- Email: [email protected]
Expression of the Chlamydia trachomatis major outer membrane protein-encoding gene in Escherichia coli: role of the 3′ end in mRNA stability
Gene. 87 (1990) 97-103 Elsevier
97
GENE 03392
Expression of the Chlamydia trachomatis major outer membrane protein-encoding gene in F.scherichia coli: role of the 3' end in mRNA stability (Recombinant DNA; gene product; monoclonal antibodies; minicells; epitope; phage Avectors; preprocessed pol)T,eptide; leader polypeptide)
Ravi Kaul, Matthew J.J. Duncan, James Guest and Wanda M. Wenman Division of Infectious Diseases, Department of Pediatrics. Universityof Alberta, Edmonton, Alberta (T6G 2R7 Canada) Received by R. E. Yasbin: 19 May 1989 Revised: 31 August 1989 Accepted: 12 September 1989
SUMMARY
The major outer membrane protein (MOMP)-encoding gene (ompl) of Chlamydia trachomatis has been cloned into Escherichia coil and partially sequenced. This recombinant gene expresses a full-length 40-kDa product, which is recognized by a monoclonal antibody directed against the species-specific epitope of MOMP. The recombinant ompl is expressed in either insertion orientation, indicating that it utilizes its own promoter system. The endogenous ompl promoter po,,;sesses a relatively low activity despite the high level of MOMP expression. Deletion of a 520-bp fragment at the 3' end encoding 39 amino acids (aa) at the C terminus and the remainder of the noncoding region leads to a significant decrease in rnRNA stability and loss of protein synthesis. When the MOMP-encoding plasmid was introduced into E. coil miniceils, it exp~ssed 40- and 43-kDa proteins; however, inhibition of post-translational processing by ethanol revealed only a 43-kDa protein. These data indicate that the unprocessed ompl gene product contains a 22-an leader sequence which is cleaved during translocation to the outer membrane, to yield a processed 40-kDa protein. The recombinant MOMP was localized to the outer membrane E. coli fraction, comparable to the location of the native C. trachomatis protein.
INTRODUCTION
C. trachomatisis a major human pathogen responsible for a wide range of infections including lymphogranuloma Correspondence to: Dr. R. Kaul, 2C3.77 Walter MacKenzie Centre, University of Alberta, Edmonton, Alberta (T6G2R7 Canada) Tel. (403)492-6631; Fax (403)492-3030. Abbreviations: aa, amino acid(s); Ap, ampicillin; bp, base pair(s); C., Chlamydia; EB, elementary bodies; ELISA, enzyme-linked immunosorbent assay; GalK, galactokinase K; Ig, immunoglobulin; IPTG, isopropyl-p-v-thiogalactopyranoside; kb, 1000bp; mAb, monoclonal antibodies; MCS, multiple cloning site; MOMP, major outer membrane protein; ompl, gene encoding MOMP; nt, nucleotide(s); ORF, open reading flame; PAGE, polyacrylamide-gelelectrophoresis; RB, reticulate bodies; Ri, rifampicin; SDS, sodium dodecyl sulfate; SSC, 0.15 M NaCl/0.015 M Na3" citrate pH 7.6; u, units; YT, 0.8% Bacto tryptone/5% Bacto yeast extract/0.5% NaCl; [ ], denotes plasmid-carrier state. 0378-1119/90/$03.50© 1990ElsevierSciencePublishersB.V.(BiomedicalDivision)
venereum (serovars LI-3), trachoma (serovars A-C), inclusion conjunctivitis and genital tract infections (serovars D-K) (Schachter and Caldwell, 1980). The pathogen displays a unique developmental cycle consisting of extracellular infectious EB and intracellular non-infectious RB (Moulder, 1974). The EB surface is composed of a MOMP which accounts for nearly 60 ~o of the total cell wall protein synthesized during chlamydial growth (Caldwell et al., 1981). Evidence suggests that MOMP, in conjunction with other outer membrane proteins, contributes to the structural integrity of the rigid form of EB due to inter- and intramolecular disulfide bonding (Hatch etal., 1984; Newhall and Jones, 1983). Recently, two groups have succeeded in cloning and sequencing the C. trachomatisompl in E. coil(Pickett et al., 1987; Stephens et al., 1985; 1986). The immunoblot analysis of a recombinant lysogen revealed a fusion protein that
98 represents a 15-kDa C-terminal peptide of the chlamydial MOMP rather than the entire 40-kDa full-length protein. Stephens et al. (1985) suggest that transcription is initiated with lacZ proceeding through an ORF until a stop signal is encountered. Alternatively, Pickett et al. (1987) speculate that the initial transcript necessitates fusion to a promoter reco,~Lmizedin E. coli. In either case expression of the fulllength translational product in E. coP. was not demonstrated by these authors. We describe the full-length translation of the C. trachomatis ompl from its endogenous promoter in E. cog and the role of the 3' end in mRNA stability and protein expression. Evidence is also presented to support the processing of a precursor MOMP product prior to translocation across the membrane.
(Pickett et al., 1987) which was provided by I.N. Clarke, University of Southampton (U.K.). Hybridization was carded out at 38 °C twice in 2 x SSC containing 0.2~ SDS and once in 0.2 x SSC. After drying, the fdters were autoradiographed overnight using Kodak X-Omat AR film. From nearly 1000 recombinants two plaques hybridized to the probe. DNA was prepared from these recombinants and cleaved with BamHI. A 9.2-kb chlamydial DNA insert was obtained from each plaque that hybridized strongly to the 17-mer probe on Southern blots. The insert was mapped with restriction endonucleases and compared to the pt,,bfished sequence (Pickett et al., 1987; Stephens et al., 1986). An internal 2. l-kb DraI fragment, derived from the original 9.2-kb BamHl fragment encoding MOMP, was subcloned into the Sinai site of pUCI8; this recombinant plasmid, designated pCT40118, was used to transform E. coli JM83.
MATERIALS AND METHODS
(d) Monoclonal antibody BALB/c mice were immunized subcutaneously with whole EB mixed with Freund's complete adjuvant, followed two weeks later with Freund's incomplete adjuvant. One week after the last injection an intraperitoneal booster dose was administered. Spleen lymphocytes and mouse mydoma cells Sp2/0 were fused with polyethylene glycol 4000 supplemented with 5~o (v/v) dimethyl sulfoxide. Hybrids surviving in HAT medium containing hypoxanthine, aminopterin and thymidine (Szybalska and Szybalski, 1962) were tested by ELISA and reactive hybridomas were cloned by dilution. Hybrids of monoclonal origin were injected intraperitoneally into pristine primed BALB/c mice and ascitic fluid containing high-titer mAb, IgG class, was collected. One clone from these mAbs reacted with all strains of the species C. trachomatis tested by ELISA. This mAb, designated F6 and specifying the species-specific domain of MOMP, was used for immmloblotting and immune precipitations. An additional mAb, KG5, used for immunoblotting was provided by R. Barnes, CDC, Atlanta, GA. This antibody also specifies the species-specific domain (Barnes et al., 1985). Identical results were obtained with F6 and KG5 in parallel experiments.
