from the testis, brain, muscle, liver, spleen and heart of euthanized donor males, quickly removed and washed in phosphate-buffered saline (PBS). Total RNA from each organ was extracted with Ultraspec II RNA reagent (BIOTECX Laboratories, USA) according to the manufacturer’s protocol and then analyzed in a NanoDrop Spectrophotometer (Thermo Scientific, USA) for RNA purity and quantification. RNA samples (1 ␮g per reaction) were DNase treated and reverse transcribed to cDNA using Transcriptor High Fidelity cDNA Synthesis Kit (ROCHE) according to the manufacturer’s instruction. Quantitative RT-PCR was performed using the DNA thermal cycler Mx3005P (Stratagene, USA). The SYBR® Green I double-stranded DNA binding dye (Finzymes, Finland) was chosen as the fluorescent marker for these assays. Fifty nanograms of cDNA were used as a template per reaction. Quantitative RT-PCR was performed for each sample in triplicate in a total volume of 25 ␮l, consisting of 12.5 ␮l SYBR® Green I Master Mix, 0.5 ␮l ROX reference dye diluted 1:500, 1.25 ␮l primer mix (900 nM/250 nM final concentrations respectively), 5.75 ␮l RNase/DNasefree water, and 5 ␮l diluted c DNA (25 ng RNA). All reaction plates were run under identical cycle conditions, 95 ◦ C for 10 min, the samples for qRT-PCR were subjected to 40 cycles, each consisting of a denaturing step at 95 ◦ C for 10 s, an annealing step at 60 ◦ C for 30 s and an extension at 72 ◦ C for 30 s. The fluorescence threshold was set at 0.2 and the resulting cycle threshold values (Ct) normalized to the reference gene were used for analysis. The negative controls were comprised of the same qRT-PCR reaction mix as samples without the addition of enzyme. The primers used for amplification of each transcript (GAPDH forward 5 CATCGTGCACCACCAACTG,

J. Mucksová et al. / Animal Reproduction Science 142 (2013) 75–83

GAPDH reverse 5 CGCTGGGATGATGTTCTGG and cGFR␣1 forward 5 GAGGCGGCAGACTATTGTTC, cGFR␣1 reverse 5 GGAGGCAGTCAGCGTAGTTC) were synthesized (Sigma) with forward and reverse primers being localized in different exons to ensure that amplicons were cDNA-specific and not a consequence of genomic DNA contamination. GAPDH was used as an internal housekeeping control. The expression profile of each sample was calculated by the Ct method and normalized to the freshly prepared chicken embryonic fibroblast sample with lowest expression levels for all markers as the calibrator. 2.4. Expression of cGFR˛1 protein in Escherichia coli The cGFR␣1 gene fragment containing suitable restriction sites (BamHI/Sal I) at the 5 and 3 ends was generated by PCR amplification from testicular cDNA. PCR primers (fGFBamHI: TACGTGGGATCCCAGAAGTCAGCGG and fGFSalI: ATGTCGACCTACAAGACGACTGATGA) were designed using web-based software (Primer3, Genefisher). PCR was performed in a total volume of 25 ␮l, consisting of 2.5 ␮l TrueStart Polymerase Buffer, 2.5 ␮l MgCl2 , 0.5 ␮l dNTP, 0.4 ␮l TrueStart Polymerase (all Fermentas, Lithuania), 10 pmol of each primer, 3 ␮l of reverse transcription product and filled up to the final volume with double-distilled water. PCR was initiated with a denaturation at 95 ◦ C for 3 min and cycled 38 times at 95 ◦ C for 30 s, 60 ◦ C for 30 s, and then 72 ◦ C for 50 s. A final extension at 72 ◦ C for 5 min was performed after cycling. Double-distilled water was included as a negative control. PCR products were resolved on a 1.5% agarose gel, stained with Sybr Green and visualized in a transilluminator (Bio-Rad, USA). Both ends of the amplified fragment was then modified with BamHI/SalI restrictases and subcloned in-frame into a GST expression vector (pGEX-5x-3, GE Healthcare) and the correct open reading frame was confirmed by DNA sequencing. In order to allow cGFR␣1 protein translation in E. coli, we transformed pGEx plasmids into Rosetta2 E. coli cells (Novagen, USA). The cGFR␣1 recombinant protein was isolated from denatured inclusion bodies using the Rapid GST Inclusion Body Solubilization and Renaturation kit (CELL BIOLABS, USA). High quantities of the GST fusion protein were obtained by inducing protein production in the E. coli with IPTG for several hours, after which cells were harvested and lysed by sonication. GST fusion protein was purified on Gluthathione Sepharose 4B. The required level of protein concentration was prepared using centrifugal filtration (Centricon, USA). 2.5. Preparation of mouse polyclonal antibodies Chicken GFR␣1 recombinant protein was then used for the intraperitoneal immunization of mice (Balb/c). Recombinant protein was injected four times after 12 days (100 ␮g per dose). Recombinant protein was diluted in Freund’s adjuvant to produce specific polyclonal antibodies. Sera were tested for cGFR␣1 reactive antibodies using an enzyme-linked immunosorbent assay (ELISA). The ELISA reaction was completed in 96-well plates (Costar Corp., Cambridge, MA), recombinant protein was diluted to a final concentration of 10 ␮g/ml in carbonate buffer and