(a) Bacterial strains C. trachomatis serovar I..2 (L2/434/Bu) obtained from ATCC was used for preparation of chromosomal DNA. Chlamydiae were grown in HeLa 229 cells for 48 h and purified through Renografin as described previously (Kuo et al., 1977). The bacterial strains used were E. cog JM83 (Vieira and Messing, 1982), E. cog P678-54 (Adler et al., 1967) and £. cog ED5363 (McKenney etal., 1981) as recipients for DNA transformations. ]'he plasmids employed were pUCI8, pUCI9 and pKO4. E. coil was grown routinely in 2 × YT medium and cells harbouring plasmids were grown in 100 ~tg Ap/ml. (b) DNA isolation and manipulation Chromosomal DNA was isolated from purified EB as described earlier (Wenman and Lovett, 1982). Plasmid vector DNA was isolated and purified by CsCI gradient centrifugation. Chromosomal DNA was completely digested with BamHl and sized on a 0.7% agarose gel; DNA fragments (9-12 kb) were transferred electrophoretically onto DEAE and subsequently recovered according to the supplier's instructions (Schleicher & Schuell, Inc.). Pooled DNA fragments were ligated to BamHI-digested, alkaline phosphatase-treated phage ~EMBL4. The ligated DNA was packaged using the Boehringer-Mannheim packaging extract kit. Phages were plated out and amplified in E. coil NM539. (c) Plaque hybridization The amplified clone bank in bacteriophage ~EMBL4 was plated out in E. coli NM539. Plaques were transferred to Millipore nitrocellulose membrane discs which were processed essentially according to Benton and Davis (1977). Recombinant plaques were hybridized to a 17-mer probe homologous to the species-specific region of ompl
(e) Localization of recombinant protein on Escherichia coU cells The inner and outer membrane fractions of E. coli JM83 harbouring pCT40118 were separated as described earlier (Kaul et al., 1987). The periplasmic proteins were separated by the cold-shock procedure of Dougan et al. (1983) while the cytoplasmic proteins were prepared from spheroplasts. RESULTS AND DISCUSSION
(a) Expression of chlamydial MOMP in Escherichia coli A recombinantcontaining a 2.1-kb Dral fragment of the
99 C. trachomatis omp] in vector pUCI8, designated I), was transformed into E. coliJM83. The cells were harvested and proteins resolved by SDS-PAGE, followed by immunoblot analysis using mAb directed to the species-specific MOMP domain (mAb F6 or KG5). A highly antigenic polypeptide of 40 kDa, identical in size and mobility to C. trachomatisMOMP, was identified (Fig. 2A). The Dral fragment from plasmid pCT40118 was excised using Kpnl and BamHl sites on the vector which flank the Smal site ofpUClS. This Kpnl-BamHl fragment encoding the C. trachomatis ompl was subcloned into pUCI8 and pUC 19 and designated pCT40218 and pCT40319, respectively. Fig. 1 shows the construction and expression of these recombinants. Subsequently a deletion mutant pCT40218d was generated by deleting a 520-bp XbalBamHl fragment at the 3' end ofpCT40218. This truncated recombinant revealed no expression ofMOMP polypeptide by immunoblot analysis compared to parental recombinants (Fig. 2A). However., a faint antigenic band of approx. 37.5 kDa was visualized when excessive amounts of truncated protein were immunoblotted (Fig. 2B).
C. trachommis MOMP. Other common bands between
pUCI8 and pCT40018 represent vector-derived gene pro-
p C T 4 0 1 1 8 (Fig.
1
2 3 4 5 6
-94
:!~ii
O f t
XEMBL4
NMS3
~Ct40
ornlgl expression
pUCl8
JM83
pCt40-I I 8
x~E ill
JM83
~Ct40-216
pUCI9
JM83
~Ct40-319
pUCI 8
JM83
)Ct 40-218d
.
~
N0. ÷
"'11
LXXXXXXI
pUCI8
Immuno blot assay
map
e pc
B
is shown,
Name * e8-'t"~.~. ft It
'
Fig, 2. lmmunoblot analysis of the cMamydial MOMP synthesized by £. cob"JM83 harbouring various recombinant plasmids. Positive recombinants, identified by Ap resistance and lack of ~.galactosidase, were grown in YT broth. The cells were harvested, suspended in electrophoresis buffer containing 2% SDS and 5% p-mereaptoethanol, and boiled for 3 rain. Proteins were separated by 0.1% SDS/10% PAGE and transferred to nitroceHnlose (Towbin et al.~ 1979), Blots were then reacted with mAb to MOMP followed by probing with t25I-labelled protein A and autoradiography. (Panel A) Lanes: !, pCT40218d; 2, I~"F40118; 3,pCT40218; 4,pCT40319; 5,pUCI8; 6,serovar 1.2 EB. Lanes I-5 contain 50pg while lane6 contains 10Fg total resolved protein. (Panel B) Lanes: !, pCT40218; 2, pCT40218d containing 80 Fg and 200 ~tg of total protein. Mobility of molecular size standards (in kDa)
Recombinant clones
Host strain
--67
A
(b) Expression of ehlamydial MOMP in EscherieMa coli minieells Recombinants containing pCT40118 and pCT40218d were transformed into E. carl minicell strain p67854, for which 3SS-labelled gone products were subjected to SDS-PAGE followed by autoradiography. Fig. 3 shows a faint band of approx. 43 kDa and a strongly expressed protein of approx. 40 kDa which migrates with native
Vector used
12
'"
i%. X X X X X ~ N I
gg~.~.a~m~--~--N~
Duc
,a
cxb E
Es, x
~uc
puc
?
cxb
c
ESo x
~puc
,,
[--=s
puc xb E
ES. x
,,
,
'
" '
,
~puc
+
4,
+
Fig. 1. Construction of ompl expression plasmids. A linearized physical map of inserted sequences is shown along with their expression as monitored by immunoblot assay using monoclonal antibodies directed towards the species specific domain (KG$ or F6) as described in RESULTS AND DISCUSSION, section a. The arrow shows the direction of transcription from the vector promoter. Only the relevant restriction sites are shown. Abbreviations: B, BamHl; C, Clal; D, Dral; E, EcoRl; K, Kpnl; S; Smal; Sa, Sau3A; X, Xhol; Xb, Xbal. The hatched bars represent the subcloned fragments that were sequenced in both directions.
I00
1
2
3
m
4
5
N
6
•
7
443 "440 437.5
432 .429
Fig. 3. Identification ofchlamydial MOMP synthesized byE. coli 1)67854 minicells. Minicells harbouring the desired plasmids were grown to stationary phase and purified by sucrose density centrifugation. The cells were labelled with [35S]methionine (Gill et ai., 1979) and then labelled polypeptides were analyzed by SDS-PAGE. Alternatively, minicells were incubated for 15 min at 37°C in labelling medium containing 8.3% ethanol and [3SS]methionine (Palva et al., 1981). The gels were soaked in water for I h and then in I M Na. salicylate for an additional hour, before vacuum drying and autoradiography were performed. Autoradiograph of a 0.1% SDS/10% polyacrylamide gel containing 3SS-labelled polypeptides synthesized by E. coil minicells harbouring pUCI8 (lanes I, 2), pCT40218 (lanes 3 and 4) and pCT40218d (lane 6 and 7). Lanes 1, 3 and 6 represent products synthesized in the absence of ethanol while lanes 2, 4 and 7 represent products synthesized in the presence of 9.2% ethanol. Lane 5 contains [35S]cysteine.labelled EB. Approximately 30 pg of protein was loaded on each lane.
ducts. The comparison of the inferred aa sequence with that derived from the N terminus of MOMP suggests that normal processing of ¢. trachomatb MOMP involves the cleavage of a 22-aa leader peptide for translocation to the outer membrane (Nano et al., 1985; Stephens et al., 1986). This 22-aa leader sequence accounts for a 2.7-kDa peptide, leading us to hypothesize that the 43-kDa protein we observed was unprocessed MOMP containing a 22-aa legder sequence. Proteolytic processing responsible for the cleavage of a signal peptide is not fully effective in minicells (Dougan et al., 1983) which may explain the presence of the minor unprocessed product of 43 kDa. In E. coli, however, this leader sequence is cleaved efficiently and a product of 40 kDa transported to the outer membranes. To investigate this possibility, proteolytic processing in minicells was inhibited by labelling the cells in the presence of ethanol. Only a 43-kDa polypeptide was synthesized. The pUC-encoded p-lactamase was also obtained solely as unprocessed poly-
peptide in the presence of ethanol (Fig. 3, lanes 2, 4, 7). However, two proteins of 37.5 kDa and 40 kDa were synthesized in the absence of ethanol (lane 6) and a 40-kDa protein was synthesized in the presence of ethanol (lane 7) by minicells harbouring pCT40218d. MOMP from other Gram- organisms possess leader or signal sequences for vectorial transport to their surface location (Holland et al., 1986; MOiler and Blobel, 1984). Although up to 75~ of the total ompl product has been obtained from the lacZ promoter in E. coli (Pickett et al., 1988), this product was localized in the cytoplasm as insoluble inclusions, possibly because it lacked the N-terminal region of the protein. (c) Stability and decay of MOMP transcripts in Escherichia coli The inability of the truncated recombinant E. coli[pCT40218d] to express ompl could be related either to the instability of mRNA due to endonucleolytic cleavage or to post-translational degradation. These possibilities were studied by examining the degradation of mRNA species after the addition of Ri to inhibit initiation of transcription. Fig. 4 shows the Northern-blot analysis of total RNA prepared at different time points after Ri addition from both control and truncated recombinant. Approximately 90~o less mRNA was present in E. coli[pCT40118d] than in the parental recombinant E. coli[pCT40118] at time 0 min.
1 2 3 4 5 6
A
123456
B
Fig. 4. Determination of MOMP mRNA stability by Northern-blot hybridization. Cells harbouring the recombinants were grown at 37°C in LB broth containing 100 pg Ap/ml and 0.1 mM IPTG to a density of approx. 2 x i0 s cells per ml. Transcription was inhibited by the addition of 200 ttg Ri/ml. Samples were collected at various time intervals followod immediately by chilling on ice. Total RNA was extracted from £. coli[pCT40218] (panel A), or its deletion derivative (panel B) by the hot phenol method (yon Gabain et al., 1983) resolved on i % agarose gel and analyzed by Northern-blot hybridization using the cloned Kpnl-Xbal fragment (which encodes the truncated gene product) as a probe. The decay rates ofthe transcripts were determined by densitometric scanning ofthe autoradiograms essentially as described earlier (Baga et 8.1., 1988). Lanes I-6 represent samples withdrawn at 0, 2, 4, 6,10 and 15 min alter treatment with Ri.
101 Densitometric tracings showed a clear difference in rates of degradation: an mRNA half life of 0.6 min for pCT402 lgd compared to 8.0 mitt for pCT40118. These data demonstrate that mRNA transcripts ofthe deletion mutant are less stable than those of the parental recombinant. Very little is known about the factors involved in decay processes ofmRNA. However, RNA stability is believed to be enhanced by palindromic sequences in E. coli which form hairpin loops in mRHA, preventing RNA degradation by endonucleolytic c~avage (Stem et al., 1984). Sequence data support the existence of an 1l-bp dyad downstream from the proximal stop codon (Stephens et al., 1986).
(d) Cellular localization of MOMP in Escheridda coil The cellular localization of chlamydiai MOMP was examined in E. coli pCT40118 using immunoblot analysis. Most of MOMP was located in the outer membrane fraction of E. coli as is the case with native C. trachomatis MOMP (Fig. 5). The recombinant protein was also accessible to MAb on the surface of viable E. coli as demonstrated by dot blot anaiysis (not shown). (e) Promoter studies Restriction endonuclease analysis of pCT40118 demonstrated that ompl is located in the same orientation as the lacZp promoter of pUC 18. To test the dependence of ompl 1
30
2
3
4
5 6 7 1 2
567
34
on the lacZp, the BamHI-Kpnl fragment was subcloned into pUCI8 and pucIg. Expression of a product was obtained in either orientation. Earlier workers using phage ~gt I 1 and ~L47.1 detected a/l-gaiactosidase fusion product that represents a 15-kDa C-terminal end of chlamydial MOMP (Pickett et al., 1987; Stephens et al., 1955). It was therefore believed that ompl does not uti,~e its own promoters in an £. coli system. Recently, chlanectin, an 18-kDa eukaryotic cell-binding protein from C. trachomatis was produced in E. coil when placed under vector promoter control (Kaul et al., 1987). These observations, coupled to the finding that chlamydial promoters lack homology to optimal E. coli consensus sequences, suggest that recognition sequences for chlamydiai RNA polymerase differ from those of E. coil Similar observations have been made with chlamydial rRNA operons from the murine biovar (Engel and Ganem, 1987). Next, to evaluate the strength and activity of the ompl promoter a 0.7-kb EcoRI-Sau3A fragment was inserted into the promoter assessment vector pKO4. This fragment contains the entire region upstream from the ompl ORF (including 18 bp of vector) as well as the first 35 aa of unprocessed MOMP. Chimeras containing this fragment with pKO4 demonstrated GaiK activity on MacConkey agar galactose plates. The GaiK assay was done exactly as described by McKenney etai. (1981). Compared to a background activity of 2.044 u (nmol of galactose phosphorylated per min at A6so) the pCT40118 promoter induced activity to 6.67 u. Both of these activities were low compared with that of the iacZp (70.5 u). Stephens et ai. (1988) identified tandem promoters designated PI and P2 upstream from ompl with very low levels of activity using cat gene expression in E. coil The existence of weak promoters despite the high level of ompl expression which we observed suggests that MOMP, its mRNA or both, may be exceptionally stable within E. coll. Pulse-chase experiments reinforced the stable nature of MOMP in C. trachomatisinfected HeLa cells (Newhall, 1987).
~
A
El
Fig. 5. 5ubcellular localization of C. ~,-achw~zatisMOMP in E, mlf IM83 transformed with pCT40118. Approximately equivalent amounts of various cell fractions were eleetrophoresed on 0.1% 5DS/12.5~ polyacrylamide gels. (Panel A)Coomassie blue-stained gel. Lanes: !, C. trachomatis serovar 1-2 EB; 2, unfractionated E. coli lM83 [pUC18 ] ; 3,unfractionated recombinant harboaring pCT40118; 4,outer membrane; 5, periplasma; 6, inner membrane; 7, cytoplasm. (Panel B) Immunoblot of the gel in panel A (containing half the concentration of protein samples used in panel A except lane I which contains approx. I/s ofthe protein concentration) reacted with mAb F6. The star indicates the MOMP polypeptide as visualized by Coomassie blue staining.
(f) Nueleotide sequence To determine whether the observed differences in expression and translocation reflect any functionally important change in the N-tcr~;,~ region, we sequenced a 689-bp Kpnl-F,coRI of pCT40118 which encodes the tandem promoter sequences as well as the first 38 aa of the translation region (Fig. 6). Comparison of the sequence in this region with that of Stephens et al. (1988) shows a total of 4 nt alterations. However, these discrepancies were located outside the tandem promoters and the N-terminal translation region. Although the cause for such variations is not clear these minor differences cannot explain the discrepancies in expression, even though they may fall within the functional boundaries of tandem promoters.
102 GGTACCC~CACTTTCTTTGTAGTAATtAAAa,CGATTTCTATCAAAACA~TTCTTAGATTTT 66 CTT~TCTCCTCTTTTCTTTTAGCCAAACCCCCATCTTCGAGCTATTCCAAACAC~-A/~T 132 CTTAGGTTTTGGAAATTAACAACTCATAAAAATTGAACTGTTTTGTAATTAACTCAAAACCCTCTC! 98 ATTCTCAACAATCP~.MATTGCCAACATGGCTTTTGCTCTCGGTTTCACAC, CGATTTTTTTCGCA 264 AAAACCAAGAACATAPAACATAAAAAGATATACAAAAATGGCTCTCTGCTTTATCGCTAAATCAGG 330 AGGCGCTTAAGGGCTTCTTCCTGGGACGAACGTTTTTCTTATCAACTTTACGAGAATAAGNL~eITT396 TTGTTATGGTCTCGAGCATT~CGACATGTTCTCGATTAAGGCTGCTTTTACTTGCAAGACATTC462 CTCAGGCCATTAATTGCTACAGGACATCTTGTCTGGCTTTAACTAGGACGCAGTGCCGCCAOA/~e~ 528 1 AGATAGCGAGCACAAAGAGAGCTAATTATAC~ATTTAGAGGTAAGA ATG AAA AAA CTC Met LUs LU$ Leu
586
S 20 TTG AAA TCO GTA TTA GTG TTT GCC GCT TTG AGT TCT GCT TCC TCC TTG Leu Ltjs Ser Yel Leu Yel Phe Ale Ale Leu Ser Ser Ale Set Ser Lee
634
21 36 CAA GCT CTG CCT GTG GGG AAT CCT GCT GAA CCA AGC CTT ATG ATC GAC GIn Ale Leu Pro Yei GltJ Ash Pro Ale Glu ,Pro Ser Lee Met lie Asp
682
37 GOA ATT C GI~j lie
689
Fig.6. The completesequenceof a 689-bpKpnl-EcoRlfragment,comprising the 5' end was determined by the dideoxy chain-termination method(Sangeret al., 1977)usingM13mpl8 and M13mp!9 recombinant clones.The underlinednt representthe differencebetweenthis sequence and that of Stephenset al. (! 986).Vectorsequenceslieupstreamfromthe arrow. The numbers above the sequence refer to aa residues from the translational site, while the nt positions are numbered on the fight margin.
resulted in significantly reduced antigenic expression. This loss of antigenicity was ascribed to decreased stability of ompl transcripts; the parental ompl transcript possesses a halflife ofg.0 min compared to its deletion mutant's halt'life of 0.6 min. (4) When the ompl gene was analyzed in minicelis, it expressed a complete unprocessed gene product of 43 kDa and a major processed product of 40 kDa which comigrated with 35S-labelled MOMP from C. trachomags serovar 1.2. In the presence of ethanol only the unprocessed 43-kDa product is produced in minicells. However, in the recombinant E. coil the 22-aa leader sequence is cleaved during translocation and a 40-kDa product is produced on the outer membrane. (5) Nucleotide sequencing of a 500-bp fragment encoding the type-specific domain of MOMP revealed one nt switch from C to G, which did not affect the aa code of the fragment. The cloning, identification and partial characterization of the C. trachomatb ompl and its promoters will facilitate understanding the developmental regulation of this organism. It may also help to define the role of leader peptide in protein translation and assembly.