77

incubated at 4 ◦ C overnight. After washing the remaining protein-binding sites were blocked by adding 5% non fat dry milk in PBS for 2 h. The primary mouse polyclonal antibodies were diluted in four-fold serial dilution and incubated for 2 h at room temperature. HRP-conjugated secondary antibody (goat anti mouse IgG, Sigma) was diluted 1/500 in blocking buffer. After 1 h and washing substrate solution (with OPD) was added (100 ␮l per well) and the optical densities were recorded by the Chameleon Microplate reader (Hidex, Finland) at 490-nm wavelength. The ELISA experiments were repeated in triplicate for each serum sample. The optimal antiserum concentration was determined and its specificity verified using flow cytometry in various testicular cell populations. 2.6. Multiple sequence alignment of GFR˛1 proteins The predicted cGFR␣1 mRNA sequence was obtained from the BLAST search of the Chicken Genome Database at the University of California, Santa Cruz (Karolchik et al., 2008) and for the respective GenBank sequence (cGFR␣1: XM 205102) from the National Centre for Biotechnology Information (NCBI) (Benson et al., 2004). Amino acid sequence of the cGFR␣1 protein (XP 990433) was compared to the GFR␣1 proteins of human (AAB 97371), mouse (NP 034409), and rat (NP 037091) using the CLC Protein WorkBench software (CLC bio, Denmark). The percent homology between the cGFR␣1 protein and its orthologues in human, mouse and rat was determined using the NCBI BLAST2 engine (Tatusova and Madden, 1999). 2.7. Preparation and purification of adult testicular cells and flow cytometry For the male germ line transplantation experiments (Trefil et al., 2006), testicular cells were initially isolated using a two-step collagenase digestion (Collagenase Type I, BIOCHROM AG, Germany) in order to remove interstitial cells (Trefil et al., 2010). For the detection of cGFR␣1 surface marker, the dispersed testicular cells were incubated on ice for 50 min with mouse serum against recombinant cGFR␣1 diluted 1:40 in 0.1% gelatin in PBS. FITC-conjugated goat anti-mouse IgM and IgG 1:400 (Jackson ImmunoResearch Laboratory, West Grove, PA, USA) was used as a secondary antibody. The cGFR␣1-stained cells were subsequently used for flow cytometry experiments performed at FACS Vantage SE flow cytometer (Becton Dickinson, Franklin Lakes, NJ) equipped with a two-stream argonhelium laser (Coherent Enterprise EE, Orsay, France) and a FlowJo software (Tree Star Inc., Ashland, OR, USA). Propidium iodide (PI) at a concentration of 5 ␮g/ml was used as a counter-stain to exclude non-viable cells (red fluorescence of their nuclei). The identification of several testicular cell populations was performed on the basis of their DNA content using testicular cell suspensions stained with Hoechst 33342 (H342) diluted in PBS (90 min at 37 ◦ C) at a final concentration of 5 ␮M. The analyses of cell cycle in these cells were performed from cell suspensions stained for 30 min with 10 ␮M H342 diluted in PBS at room temperature (Mucksova et al., 2009). The various categories of cells stained by H342 were excited by a UV laser adjusted