ACKNOWLEDGEMENTS Serovar specificity was confLvmed by sequencing a 0.5-kb EcoRl fragment between aa 80 and 247, the type-specific domain of MOMP. No difference in nt sequence except a C-to-G shit~ (from GGC to GGG) at aa 157 was observed. This change did not, however, affect the deduced aa sequence. Sequence variation within the same serovar has been observed by Hart et al, (1988) also,
(g) Conclusions (1) We have isolated an E. coli recombinant that expresses a 40-kDa polypeptide identical in size, antigenicity and mobility to native EB MOMP. The recombinant MOMP, analogous to the native C. trachomatb protein, is located in the outer membrane fraction of E. coil, and is immunoaccessible. (2) The presence of functional promoters on the ompl gene was confLrmed by the expression of MOMP in pCT40319, where the lacZp is oriented opposite to the inserted gene. Promoter strength was quantitated using an expression assessment vector pKO4. Low levels of activity were observed with ompl promoters compared to the lacZp, suggesting the existence of weak promoters despite the high levels of ompl expression. (3) The 3' end of the ompl gene is essential for RNA stability and expression of the ompl product. Deletion of a 520-bp fragment at the 3' end of the gene encoding the terminal 30 aa and the remainder of the noncoding regions
This work was supported by grants from the Canadian Medical Research Council (MA7951) and University of Alberta Central Research Fund. W.M.W. is a scholar ofthe Alberta Heritage Foundation for Medical Research. We thank I. Clarke, University of Southampton, for providing a MOMP species-specific oligodeoxyribonucleotide; R. Barnes, CDC, Atlanta, for providing monoclonal antibody KG5; R. Meuser for technical help and L. Frost, University of Alberta, for providing plasmid pKO4 and E. coli ED 5363.
REFERENCES Adler, H.I., Fisher, W.D., Cohen, A. and Hardigree, A.A.: Miniature Escherichlacoilcellsdeficientin DNA. Proc. Natl. Acad. Sci.USA 57 (1987) 321-326. Baga, M., Goransson, M., Normark, S. and Uhlin, B.E.: Processed mRNAwith differentialstabilityin the regulationofE. colipilingene expression. Cell 52 (1988) 197-206. Barnes, R.C., Wang, S.P., Kuo, C.C. and Stamm,W.E.: Rapid immunotypingof Chlamydiatrachomagswithmonoclonalantibodiesin a solid phase enzymeimmunoassay.J. Clin. Microbiol. 22 (1985)609-613. Benton, W.D. and Davis, R.W.: Screening2,gt recombinant clones by hybridization to singleplaque in situ. Science 196 (1977) 180-182. Caldwell,H.D., Kromhout,J. and Schachter,J.: Purificationand partial characterizationofthe majorouter membraneprotein of Chlamydia trachomatb.Infect. Immun. 35 (1981) 1161-1176.
103 Dougnn, G., Dowd, G, and Kehce, M.: Organization Of K88 ac-encoded polypeptides in the Escheric~a co//cell envelope; use ofminiceHs and outer membrane protein mutants for studying assembly by pill J. Bacterinl. !$3 (1983) 364-370. Engel, J.N. and Ganem, D.: Chlumydial rRNA operons: gene organization and identification ofputative tandem promoters. J. Bacteriol. 169 (1987) $678-$685. Gill, R.E., Heffron, F. and Falkow, S.: Identification of the protein encoded by the transposable element TnJ which is required for its transposition. Nature 282 (1979) 797-801. Hatch, T.P., Allan, I. and Pearce, J.H.: Structural and polypeptide differences between envelopes of infective and reproductive life cycle forms of Chlamydia spp. J. Bacteriol. 157 (1984) 13-20. Hart, C., Ward, M.E. and Clarke, I.N.: Analysis of the entire nuclcotlde sequence of the cryptic plasmid of CAlamydiatracAoma~ serovar L t. Evidence for involvement in DNA replication. Nucleic Acids Res. 16 (1988) 4053--4067. Holland, B.I., Macman, N. and Nicaud, J.: Secretion of proteins from bacteria. Biotechnology 4 (1986) 429-431. Kaul, R., Roy, K.L. and Wenman, W.M.: Cloning, expression and primary structure of a Chlamydia trachoma~ binding protein. J. Bacteriol. 169 (1987) 5152-5156. Kuo, C.C., Wang, S.P. and Grayston, J.T.: Growth of trachoma organisms in HeLa 229 cell culture. In Hobson, D. and Holmes, K.K. (Eds.), Nongonococcal Urethritis and Related Infections. American Society for Microbiology, Washington, DC, 1977, pp. 328-336. McKenney, K., Shimatake, H., Court, D., Schmeissner, U., Brady, C. and Rosenberg, M.: A system to study promoter and terminator signals recognized by E. colipolymerase. In Chirikjian, J.G. and Papas, T.S. (Eds.), Gene Amplification and Analysis, Vol. 2, Structural Analysis of Nucleic Acids. Elsevier, New York, 1981, pp. 383-415. Moulder, J.W.: lntracellular parasitism: life in an extreme environment. J. Infect. Dis. 130 (1974) 300-306. M0iler, M. and Blobel, G.: In vitro translocation of bacterial proteins across the plasmamembrane of EsckericMacoil Proc. Natl. Aced. Sci. USA 81 (1984) 7421-7425. Nano, F.E., Barstad, P.A., Mayer, L.W., Coligan, J.E. and Caldweli, H.D.: Partial amino acid sequence and molecular cloning of the encoding gem for the major outer membrane protein of Chlamydla trachomatb. Infect. Immun. 48 (1985) 372-377. Newhall, W.J.V.: Biosynthesis and disulfide cross-linking of outer membrane components during the growth cycle of Chlamydla trachomaf~. Infect. Immun. 55 (1987) 162-168. Newhall, W.J.V. and Jones, R.B.: Disulfide linked olignmers ofthe major outer membrane protein of chlamydiae. J. Bacteriol. 154 (1983) 998-1001.
Palva, E.T., Hirst, T.R., Hardy, SJ.S., Holmgren, J. and Rancl~ L: Synthesis of a precursor to the B subunit of'heat lal~e anteroto~M in ~ coil J. Bacteriol. 146 (1981) 325-330. Pickett, M,A., Ward, M.E. and Clarke, I.N.: Complete sequence of the major outer membrane protein from CMamyd~atrackoma~ serovur L t. FEMS Microbiol. Lett. 42 (1987) 185-190. Pickett, M.A., Ward, M.E. and Clarke, I.N.: High level expression and epitope localization of the major outer meanbrane protein of CAlamydia tracAomat~ serovar L,. Mol. Microb. 2 (1988) 681-685. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. USA 74 (1977) 5463-5467. Schachter, J. and Caldwell, H.D.: Cldamydiae. Atmu. Rev. MicrobioL 34 .(1980) 285-309. Stephens, R.S., Kuo, C.C., Newport, G. and Asabian, N.: Molecular cloning and expression of C ~ y d ~ a mac~omagsmajor outer membrane protein antigens in E.vcher/c.A/acon. Infect. lmmun. 47 (1985) 713-718. Stephens, R.S., Mullenbach, G., Sanchez-Pescador, R. and Agabian, N.: Sequence analysis of the major outer membrane protein gene from CblamydiatracAoma~ serovar L2. J. Bacterinl, 168 (1986) 1277-1282. Stephens, R.S., Wagar, E.A. and Edman, U.: Developmental regulation of tandem promoters for the major outer membrane protein gene of Chlamydia trachoma~. J. Bacteriol. 170 (1988) 744-750. Stern, MJ., Ames, G.F., Smith, N.H., Robinson, E.C. and Higgins, C.F.: Repetitive extragenic palindromic sequences: a major component of the bacterial genome. Cell 37 (1984) 1015-1026. Szybalska, E.H. and Szybalski, W.: Genetics of human cell lines, IV. DNA-mediated heritable transformation of a biochemical trait. Proc. Natl. Acad. Sci. USA 48 (1962) 2026-2034. Towbin, H., Staehelin, T. and Gordon, J.: Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some application. Proc. Natl. Acad. Sci. USA 76 (1979) 4350-4354. Vieira, J. and Messing, J.: The pUC plasmids, an Ml3mpT-derived sys. tem for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19 (1982) 259-268. Von Gabain, A., Belasco, J.G., Schottel, J.L, Chang, A.C.Y. and Cohen, S,N.: Decay ofmRNA in £schericMacoil: investigation of the fate of specific segments oftranscripts. Proc. Natl. Acad. Sci. USA 80 (1983) 653-657. Wenman, W.M. and Lovett, M.A.: Expression in £schevtch/a ~ of a Chlamydla Irachoma~ antigen recognized during human infection. Nature 296 (1982) 68-70.