78

J. Mucksová et al. / Animal Reproduction Science 142 (2013) 75–83

at 50 mV using a combination of two filters (485 nm longpass and 505 nm short-pass) in front of the first detector, while cell populations stained with PI were detected with a 682 nm/22 nm bandpass filter in front of the second detector. The immunocytochemical analysis of cGFR␣1 positive cells was performed using a confocal microscope Olympus FV1000 (Olympus, GmbH Mannheim, Germany). 2.8. In situ hybridization and immunohistochemistry The in situ hybridization was performed on paraformaldehyde-fixed cryostat sections obtained from unfixed frozen testes specimens or on paraffin-embedded sections. To localize the mRNA encoding for cGFR␣1 within adult cockerel testes, both sense and anti-sense probes were prepared by in vitro transcription of cGFR␣1. The cGFR␣1 coding sequence was subcloned into pBluescript SK II (Stratagene). The construct was linearized, and digoxigenin-labeled antisense RNA and control sense probes were in vitro-transcribed using the DIG RNA Labeling Kit (Roche Applied Science) according to the manufacturer’s instructions. The 3 -DIG oligonucleotide probe (Roche) was detected with alkaline phosphatase conjugated sheep anti-digoxigenin Fab antibody (Roche). The sites of hybridization were visualized by the colorimetric reaction of the enzyme conjugate with 5-bromo-4-chloro3-indolyl phosphate (BCIP) and nitro blue tetrazolium (NBT) mixture. The samples were observed by immersing slides in Mowiol. For paraffin embedding, samples were fixed for 24 h in Bouin’s solution, washed in PBS (Invitrogen) for 15 min at 4 ◦ C, dehydrated at 4 ◦ C for 15 min in 50% ethanol, washed twice in 70% ethanol, and embedded using standard procedures. Sections were cut at 5 ␮m and mounted on slides (ProbeOn Plus; Fisher Scientific). For staining, sections were deparaffinized and rehydrated through a series of graded alcohols at room temperature. For antigen retrieval, tissues sections were boiled in 0.01 M citrate buffer (pH 6.0) for 20 min and then cooled for 10 min. Sections were incubated in a solution of 5% not fat milk + 10% normal mouse serum (Sigma) in PBS (1 h, room temperature) to block non-specific binding. For immunohistochemical staining, sections were incubated overnight at 4 ◦ C in a sealed, humidified chamber with the same primary antibodies used as for flow cytometry (mouse primary polyclonal antibodies for recombinant cGFR␣1 diluted 1:40). PE-conjugated goat anti-mouse IgM 1:200 (Jackson ImmunoResearch Laboratory, West Grove, PA, USA) was used as a secondary antibody and sections were examined with an Olympus IX81 microscope (Olympus, GmbH Mannheim, Germany). Negative controls were performed by excluding primary antibodies. 2.9. Selection of cGFR˛1-positive cells, transplantation, and assessment of the sperm output These methods were described in our previous study (Trefil et al., 2010). Briefly, polyclonal mouse anti-cGFR␣1 antibodies (diluted 1:40) were applied to the freshly isolated suspension of adult cockerel testicular cells and

after 30 min at 4 ◦ C, the secondary antibodies (goat anti mouse IgG) conjugated with biotin (diluted 1:200) was added. cGFR␣1-positive cells were selected using magnetic activated cell sorting (MACS) according to Dynal (Norway) instructions. Approximately 250 ␮l of the dispersed cGFR␣1-positive testicular cells with cell densities varying from 105 to 106 cells/ml were injected at five different locations into both testes of anaesthetized recipient WL males. Ejaculates from transplanted and control males were collected once a week for 7 weeks using the abdominal massage technique described by Burrows and Quinn (1937). 2.10. Artificial insemination with semen from transplanted males Outbred BL hens were inseminated with semen collected from WL recipient males in which semen production resumed 5–7 weeks after transplantation. Six hens were inseminated twice a week for 5 weeks with individual ejaculates from transplanted males producing spermatozoa. Eggs (32 eggs per hen) were incubated in four weekly batches under standard incubation conditions. Weekly intra-vaginal inseminations were performed with 2 × 105 spermatozoa per hen for 7 weeks. The percentage of hatched eggs was determined from the number of hatched eggs divided by the total number of eggs incubated. 2.11. Statistical analysis Relative quantification of gene expression was calculated using the Ct method. t test (Excel 2007) was performed for calculated values. 3. Results 3.1. Comparison of cGFR˛1 with orthologous mammalian gene products The predicted gene sequence of cGFR␣ was obtained from NCBI GenBank assembly of the chicken genome. GFR␣1 maps to the chicken chromosome 6 (Chromosome 6, NC 006093.2 (30088281–30225382, complement; ID: 395994)). The predicted mRNA sequence of cGFR␣1 contains an open reading frame of 1407 bp to be translated into a 469-amino acid protein. The cGFR␣1 protein consists of twenty one S/T-S/T motifs, three nuclear localization signals (K-R/K-X-R/K, in which X represents any amino acid) (Roberts, 1989), six potential phosphorylation sites for protein kinase C (S/T-X-R/K) (Kishimoto et al., 1985), and ten potential phosphorylation sites for casein kinase II (S/T-XX-D/E) (Pinna, 1990). Ten DNA-binding sites, five out of six potential phosphorylation sites for protein kinase C, two nuclear localization signals, and two amino-acid triplet in domain 2 (MLF and RRR) were previously reported to ˜ be important for GDNF binding (Scott and Ibánez, 2001) and are present in cGFR␣1. Six out of ten casein kinase II phosphorylation sites of cGFR␣1 were found conserved in mammalian GFR␣1 orthologues (Fig. 1). Multiple sequence alignment and the percentage homology of cGFR␣1 with mammalian GFR␣1 proteins over the entire amino-acid

J. Mucksová et al. / Animal Reproduction Science 142 (2013) 75–83

79

Fig. 1. Multiple amino acid sequence alignment of GFR␣1 proteins. Amino acid sequences of known GFR␣1proteins from human (hGFR␣1), mice (mGFR␣1), and rat (rGFR␣1) were compared with the predicted cGFR␣1 using the CLC Protein WorkBench program. Dots indicate amino acids identical to mammalian GFR␣1 while dashes represent gaps in the sequence. Amino acid sequences shown in boxes are as follows: 1 – DNA binding sites (S/T-S/T motifs); 2 – nuclear localization signal (K-R/K-X-R/K, where X represents any amino acid); 3 – protein kinase C phosphorylation site (S/T-X-R/K); 4 – casein kinase-II phosphorylation site (S/T-X-X-D/E) and GDNF binding site (MLF, RRR), which are conserved in both mammalian and cGFR␣1.

sequence indicated significant similarities and conservation of the main structural motifs (Fig. 1). The protein sequence identity between cGFR␣1 and GFR␣1 in human, mouse and rat was 77.31%, 77.52% and 77.31% respectively (Table 1).

(Bakst et al., 2007). Dead cells were not visible because they were outside the frame of the diagram. Control of the elimination of dead cells was made possible by using PI staining (excitation wavelength: 488 nm). 3.3. Intracellular and cell type-specific display of cGFR␣1

3.2. cGFR␣1 positivity in chicken testicular cells Using the flow cytometry, we estimated the percentage of cGFR␣1-positive cells in preparates of testicular cells isolated and purified for male germ line transplantation experiments (Trefil et al., 2006). We detected 2.8% cGFR␣1positive cells in the crude preparates of testicular cells from adult donors. In separate analyses of various cell populations based on H342 nuclear staining, the percentages of cGFR␣1-positive testicular cells with haploid, diploid, tetraploid and side population (SP) DNA content were 1.6%, 2.5%, 39.3% and 76.8%, respectively (Fig. 2). Fluorescence intensity was measured as a linear scale. Some cell types displayed a shift of fluorescence into red light after staining with H342. Among the various cell categories, the SP cells were sorted on the basis of three additive criteria: diploid DNA content, low side scatter, and small nuclear diameter

In the fraction of cGFR␣1-positive cells, cGFR␣1 was localized on the surface of dispersed testicular cells (Fig. 3). In order to better localize the cGFR␣1 expression in intact testicular tissue, we used the method of in situ hybridization. The mRNA encoding cGFR␣1 was detected mainly in cells close to the basement membrane enveloping the seminiferous tubule (Fig. 4A). Negative control prepared with 5 -DIG oligonucleotide probe did not show any specific signal (Fig. 4B). Sections of testis tissue (Fig. 4C) stained with the mouse serum against recombinant cGFR␣1 revealed two distinct positive cell populations in the seminiferous epithelium: one adjacent to the basement membrane enveloping the seminiferous tubule, and the other associated with and just above the elongated spermatids. 3.4. Organ-specific cGFR˛1 expression

Table 1 Percentage identitya of aligned protein sequences of chicken, human, mouse, and rat GFR␣1. cGFR␣1 cGFR␣1 (Gallus gallus) mGFR␣1 (Mus musculus) rGFR␣1 (Rattus norvegicus) hGFR␣1 (Homo sapiens) a

77.52 77.31 77.73

mGFR␣1

rGFR␣1

hGFR␣1

77.52

77.31 97.65

77.73 92.95 92.74

97.65 92.95

Determined using the NCBI blastp engine.