97
GENE 03392
Expression of the Chlamydia trachomatis major outer membrane protein-encoding gene in F.scherichia coli: role of the 3' end in mRNA stability (Recombinant DNA; gene product; monoclonal antibodies; minicells; epitope; phage Avectors; preprocessed pol)T,eptide; leader polypeptide)
Ravi Kaul, Matthew J.J. Duncan, James Guest and Wanda M. Wenman Division of Infectious Diseases, Department of Pediatrics. Universityof Alberta, Edmonton, Alberta (T6G 2R7 Canada) Received by R. E. Yasbin: 19 May 1989 Revised: 31 August 1989 Accepted: 12 September 1989
SUMMARY
The major outer membrane protein (MOMP)-encoding gene (ompl) of Chlamydia trachomatis has been cloned into Escherichia coil and partially sequenced. This recombinant gene expresses a full-length 40-kDa product, which is recognized by a monoclonal antibody directed against the species-specific epitope of MOMP. The recombinant ompl is expressed in either insertion orientation, indicating that it utilizes its own promoter system. The endogenous ompl promoter po,,;sesses a relatively low activity despite the high level of MOMP expression. Deletion of a 520-bp fragment at the 3' end encoding 39 amino acids (aa) at the C terminus and the remainder of the noncoding region leads to a significant decrease in rnRNA stability and loss of protein synthesis. When the MOMP-encoding plasmid was introduced into E. coil miniceils, it exp~ssed 40- and 43-kDa proteins; however, inhibition of post-translational processing by ethanol revealed only a 43-kDa protein. These data indicate that the unprocessed ompl gene product contains a 22-an leader sequence which is cleaved during translocation to the outer membrane, to yield a processed 40-kDa protein. The recombinant MOMP was localized to the outer membrane E. coli fraction, comparable to the location of the native C. trachomatis protein.
INTRODUCTION
C. trachomatisis a major human pathogen responsible for a wide range of infections including lymphogranuloma Correspondence to: Dr. R. Kaul, 2C3.77 Walter MacKenzie Centre, University of Alberta, Edmonton, Alberta (T6G2R7 Canada) Tel. (403)492-6631; Fax (403)492-3030. Abbreviations: aa, amino acid(s); Ap, ampicillin; bp, base pair(s); C., Chlamydia; EB, elementary bodies; ELISA, enzyme-linked immunosorbent assay; GalK, galactokinase K; Ig, immunoglobulin; IPTG, isopropyl-p-v-thiogalactopyranoside; kb, 1000bp; mAb, monoclonal antibodies; MCS, multiple cloning site; MOMP, major outer membrane protein; ompl, gene encoding MOMP; nt, nucleotide(s); ORF, open reading flame; PAGE, polyacrylamide-gelelectrophoresis; RB, reticulate bodies; Ri, rifampicin; SDS, sodium dodecyl sulfate; SSC, 0.15 M NaCl/0.015 M Na3" citrate pH 7.6; u, units; YT, 0.8% Bacto tryptone/5% Bacto yeast extract/0.5% NaCl; [ ], denotes plasmid-carrier state. 0378-1119/90/$03.50© 1990ElsevierSciencePublishersB.V.(BiomedicalDivision)
venereum (serovars LI-3), trachoma (serovars A-C), inclusion conjunctivitis and genital tract infections (serovars D-K) (Schachter and Caldwell, 1980). The pathogen displays a unique developmental cycle consisting of extracellular infectious EB and intracellular non-infectious RB (Moulder, 1974). The EB surface is composed of a MOMP which accounts for nearly 60 ~o of the total cell wall protein synthesized during chlamydial growth (Caldwell et al., 1981). Evidence suggests that MOMP, in conjunction with other outer membrane proteins, contributes to the structural integrity of the rigid form of EB due to inter- and intramolecular disulfide bonding (Hatch etal., 1984; Newhall and Jones, 1983). Recently, two groups have succeeded in cloning and sequencing the C. trachomatisompl in E. coil(Pickett et al., 1987; Stephens et al., 1985; 1986). The immunoblot analysis of a recombinant lysogen revealed a fusion protein that
98 represents a 15-kDa C-terminal peptide of the chlamydial MOMP rather than the entire 40-kDa full-length protein. Stephens et al. (1985) suggest that transcription is initiated with lacZ proceeding through an ORF until a stop signal is encountered. Alternatively, Pickett et al. (1987) speculate that the initial transcript necessitates fusion to a promoter reco,~Lmizedin E. coli. In either case expression of the fulllength translational product in E. coP. was not demonstrated by these authors. We describe the full-length translation of the C. trachomatis ompl from its endogenous promoter in E. cog and the role of the 3' end in mRNA stability and protein expression. Evidence is also presented to support the processing of a precursor MOMP product prior to translocation across the membrane.
(Pickett et al., 1987) which was provided by I.N. Clarke, University of Southampton (U.K.). Hybridization was carded out at 38 °C twice in 2 x SSC containing 0.2~ SDS and once in 0.2 x SSC. After drying, the fdters were autoradiographed overnight using Kodak X-Omat AR film. From nearly 1000 recombinants two plaques hybridized to the probe. DNA was prepared from these recombinants and cleaved with BamHI. A 9.2-kb chlamydial DNA insert was obtained from each plaque that hybridized strongly to the 17-mer probe on Southern blots. The insert was mapped with restriction endonucleases and compared to the pt,,bfished sequence (Pickett et al., 1987; Stephens et al., 1986). An internal 2. l-kb DraI fragment, derived from the original 9.2-kb BamHl fragment encoding MOMP, was subcloned into the Sinai site of pUCI8; this recombinant plasmid, designated pCT40118, was used to transform E. coli JM83.
MATERIALS AND METHODS
(d) Monoclonal antibody BALB/c mice were immunized subcutaneously with whole EB mixed with Freund's complete adjuvant, followed two weeks later with Freund's incomplete adjuvant. One week after the last injection an intraperitoneal booster dose was administered. Spleen lymphocytes and mouse mydoma cells Sp2/0 were fused with polyethylene glycol 4000 supplemented with 5~o (v/v) dimethyl sulfoxide. Hybrids surviving in HAT medium containing hypoxanthine, aminopterin and thymidine (Szybalska and Szybalski, 1962) were tested by ELISA and reactive hybridomas were cloned by dilution. Hybrids of monoclonal origin were injected intraperitoneally into pristine primed BALB/c mice and ascitic fluid containing high-titer mAb, IgG class, was collected. One clone from these mAbs reacted with all strains of the species C. trachomatis tested by ELISA. This mAb, designated F6 and specifying the species-specific domain of MOMP, was used for immmloblotting and immune precipitations. An additional mAb, KG5, used for immunoblotting was provided by R. Barnes, CDC, Atlanta, GA. This antibody also specifies the species-specific domain (Barnes et al., 1985). Identical results were obtained with F6 and KG5 in parallel experiments.
(a) Bacterial strains C. trachomatis serovar I..2 (L2/434/Bu) obtained from ATCC was used for preparation of chromosomal DNA. Chlamydiae were grown in HeLa 229 cells for 48 h and purified through Renografin as described previously (Kuo et al., 1977). The bacterial strains used were E. cog JM83 (Vieira and Messing, 1982), E. cog P678-54 (Adler et al., 1967) and £. cog ED5363 (McKenney etal., 1981) as recipients for DNA transformations. ]'he plasmids employed were pUCI8, pUCI9 and pKO4. E. coil was grown routinely in 2 × YT medium and cells harbouring plasmids were grown in 100 ~tg Ap/ml. (b) DNA isolation and manipulation Chromosomal DNA was isolated from purified EB as described earlier (Wenman and Lovett, 1982). Plasmid vector DNA was isolated and purified by CsCI gradient centrifugation. Chromosomal DNA was completely digested with BamHl and sized on a 0.7% agarose gel; DNA fragments (9-12 kb) were transferred electrophoretically onto DEAE and subsequently recovered according to the supplier's instructions (Schleicher & Schuell, Inc.). Pooled DNA fragments were ligated to BamHI-digested, alkaline phosphatase-treated phage ~EMBL4. The ligated DNA was packaged using the Boehringer-Mannheim packaging extract kit. Phages were plated out and amplified in E. coil NM539. (c) Plaque hybridization The amplified clone bank in bacteriophage ~EMBL4 was plated out in E. coli NM539. Plaques were transferred to Millipore nitrocellulose membrane discs which were processed essentially according to Benton and Davis (1977). Recombinant plaques were hybridized to a 17-mer probe homologous to the species-specific region of ompl
(e) Localization of recombinant protein on Escherichia coU cells The inner and outer membrane fractions of E. coli JM83 harbouring pCT40118 were separated as described earlier (Kaul et al., 1987). The periplasmic proteins were separated by the cold-shock procedure of Dougan et al. (1983) while the cytoplasmic proteins were prepared from spheroplasts. RESULTS AND DISCUSSION
(a) Expression of chlamydial MOMP in Escherichia coli A recombinantcontaining a 2.1-kb Dral fragment of the
99 C. trachomatis omp] in vector pUCI8, designated I), was transformed into E. coliJM83. The cells were harvested and proteins resolved by SDS-PAGE, followed by immunoblot analysis using mAb directed to the species-specific MOMP domain (mAb F6 or KG5). A highly antigenic polypeptide of 40 kDa, identical in size and mobility to C. trachomatisMOMP, was identified (Fig. 2A). The Dral fragment from plasmid pCT40118 was excised using Kpnl and BamHl sites on the vector which flank the Smal site ofpUClS. This Kpnl-BamHl fragment encoding the C. trachomatis ompl was subcloned into pUCI8 and pUC 19 and designated pCT40218 and pCT40319, respectively. Fig. 1 shows the construction and expression of these recombinants. Subsequently a deletion mutant pCT40218d was generated by deleting a 520-bp XbalBamHl fragment at the 3' end ofpCT40218. This truncated recombinant revealed no expression ofMOMP polypeptide by immunoblot analysis compared to parental recombinants (Fig. 2A). However., a faint antigenic band of approx. 37.5 kDa was visualized when excessive amounts of truncated protein were immunoblotted (Fig. 2B).