92.74

Strikingly different levels of the cGFR␣1transcript were observed in brain, testes, spleen, liver and heart of adult cockerels. The highest expression of cGFR␣1 mRNA was detected in the adult testis, moderate expression in the brain (about 5 times less than in testis, p < 0.05) and only slight expression in the spleen, liver and heart. No cGFR␣1 mRNA was detected in muscle tissue of 24-week-old chicks (Fig. 5).

80

J. Mucksová et al. / Animal Reproduction Science 142 (2013) 75–83

Fig. 2. Flow cytometry analysis of cGFR␣1-positive adult cockerel testicular cells fluorescence. (A) Dual-parameter flow cytometry analysis of GFR␣-1 positive adult testicular cell cycle stained with H342 and PI. The population of adult testicular cells consisted of haploid (c) testicular cells, diploid (2c) cells in G1 phase, tetraploid cells and premeiotic spermatocytes I (4c) in G2/M phase of the cell cycle. (B) Percentages of cGFR␣1-positive testicular cells with haploid, diploid, tetraploid and SP DNA contents. Visible populations of adult tetraploid testicular cells, premeiotic spermatocytes I (4c), diploid testicular cells (2c), haploid spermatids (c) and specific population of testicular cells referred to as SP cells.

3.5. Restoration of spermatogenesis after transfer of cGFR˛1-positive testicular cells In order to prove the assumption that cGFR␣1-positive testicular cells are the spermatogonial cells with stem capacity, we performed the transfer of sorted cGFR␣1positive testicular cells from adult fertile donors into two sterilized recipients and monitored the appearance of heterologous spermatozoa. About 8 weeks after transplantation, one of two recipient males began to produce semen when manually collected. Sperm numbers increased in that male over the next 7 weeks. The two age-matched sterilized but non-transplanted males failed to produce semen after attempts at manual semen collection. Fertility of the recipient with restored semen production was demonstrated by successful production of progeny with donor cell phenotypes. The system of phenotype markers in our germ line transplantation model was described previously (Trefil et al., 2006). In the course of 7 weeks, six hens were inseminated with semen collected from the successfully transplanted cockerel. Of the 190 eggs collected, only twenty (10.5%) were fertile and fifteen hatched (7.9%). Of the hatched chicks, twelve (80%) expressed the following donor phenotypes: barred cockerels (ii, Ee, B/b or Ee, B/B or ee, B/B or ee, B/b genotype), black hens (ii, Ee, b- or ee, b-), or barter hens (Ee, B- or ee, B-), see Fig. 6. The remaining three chicks feathered white (Ii) suggesting that donor sterilization was incomplete.

4. Discussion We investigated the presence and expression of the chicken orthologue of GFR␣1, a cell surface receptor of the GDNF family that had been previously described in the seminiferous epithelium of the mouse, rat and human.

Fig. 3. Display of cGFR␣1 on the surface of a diploid testicular cell from adult cockerel. Stained with mouse serum against recombinant cGFR␣1, detected with anti-mouse IgG and IgM conjugated to FITC. Nucleus stained with DAPI.

J. Mucksová et al. / Animal Reproduction Science 142 (2013) 75–83

81

Fig. 4. Localization of cGFR␣1 expression in testes. (A) In situ hybridization of cGFR␣1 mRNA in sections of frozen testes visualized by the colorimetric reaction of the enzyme conjugated with a BCIP and NBT mixture, 3 -DIG oligonucleotide probe was detected with alkaline phosphatase conjugated sheep anti-digoxigenin Fab antibody. mRNA-positive cells encoding cGFR␣1 (dark purple color) were detected close the membrane of seminiferous tubules. Magnification 400× (left) and 800× (right). (B) In situ hybridization of cGFR␣1 mRNA in sections of frozen testes, negative control prepared with 5 -DIG oligonucleotide probe alone. Magnification 400×. (C) Immunohistochemistry of seminiferous tubules from adult cockerels stained with mouse serum against recombinant chicken GFR␣1 detected with an anti-mouse IgM conjugated to PE. Magnification 400×.