C. trachommis MOMP. Other common bands between
pUCI8 and pCT40018 represent vector-derived gene pro-
p C T 4 0 1 1 8 (Fig.
1
2 3 4 5 6
-94
:!~ii
O f t
XEMBL4
NMS3
~Ct40
ornlgl expression
pUCl8
JM83
pCt40-I I 8
x~E ill
JM83
~Ct40-216
pUCI9
JM83
~Ct40-319
pUCI 8
JM83
)Ct 40-218d
.
~
N0. ÷
"'11
LXXXXXXI
pUCI8
Immuno blot assay
map
e pc
B
is shown,
Name * e8-'t"~.~. ft It
'
Fig, 2. lmmunoblot analysis of the cMamydial MOMP synthesized by £. cob"JM83 harbouring various recombinant plasmids. Positive recombinants, identified by Ap resistance and lack of ~.galactosidase, were grown in YT broth. The cells were harvested, suspended in electrophoresis buffer containing 2% SDS and 5% p-mereaptoethanol, and boiled for 3 rain. Proteins were separated by 0.1% SDS/10% PAGE and transferred to nitroceHnlose (Towbin et al.~ 1979), Blots were then reacted with mAb to MOMP followed by probing with t25I-labelled protein A and autoradiography. (Panel A) Lanes: !, pCT40218d; 2, I~"F40118; 3,pCT40218; 4,pCT40319; 5,pUCI8; 6,serovar 1.2 EB. Lanes I-5 contain 50pg while lane6 contains 10Fg total resolved protein. (Panel B) Lanes: !, pCT40218; 2, pCT40218d containing 80 Fg and 200 ~tg of total protein. Mobility of molecular size standards (in kDa)
Recombinant clones
Host strain
--67
A
(b) Expression of ehlamydial MOMP in EscherieMa coli minieells Recombinants containing pCT40118 and pCT40218d were transformed into E. carl minicell strain p67854, for which 3SS-labelled gone products were subjected to SDS-PAGE followed by autoradiography. Fig. 3 shows a faint band of approx. 43 kDa and a strongly expressed protein of approx. 40 kDa which migrates with native
Vector used
12
'"
i%. X X X X X ~ N I
gg~.~.a~m~--~--N~
Duc
,a
cxb E
Es, x
~uc
puc
?
cxb
c
ESo x
~puc
,,
[--=s
puc xb E
ES. x
,,
,
'
" '
,
~puc
+
4,
+
Fig. 1. Construction of ompl expression plasmids. A linearized physical map of inserted sequences is shown along with their expression as monitored by immunoblot assay using monoclonal antibodies directed towards the species specific domain (KG$ or F6) as described in RESULTS AND DISCUSSION, section a. The arrow shows the direction of transcription from the vector promoter. Only the relevant restriction sites are shown. Abbreviations: B, BamHl; C, Clal; D, Dral; E, EcoRl; K, Kpnl; S; Smal; Sa, Sau3A; X, Xhol; Xb, Xbal. The hatched bars represent the subcloned fragments that were sequenced in both directions.
I00
1
2
3
m
4
5
N
6
•
7
443 "440 437.5
432 .429
Fig. 3. Identification ofchlamydial MOMP synthesized byE. coli 1)67854 minicells. Minicells harbouring the desired plasmids were grown to stationary phase and purified by sucrose density centrifugation. The cells were labelled with [35S]methionine (Gill et ai., 1979) and then labelled polypeptides were analyzed by SDS-PAGE. Alternatively, minicells were incubated for 15 min at 37°C in labelling medium containing 8.3% ethanol and [3SS]methionine (Palva et al., 1981). The gels were soaked in water for I h and then in I M Na. salicylate for an additional hour, before vacuum drying and autoradiography were performed. Autoradiograph of a 0.1% SDS/10% polyacrylamide gel containing 3SS-labelled polypeptides synthesized by E. coil minicells harbouring pUCI8 (lanes I, 2), pCT40218 (lanes 3 and 4) and pCT40218d (lane 6 and 7). Lanes 1, 3 and 6 represent products synthesized in the absence of ethanol while lanes 2, 4 and 7 represent products synthesized in the presence of 9.2% ethanol. Lane 5 contains [35S]cysteine.labelled EB. Approximately 30 pg of protein was loaded on each lane.
ducts. The comparison of the inferred aa sequence with that derived from the N terminus of MOMP suggests that normal processing of ¢. trachomatb MOMP involves the cleavage of a 22-aa leader peptide for translocation to the outer membrane (Nano et al., 1985; Stephens et al., 1986). This 22-aa leader sequence accounts for a 2.7-kDa peptide, leading us to hypothesize that the 43-kDa protein we observed was unprocessed MOMP containing a 22-aa legder sequence. Proteolytic processing responsible for the cleavage of a signal peptide is not fully effective in minicells (Dougan et al., 1983) which may explain the presence of the minor unprocessed product of 43 kDa. In E. coli, however, this leader sequence is cleaved efficiently and a product of 40 kDa transported to the outer membranes. To investigate this possibility, proteolytic processing in minicells was inhibited by labelling the cells in the presence of ethanol. Only a 43-kDa polypeptide was synthesized. The pUC-encoded p-lactamase was also obtained solely as unprocessed poly-
peptide in the presence of ethanol (Fig. 3, lanes 2, 4, 7). However, two proteins of 37.5 kDa and 40 kDa were synthesized in the absence of ethanol (lane 6) and a 40-kDa protein was synthesized in the presence of ethanol (lane 7) by minicells harbouring pCT40218d. MOMP from other Gram- organisms possess leader or signal sequences for vectorial transport to their surface location (Holland et al., 1986; MOiler and Blobel, 1984). Although up to 75~ of the total ompl product has been obtained from the lacZ promoter in E. coli (Pickett et al., 1988), this product was localized in the cytoplasm as insoluble inclusions, possibly because it lacked the N-terminal region of the protein. (c) Stability and decay of MOMP transcripts in Escherichia coli The inability of the truncated recombinant E. coli[pCT40218d] to express ompl could be related either to the instability of mRNA due to endonucleolytic cleavage or to post-translational degradation. These possibilities were studied by examining the degradation of mRNA species after the addition of Ri to inhibit initiation of transcription. Fig. 4 shows the Northern-blot analysis of total RNA prepared at different time points after Ri addition from both control and truncated recombinant. Approximately 90~o less mRNA was present in E. coli[pCT40118d] than in the parental recombinant E. coli[pCT40118] at time 0 min.
1 2 3 4 5 6
A
123456
B
Fig. 4. Determination of MOMP mRNA stability by Northern-blot hybridization. Cells harbouring the recombinants were grown at 37°C in LB broth containing 100 pg Ap/ml and 0.1 mM IPTG to a density of approx. 2 x i0 s cells per ml. Transcription was inhibited by the addition of 200 ttg Ri/ml. Samples were collected at various time intervals followod immediately by chilling on ice. Total RNA was extracted from £. coli[pCT40218] (panel A), or its deletion derivative (panel B) by the hot phenol method (yon Gabain et al., 1983) resolved on i % agarose gel and analyzed by Northern-blot hybridization using the cloned Kpnl-Xbal fragment (which encodes the truncated gene product) as a probe. The decay rates ofthe transcripts were determined by densitometric scanning ofthe autoradiograms essentially as described earlier (Baga et 8.1., 1988). Lanes I-6 represent samples withdrawn at 0, 2, 4, 6,10 and 15 min alter treatment with Ri.
101 Densitometric tracings showed a clear difference in rates of degradation: an mRNA half life of 0.6 min for pCT402 lgd compared to 8.0 mitt for pCT40118. These data demonstrate that mRNA transcripts ofthe deletion mutant are less stable than those of the parental recombinant. Very little is known about the factors involved in decay processes ofmRNA. However, RNA stability is believed to be enhanced by palindromic sequences in E. coli which form hairpin loops in mRHA, preventing RNA degradation by endonucleolytic c~avage (Stem et al., 1984). Sequence data support the existence of an 1l-bp dyad downstream from the proximal stop codon (Stephens et al., 1986).
(d) Cellular localization of MOMP in Escheridda coil The cellular localization of chlamydiai MOMP was examined in E. coli pCT40118 using immunoblot analysis. Most of MOMP was located in the outer membrane fraction of E. coli as is the case with native C. trachomatis MOMP (Fig. 5). The recombinant protein was also accessible to MAb on the surface of viable E. coli as demonstrated by dot blot anaiysis (not shown). (e) Promoter studies Restriction endonuclease analysis of pCT40118 demonstrated that ompl is located in the same orientation as the lacZp promoter of pUC 18. To test the dependence of ompl 1
30
2
3
4
5 6 7 1 2
567
34
on the lacZp, the BamHI-Kpnl fragment was subcloned into pUCI8 and pucIg. Expression of a product was obtained in either orientation. Earlier workers using phage ~gt I 1 and ~L47.1 detected a/l-gaiactosidase fusion product that represents a 15-kDa C-terminal end of chlamydial MOMP (Pickett et al., 1987; Stephens et al., 1955). It was therefore believed that ompl does not uti,~e its own promoters in an £. coli system. Recently, chlanectin, an 18-kDa eukaryotic cell-binding protein from C. trachomatis was produced in E. coil when placed under vector promoter control (Kaul et al., 1987). These observations, coupled to the finding that chlamydial promoters lack homology to optimal E. coli consensus sequences, suggest that recognition sequences for chlamydiai RNA polymerase differ from those of E. coil Similar observations have been made with chlamydial rRNA operons from the murine biovar (Engel and Ganem, 1987). Next, to evaluate the strength and activity of the ompl promoter a 0.7-kb EcoRI-Sau3A fragment was inserted into the promoter assessment vector pKO4. This fragment contains the entire region upstream from the ompl ORF (including 18 bp of vector) as well as the first 35 aa of unprocessed MOMP. Chimeras containing this fragment with pKO4 demonstrated GaiK activity on MacConkey agar galactose plates. The GaiK assay was done exactly as described by McKenney etai. (1981). Compared to a background activity of 2.044 u (nmol of galactose phosphorylated per min at A6so) the pCT40118 promoter induced activity to 6.67 u. Both of these activities were low compared with that of the iacZp (70.5 u). Stephens et ai. (1988) identified tandem promoters designated PI and P2 upstream from ompl with very low levels of activity using cat gene expression in E. coil The existence of weak promoters despite the high level of ompl expression which we observed suggests that MOMP, its mRNA or both, may be exceptionally stable within E. coll. Pulse-chase experiments reinforced the stable nature of MOMP in C. trachomatisinfected HeLa cells (Newhall, 1987).
~
A
El
Fig. 5. 5ubcellular localization of C. ~,-achw~zatisMOMP in E, mlf IM83 transformed with pCT40118. Approximately equivalent amounts of various cell fractions were eleetrophoresed on 0.1% 5DS/12.5~ polyacrylamide gels. (Panel A)Coomassie blue-stained gel. Lanes: !, C. trachomatis serovar 1-2 EB; 2, unfractionated E. coli lM83 [pUC18 ] ; 3,unfractionated recombinant harboaring pCT40118; 4,outer membrane; 5, periplasma; 6, inner membrane; 7, cytoplasm. (Panel B) Immunoblot of the gel in panel A (containing half the concentration of protein samples used in panel A except lane I which contains approx. I/s ofthe protein concentration) reacted with mAb F6. The star indicates the MOMP polypeptide as visualized by Coomassie blue staining.
(f) Nueleotide sequence To determine whether the observed differences in expression and translocation reflect any functionally important change in the N-tcr~;,~ region, we sequenced a 689-bp Kpnl-F,coRI of pCT40118 which encodes the tandem promoter sequences as well as the first 38 aa of the translation region (Fig. 6). Comparison of the sequence in this region with that of Stephens et al. (1988) shows a total of 4 nt alterations. However, these discrepancies were located outside the tandem promoters and the N-terminal translation region. Although the cause for such variations is not clear these minor differences cannot explain the discrepancies in expression, even though they may fall within the functional boundaries of tandem promoters.
102 GGTACCC~CACTTTCTTTGTAGTAATtAAAa,CGATTTCTATCAAAACA~TTCTTAGATTTT 66 CTT~TCTCCTCTTTTCTTTTAGCCAAACCCCCATCTTCGAGCTATTCCAAACAC~-A/~T 132 CTTAGGTTTTGGAAATTAACAACTCATAAAAATTGAACTGTTTTGTAATTAACTCAAAACCCTCTC! 98 ATTCTCAACAATCP~.MATTGCCAACATGGCTTTTGCTCTCGGTTTCACAC, CGATTTTTTTCGCA 264 AAAACCAAGAACATAPAACATAAAAAGATATACAAAAATGGCTCTCTGCTTTATCGCTAAATCAGG 330 AGGCGCTTAAGGGCTTCTTCCTGGGACGAACGTTTTTCTTATCAACTTTACGAGAATAAGNL~eITT396 TTGTTATGGTCTCGAGCATT~CGACATGTTCTCGATTAAGGCTGCTTTTACTTGCAAGACATTC462 CTCAGGCCATTAATTGCTACAGGACATCTTGTCTGGCTTTAACTAGGACGCAGTGCCGCCAOA/~e~ 528 1 AGATAGCGAGCACAAAGAGAGCTAATTATAC~ATTTAGAGGTAAGA ATG AAA AAA CTC Met LUs LU$ Leu
586
S 20 TTG AAA TCO GTA TTA GTG TTT GCC GCT TTG AGT TCT GCT TCC TCC TTG Leu Ltjs Ser Yel Leu Yel Phe Ale Ale Leu Ser Ser Ale Set Ser Lee
634
21 36 CAA GCT CTG CCT GTG GGG AAT CCT GCT GAA CCA AGC CTT ATG ATC GAC GIn Ale Leu Pro Yei GltJ Ash Pro Ale Glu ,Pro Ser Lee Met lie Asp
682
37 GOA ATT C GI~j lie
689
Fig.6. The completesequenceof a 689-bpKpnl-EcoRlfragment,comprising the 5' end was determined by the dideoxy chain-termination method(Sangeret al., 1977)usingM13mpl8 and M13mp!9 recombinant clones.The underlinednt representthe differencebetweenthis sequence and that of Stephenset al. (! 986).Vectorsequenceslieupstreamfromthe arrow. The numbers above the sequence refer to aa residues from the translational site, while the nt positions are numbered on the fight margin.
resulted in significantly reduced antigenic expression. This loss of antigenicity was ascribed to decreased stability of ompl transcripts; the parental ompl transcript possesses a halflife ofg.0 min compared to its deletion mutant's halt'life of 0.6 min. (4) When the ompl gene was analyzed in minicelis, it expressed a complete unprocessed gene product of 43 kDa and a major processed product of 40 kDa which comigrated with 35S-labelled MOMP from C. trachomags serovar 1.2. In the presence of ethanol only the unprocessed 43-kDa product is produced in minicells. However, in the recombinant E. coil the 22-aa leader sequence is cleaved during translocation and a 40-kDa product is produced on the outer membrane. (5) Nucleotide sequencing of a 500-bp fragment encoding the type-specific domain of MOMP revealed one nt switch from C to G, which did not affect the aa code of the fragment. The cloning, identification and partial characterization of the C. trachomatb ompl and its promoters will facilitate understanding the developmental regulation of this organism. It may also help to define the role of leader peptide in protein translation and assembly.