In the present study, cGFR␣1 was selected as a candidate marker for the identification of chicken spermatogonia based on the observations that its mouse orthologue is present on the surface of a specific population of mouse spermatogonia likely to be representative of SSCs

Fig. 5. Expression of cGFR␣1 gene in various chicken organs analyzed using qRT-PCR. The threshold cycle (Ct) of gene was normalized to an endogenous housekeeping gene, cGAPDH. Relative quantification of gene expression was calculated using the Ct method. Values on the y-axis show the relative expression of cGFR␣1/cGAPDH. Each bar represents the mean S.E.M. of three independent experiments.

(Hofmann et al., 2005). In addition, these authors were able to describe the signaling pathways that may play a crucial role in maintaining SSC proliferation and renewal. We report that cGFR␣1 was detected in the following cell

Fig. 6. F1 chicken generation after the transfer of cGFR␣1-positive testicular cells. Black or barred plumage in the progeny (F1 generation) revealed successful cGFR␣1 selected germ transfer, white plumage indicates incomplete sterilization of the recipient.

82

J. Mucksová et al. / Animal Reproduction Science 142 (2013) 75–83

categories isolated by flow cytometry: diploid spermatogonia, tetraploid preleptotene spermatocytes, secondary spermatocytes and haploid spermatids (Fig. 2). However, two distinct positive cell populations were observed by immunohistochemistry, one located in the vicinity of the basement membrane of seminiferous tubules and another between or just above elongated spermatids, possibly representing spermatogonia and haploid spermatids, respectively. In order to support the functional similarities and/or dissimilarities of GFR␣1 between species, we compared the structural organization of cGFR␣1 and its conservation in reference to mammalian orthologues. Indeed, the predicted amino acid sequence of cGFR␣1 shares the potential functional moieties and displays strong similarities with human, mouse and rat GFR␣1 proteins. This unequivocally indicates that all described members of GFR␣1 family have similar functions. However, some differences in structural features between the chicken and mammalian GFR␣1 receptors suggest that one or more functions influenced by GFR␣1 may be differentially expressed between the avian and mammalian classes. Using flow cytometry analyses, we could identify a total of 2.8% cGFR␣1 positive cells in the isolated testicular cells from adult chickens while in the mouse, the percentages of GFR␣1 positive cells reached 1.9% (Buageaw et al., 2005) and 1.73% (Grisanti et al., 2009). Besides variations caused by technical differences in the experimental approaches to quantify GFR␣1-positive populations (flow cytometry in this study vs. MACS in mouse studies), such differences, albeit relatively minor, may indicate species-specific subpopulations of spermatogonia. The total DNA content of the mature chicken’s testes was previously described by Mucksova et al. (2009). These authors reported a total of 57.8% haploid (c), 19.0% diploid (2c), 8.4% tetraploid (4c) and 1.3% side population (SP). In the present study, analyses based on nuclear staining of the nuclei by H342 indicated that the percentages of cGFR␣1positive testicular cells with haploid, diploid, tetraploid and SP DNA content were 1.6%, 2.5%, 39.3% and 76.8%, respectively. In human, Grisanti et al. (2009) reported percentages of hGFR␣1 positive cells reaching 1.4–1.5% of the SP isolated from adult testicular cells. In mouse, rat and human, GFR␣1 positive cells in the testes had been identified as pale or dark spermatogonia, resulting in the recognition of GFR␣1 as a reliable marker of spermatogonia (Hofmann et al., 2005; Kokkinaki et al., 2010; Davidoff et al., 2001; Kamimura et al., 2002). In conclusion, the present study demonstrates that cGFR␣1 is expressed in several chicken tissues including the testes, brain, spleen, liver and heart while no labeling was observed in muscle tissue. Additional observations based on immunocytochemical and immunohistochemical approaches revealed that cGFR␣1 positive cells are present in several categories of testicular cells with the highest expression observed in the SP cell category. The SP cells possess several morphological characteristics (nuclear size, intra-tubular distribution) of the SSC population in the chicken. Unfortunately, there are no reliable morphological criteria or readily identifiable surface markers to

differentiate SSCs from the other spermatogonial subtype. Consequently, the precise number of SSC transferred into each male recipient is not known. We suspect that a significant percentage of the transferred cells did not seed the seminiferous epithelium but were lost to the interstitial spaces. Ogawa et al. (1997, 2000) noted that the number of colonies re-colonizing seminiferous tubules was indicative of the number of stem spermatogonia transferred to the recipient in mice. In conclusion, about 80% (12 chicks) of the fertilized eggs from hens inseminated with heterologous semen were fertilized with sperm derived from the donor cGFR␣1-positive cell population. This is higher percentage than in the case of c-Kit-positive cells (Trefil et al., 2010), however, the low numbers of recipients examinated in both studies do not allow to draw firm conclusions about the efficiency. When optimized, this approach could be an alternative to PGC manipulation and gene transfer in avian species. Furthermore, this technique can also be used as a means to restore endangered or lost lines of birds, thus opening new approaches to preservation of genetic resources in avian species. Acknowledgements We would like to thank Zdenˇek Cimburek for FACS analyses. This research was supported by Grant No. ME10104 from the Grant Agency of the Ministry of Education of the Czech Republic, Grant No. QJ1210041 from the National Agency for Agriculture Research and Grant No. P502/11/2207 awarded by the Grant Agency of the Czech Republic. References Bakst, M.R., Akuffo, V., Trefil, P., Brillard, J.P., 2007. Morphological and histochemical characterization of the seminiferous epithelial and Leydig cells of the turkey. Anim. Reprod. Sci. 97, 303–313. Benson, D.A., Karsch-Mizrachi, I., Lipman, D.J., Ostell, J., Wheeler, D.L., 2004. GenBank: update. Nucleic Acids Res. 32, D23–D26. Buageaw, A., Sukhwani, M., Ben-Yehudah, A., Ehmcke, J., Rawe, V.Y., Pholpramool, C., Orwig, K.E., Schlatt, S., 2005. GDNF family receptor alpha1 phenotype of spermatogonial stem cells in immature mouse testes. Biol. Reprod. 73 (5), 1011–1016. Burrows, W.H., Quinn, J.P., 1937. Collection of spermatozoa from domestic chicken and turkey. Poult. Sci. 16, 19–24. Davidoff, M.S., Middendorff, R., Koeva, Y., Pusch, W., Jezek, D., Müller, D., 2001. Glial cell line-derived neurotrophic factor (GDNF) and its receptors GFRalpha-1 and GFRalpha-2 in the human testis. Ital. J. Anat. Embryol. 106 (2), 173–180. Dettin, L., Ravindranath, N., Hofmann, M.C., Dym, M., 2003. Morphological characterization of the spermatogonial subtypes in the neonatal mouse testis. Biol. Reprod. 69 (5), 1565–1571. Fouchécourt, S., Godet, M., Sabido, O., Durand, P., 2006. Glial cell-linederived neurotropic factor and its receptors are expressed by germinal and somatic cells of the rat testis. J. Endocrinol. 190 (1), 59–71. Grisanti, L., Falciatori, I., Grasso, M., Dovere, L., Fera, S., Muciaccia, B., Fuso, A., Berno, V., Boitani, C., Stefanini, M., Vicini, E., 2009. Identification of spermatogonial stem cell subsets by morphological analysis and prospective isolation. Stem Cells 27, 3043–3052. He, Z., Kokkinaki, M., Jiang, J., Dobrinski, I., Dym, M., 2010. Isolation, characterization, and culture of human spermatogonia. Biol. Reprod. 82, 363–372. Hofmann, M.C., Braydlich-Stolle, L., Dym, M., 2005. Isolation of male germline stem cells, influence of GDNF. Dev. Biol. 279 (1), 114–124. Jing, S., Wen, D., Yu, Y., Holst, P.L., Luo, Y., Fang, M., Tamir, R., Antonio, L., Hu, Z., Cupples, R., Louis, J.C., Hu, S., 1996. GDNF-induced activation of the ret protein tyrosine kinase is mediated by GDNFR-alpha a novel receptor for GDNF. Cell 85, 1113–1124.