ACKNOWLEDGEMENTS Serovar specificity was confLvmed by sequencing a 0.5-kb EcoRl fragment between aa 80 and 247, the type-specific domain of MOMP. No difference in nt sequence except a C-to-G shit~ (from GGC to GGG) at aa 157 was observed. This change did not, however, affect the deduced aa sequence. Sequence variation within the same serovar has been observed by Hart et al, (1988) also,
(g) Conclusions (1) We have isolated an E. coli recombinant that expresses a 40-kDa polypeptide identical in size, antigenicity and mobility to native EB MOMP. The recombinant MOMP, analogous to the native C. trachomatb protein, is located in the outer membrane fraction of E. coil, and is immunoaccessible. (2) The presence of functional promoters on the ompl gene was confLrmed by the expression of MOMP in pCT40319, where the lacZp is oriented opposite to the inserted gene. Promoter strength was quantitated using an expression assessment vector pKO4. Low levels of activity were observed with ompl promoters compared to the lacZp, suggesting the existence of weak promoters despite the high levels of ompl expression. (3) The 3' end of the ompl gene is essential for RNA stability and expression of the ompl product. Deletion of a 520-bp fragment at the 3' end of the gene encoding the terminal 30 aa and the remainder of the noncoding regions
This work was supported by grants from the Canadian Medical Research Council (MA7951) and University of Alberta Central Research Fund. W.M.W. is a scholar ofthe Alberta Heritage Foundation for Medical Research. We thank I. Clarke, University of Southampton, for providing a MOMP species-specific oligodeoxyribonucleotide; R. Barnes, CDC, Atlanta, for providing monoclonal antibody KG5; R. Meuser for technical help and L. Frost, University of Alberta, for providing plasmid pKO4 and E. coli ED 5363.
REFERENCES Adler, H.I., Fisher, W.D., Cohen, A. and Hardigree, A.A.: Miniature Escherichlacoilcellsdeficientin DNA. Proc. Natl. Acad. Sci.USA 57 (1987) 321-326. Baga, M., Goransson, M., Normark, S. and Uhlin, B.E.: Processed mRNAwith differentialstabilityin the regulationofE. colipilingene expression. Cell 52 (1988) 197-206. Barnes, R.C., Wang, S.P., Kuo, C.C. and Stamm,W.E.: Rapid immunotypingof Chlamydiatrachomagswithmonoclonalantibodiesin a solid phase enzymeimmunoassay.J. Clin. Microbiol. 22 (1985)609-613. Benton, W.D. and Davis, R.W.: Screening2,gt recombinant clones by hybridization to singleplaque in situ. Science 196 (1977) 180-182. Caldwell,H.D., Kromhout,J. and Schachter,J.: Purificationand partial characterizationofthe majorouter membraneprotein of Chlamydia trachomatb.Infect. Immun. 35 (1981) 1161-1176.
103 Dougnn, G., Dowd, G, and Kehce, M.: Organization Of K88 ac-encoded polypeptides in the Escheric~a co//cell envelope; use ofminiceHs and outer membrane protein mutants for studying assembly by pill J. Bacterinl. !$3 (1983) 364-370. Engel, J.N. and Ganem, D.: Chlumydial rRNA operons: gene organization and identification ofputative tandem promoters. J. Bacteriol. 169 (1987) $678-$685. Gill, R.E., Heffron, F. and Falkow, S.: Identification of the protein encoded by the transposable element TnJ which is required for its transposition. Nature 282 (1979) 797-801. Hatch, T.P., Allan, I. and Pearce, J.H.: Structural and polypeptide differences between envelopes of infective and reproductive life cycle forms of Chlamydia spp. J. Bacteriol. 157 (1984) 13-20. Hart, C., Ward, M.E. and Clarke, I.N.: Analysis of the entire nuclcotlde sequence of the cryptic plasmid of CAlamydiatracAoma~ serovar L t. Evidence for involvement in DNA replication. Nucleic Acids Res. 16 (1988) 4053--4067. Holland, B.I., Macman, N. and Nicaud, J.: Secretion of proteins from bacteria. Biotechnology 4 (1986) 429-431. Kaul, R., Roy, K.L. and Wenman, W.M.: Cloning, expression and primary structure of a Chlamydia trachoma~ binding protein. J. Bacteriol. 169 (1987) 5152-5156. Kuo, C.C., Wang, S.P. and Grayston, J.T.: Growth of trachoma organisms in HeLa 229 cell culture. In Hobson, D. and Holmes, K.K. (Eds.), Nongonococcal Urethritis and Related Infections. American Society for Microbiology, Washington, DC, 1977, pp. 328-336. McKenney, K., Shimatake, H., Court, D., Schmeissner, U., Brady, C. and Rosenberg, M.: A system to study promoter and terminator signals recognized by E. colipolymerase. In Chirikjian, J.G. and Papas, T.S. (Eds.), Gene Amplification and Analysis, Vol. 2, Structural Analysis of Nucleic Acids. Elsevier, New York, 1981, pp. 383-415. Moulder, J.W.: lntracellular parasitism: life in an extreme environment. J. Infect. Dis. 130 (1974) 300-306. M0iler, M. and Blobel, G.: In vitro translocation of bacterial proteins across the plasmamembrane of EsckericMacoil Proc. Natl. Aced. Sci. USA 81 (1984) 7421-7425. Nano, F.E., Barstad, P.A., Mayer, L.W., Coligan, J.E. and Caldweli, H.D.: Partial amino acid sequence and molecular cloning of the encoding gem for the major outer membrane protein of Chlamydla trachomatb. Infect. Immun. 48 (1985) 372-377. Newhall, W.J.V.: Biosynthesis and disulfide cross-linking of outer membrane components during the growth cycle of Chlamydla trachomaf~. Infect. Immun. 55 (1987) 162-168. Newhall, W.J.V. and Jones, R.B.: Disulfide linked olignmers ofthe major outer membrane protein of chlamydiae. J. Bacteriol. 154 (1983) 998-1001.
Palva, E.T., Hirst, T.R., Hardy, SJ.S., Holmgren, J. and Rancl~ L: Synthesis of a precursor to the B subunit of'heat lal~e anteroto~M in ~ coil J. Bacteriol. 146 (1981) 325-330. Pickett, M,A., Ward, M.E. and Clarke, I.N.: Complete sequence of the major outer membrane protein from CMamyd~atrackoma~ serovur L t. FEMS Microbiol. Lett. 42 (1987) 185-190. Pickett, M.A., Ward, M.E. and Clarke, I.N.: High level expression and epitope localization of the major outer meanbrane protein of CAlamydia tracAomat~ serovar L,. Mol. Microb. 2 (1988) 681-685. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. USA 74 (1977) 5463-5467. Schachter, J. and Caldwell, H.D.: Cldamydiae. Atmu. Rev. MicrobioL 34 .(1980) 285-309. Stephens, R.S., Kuo, C.C., Newport, G. and Asabian, N.: Molecular cloning and expression of C ~ y d ~ a mac~omagsmajor outer membrane protein antigens in E.vcher/c.A/acon. Infect. lmmun. 47 (1985) 713-718. Stephens, R.S., Mullenbach, G., Sanchez-Pescador, R. and Agabian, N.: Sequence analysis of the major outer membrane protein gene from CblamydiatracAoma~ serovar L2. J. Bacterinl, 168 (1986) 1277-1282. Stephens, R.S., Wagar, E.A. and Edman, U.: Developmental regulation of tandem promoters for the major outer membrane protein gene of Chlamydia trachoma~. J. Bacteriol. 170 (1988) 744-750. Stern, MJ., Ames, G.F., Smith, N.H., Robinson, E.C. and Higgins, C.F.: Repetitive extragenic palindromic sequences: a major component of the bacterial genome. Cell 37 (1984) 1015-1026. Szybalska, E.H. and Szybalski, W.: Genetics of human cell lines, IV. DNA-mediated heritable transformation of a biochemical trait. Proc. Natl. Acad. Sci. USA 48 (1962) 2026-2034. Towbin, H., Staehelin, T. and Gordon, J.: Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some application. Proc. Natl. Acad. Sci. USA 76 (1979) 4350-4354. Vieira, J. and Messing, J.: The pUC plasmids, an Ml3mpT-derived sys. tem for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19 (1982) 259-268. Von Gabain, A., Belasco, J.G., Schottel, J.L, Chang, A.C.Y. and Cohen, S,N.: Decay ofmRNA in £schericMacoil: investigation of the fate of specific segments oftranscripts. Proc. Natl. Acad. Sci. USA 80 (1983) 653-657. Wenman, W.M. and Lovett, M.A.: Expression in £schevtch/a ~ of a Chlamydla Irachoma~ antigen recognized during human infection. Nature 296 (1982) 68-70.