J. Mucksová et al. / Animal Reproduction Science 142 (2013) 75–83 Kalina, J., Senigl, F., Micakova, A., Mucksova, J., Blazkova, J., Yan, H., Poplstein, M., Hejnar, J., Trefil, P., 2007. Retrovirus-mediated in vitro gene transfer into chicken male germ line cells. Reproduction 134, 445–453. Kamimura, Y., Chiba, H., Utsumi, H., Gotoh, T., Tobioka, H., Sawada, N., 2002. Barrier function of microvessels and roles of glial cell linederived neurotrophic factor in the rat testis. Med. Electron Microsc. 35 (3), 139–145. Karolchik, D., Kuhn, R.M., Baertsch, R., Barber, G.P., Clawson, H., Diekhans, M., Giardine, B., Harte, R.A., Hinrichs, A.S., Hsu, F., et al., 2008. The UCSC genome browser database: 2008 update. Nucleic Acids Res. 36, D773–D779. Kishimoto, A., Nishiyama, K., Nakanishi, H., Uratsuji, Y., Nomura, H., Takeyama, Y., Nishizuka, Y., 1985. Studies on the phosphorylation of myelin basic protein by protein kinase C and adenosine 3 :5 -monophosphate-dependent protein kinase. J. Biol. Chem. 260, 12492–12499. Kokkinaki, M., Lee, T.L., He, Z., Jiang, J., Golestaneh, N., Hofmann, M.C., Chan, W.Y., Dym, M., 2010. Age affects gene expression in mouse spermatogonial stem/progenitor cells. Reproduction 139, 1011–1020. Lee, Y.M., Jung, J.G., Kim, J.N., Park, T.S., Kim, T.M., Shin, S.S., Kang, D.K., Lim, J.M., Han, J.Y., 2006. A testis-mediated germline chimera production based on transfer of chicken testicular cells directly into heterologous testes. Biol. Reprod. 75, 380–386. Meng, X., Lindahl, M., Hyvonen, M.E., Parvinen, M., De Rooij, D.G., Hess, M.W., Raatikainen-Ahokas, A., Sainio, K., Rauvala, H., Lakso, M., et al., 2000. Regulation of cell fate decision of undifferentiated spermatogonia by GDNF. Science 287, 1489–1493. Mucksova, J., Brillard, J.-P., Hejnar, J., Poplstein, M., Kalina, J., Bakst, M., Yan, H., Trefil, P., 2009. Identification of various testicular cell populations in pubertal and adult cockerels. Anim. Reprod. Sci. 114 (4), 415–422. Ogawa, T., Arechag, J.M., Avarbock, M.R., Brinster, R.L., 1997. Transplantation of testis germinal cells into mouse seminiferous tubules. Int. J. Dev. Biol. 41, 111–122.

83

Ogawa, T., Dobrinski, I., Avarbock, M.R., Brinster, R.L., 2000. Transplantation of male germ line stem cells restores fertility in infertile mice. Nat. Med. 6, 29–34. Pereira, R.J., Napolitano, A., Garcia-Pereira, F.L., Baldo, C.F., Suhr, S.T., King, L.E., Cibeli, J.B., Karcher, D.M., McNiel, E.A., Perez, G.I., 2013. Conservation of avian germplasm by xenogeneic transplantation of spermatogonia from sexually mature donors. Stem Cells 22, 735–749. Pinna, L.A., 1990. Casein kinase 2: an ‘eminence grise’ in cellular regulation? Biochim. Biophys. Acta 1054, 267–284. Roberts, B., 1989. Nuclear location signal-mediated protein transport. Biochim. Biophys. Acta 1008, 263–280. ˜ Scott, R., Ibánez, C.F., 2001. Determinants of ligand binding specificity in the glial cell line-derived neurotrophic factor family receptor alpha S. J. Biol. Chem. 276, 1450–1458. Tatusova, T.A., Madden, T.L., 1999. BLAST2 sequences, a new tool for comparing protein and nucleotide sequences. FEMS Microbiol. Lett. 174, 247–250. Trefil, P., Polak, J., Poplstein, M., Mikus, M., Kotrbova, A., Rozinek, J., 2003. Preparation of chicken testes as recipient organs to germ-line chimeras by means of gamma-radiation. Br. Poult. Sci. 44, 643–650. Trefil, P., Micakova, A., Mucksova, J., Hejnar, J., Poplstein, M., Bakst, M.R., Kalina, J., Brillard, J.P., 2006. Restoration of spermatogenesis and male fertility by transplantation of dispersed testicular cells in the chicken. Biol. Reprod. 75 (4), 575–581. Trefil, P., Bakst, M.R., Yan, H., Hejnar, J., Kalina, J., Mucksova, J., 2010. Restoration of spermatogenesis after transplantation of cKit positive testicular cells in the fowl. Theriogenology 74 (9), 1670–1676. Viglietto, G., Dolci, S., Bruni, P.B., Baldassarre, G., Chiariotti, L., Melillo, R.M., Salvatore, G., Chiapetta, G., Sferratore, F., Fusco, A., Santoro, M., 2000. Glial cell line-derived neutrotropic factor and neurturin can act as paracrine growth factors stimulating DNA synthesis of Ret-expressing spermatogonia. Int. J. Oncol. 16, 689–694.