Expression of the monocarboxylate transporter 1 (MCT1) in cells of the porcine intestine

Cell Biology International 32 (2008) 638e645 www.elsevier.com/locate/cellbi

Expression of the monocarboxylate transporter 1 (MCT1) in cells of the porcine intestine Harald Welter, Rolf Claus* Institute for Animal Husbandry and Animal Breeding, University of Hohenheim, Garbenstrasse 17, D-70599 Stuttgart, Germany Received 15 August 2007; revised 18 October 2007; accepted 16 January 2008

Abstract Uptake of energy into cells and its allocation to individual cellular compartments by transporters are essential for tissue homeostasis. The present study gives an analysis of MCT1 expression and its cellular occurrence in the porcine intestine. Tissue portions from duodenum, jejunum, ileum, colon ascendens, colon transversum and colon descendens were collected and prepared for immunohistochemistry, Western blot and real time RT-PCR. A 169 bp porcine MCT1 cDNA fragment was amplified and published. MCT1 mRNA expression in the large intestine was 20 fold higher compared to the small intestine. Western blot detected a single protein band of 41 kDa at a much higher amount of MCT1 protein in the large intestine vs. the small intestine. MCT1 protein was detected in mitochondrial fractions of the large but not the small intestine. Immunohistochemistry in the small intestine showed that immune cells in the lamina propria and in the lymphoid follicles primarily expressed MCT1 while in the colon epithelial cells were the main source of MCT1. In summary, cellular expression of MCT1 differs between epithelial cells in the colon and small intestine. A possible role of MCT1 for uptake of butyrate into immune cells and the overall role of MCT1 for intestinal immune cell function remains elusive. Ó 2008 International Federation for Cell Biology. Published by Elsevier Ltd. All rights reserved. Keywords: MCT1; Pig intestine; Expression

1. Introduction Energy uptake into cells and the allocation to individual cellular compartments by transporters are essential for tissue homeostasis (Voet et al., 2002). Digestion provides a broad spectrum of energy substrates such as glucose, fatty acids, specific amino acids and short chain fatty acids (SCFA) including acetate, propionate and lactate which are differently preferred by individual cell types. Enterocytes in the small intestine prefer glucose and glutamine but were also shown to be able to use lactate as a substrate for intracellular oxidative metabolism (Ashy and Ardawi, 1988). In contrast, cells in the large

Abbreviations: SCFA, short chain fatty acids; MCT1, monocarboxylate transporter MCT1; UQ, ubiquitin; RT, Reverse transcription; Bcl-2, B-cell lymphoma 2. * Corresponding author. Tel.: þ49 (0)711 4592 2455; fax: þ49 (0)711 4592 2498. E-mail address: [email protected] (R. Claus).

intestine do not have access to these substrates and predominantly depend on butyrate (Bergman, 1990). This SCFA is produced by bacterial fermentation and provides over 60% of the colonocytes’ energy requirement (Andoh et al., 2003). In vivo and in vitro studies showed that butyrate additionally exerts a variety of effects related to proliferation, differentiation and apoptosis (Scheppach et al., 1992). Many in vitro studies with transformed cells report that butyrate stimulates apoptosis (Heerdt et al., 1994). Hague et al. (1997) showed that Bcl-2 and Bak may play a pivotal role in sodium butyrate-induced apoptosis in human colonic adenoma cell lines. In contrast, an intracolonic infusion of short-chain fatty acids stimulated intestinal mucosal growth in rats in vivo (Kripke et al., 1989). Targeting butyrate into the porcine small intestine also improved mucosal morphology and function (Claus et al., 2007). Moreover, in the pig colon, butyrate inhibits apoptosis of mucosal cells in vivo through the expression of the antiapoptotic signal Bcl-2 (Mentschel and Claus, 2003).

1065-6995/$ - see front matter Ó 2008 International Federation for Cell Biology. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.cellbi.2008.01.008

H. Welter, R. Claus / Cell Biology International 32 (2008) 638e645

Generally, it is assumed that transporter assisted uptake of energy into the cytoplasm and further transfer into the mitochondria are independent steps. Different mechanisms are discussed to explain the mode of action of butyrate and its passage through the plasma membrane of intestinal cells. It was suggested that monocarboxylates can enter the cytoplasm of cells by diffusion depending on the acidic milieu of the apical microenvironment (Fleming et al., 1989; von Engelhardt et al., 1989). In a transport kinetic study using isolated human and pig colonic luminal membrane vesicles Ritzhaupt et al. (1998a) demonstrated a role of the monocarboxylate transporter MCT1 as the main carrier protein. This protein transfers not only butyrate but also lactate and other monocarboxylates from colonic lumen into colonocytes. To maintain the ion milieu, bicarbonate anions instead are exported from the cells. Accordingly, the occurrence of MCT1 in epithelial cells which line the surface epithelium of the colon is well documented for many species (for review see Halestrap and Price, 1999). Additionally, MCT1 is located at the inner mitochondrial membrane and is known to function as a part of the mitochondrial oxidation complex to facilitate fuel uptake and oxidation (Brooks et al., 1999a,b). Recently, we found remarkable effects of fat-coated butyrate on small intestinal proliferation (Claus et al., 2007). The mode of action, however, is still unknown as well as the possible occurrence of MCT1 in the small intestine. In rats (Orsenigo et al., 1999) and rabbits (Tamai et al., 1995) MCT1 could be identified in jejunal enterocytes. An actual study revealed both MCT1 and MCT4 in porcine small intestine by Western blot (Sepponen et al., 2007), but its allocation, e.g. by immunohistochemistry, to specific cell types was not investigated. Additionally, a detailed comparison of the expression both on mRNA and protein level still is missing. Therefore, the aim of the present study was to clarify the tissue- and cell specific expression of MCT1 in the small and large intestine of the pig by immunohistochemistry, real time RT-PCR and Western blot, respectively. As a prerequisite the partial coding sequence of porcine MCT1 was determined and published in the EMBL database. 2. Materials and methods 2.1. Animals, feeding and tissue sampling Six German Landrace  Pietrain barrows (male castrated pigs) with a weight of 80e95 kg at the beginning of the experiment were kept in individual crates without straw and fed a standardised diet provided twice daily at 08:00 and 15:00 at an amount of 1.5 kg (see Table 1). After a six week feeding period the pigs had reached 100e125 kg and were euthanized by intravenous infusion of Narcodorm-n (Alvetra, Neumu¨nster, Germany). Within 10 min post mortem tissue portions were collected from the duodenum, jejunum, ileum, colon ascendens, colon transversum and colon descendens. They were rinsed with cold physiological saline and fixed in 4% paraformaldehyde for immunohistological evaluation. Additional fractions were shock frozen in liquid nitrogen and stored at

639

Table 1 Composition of the standardized diet and daily intake of metabolizable energy ME (MJ) Components

%/kg fresh substance

Water Protein Fat Ashes Crude fiber Nitrogen free extract Sugar Starch Calcium Phosphate

11.72 15.81 2.72 4.43 3.18 62.15 3.9 46.33 0.64 0.51

Energy (MJ ME/kg) Amount/day(kg/d) Energy/day (MJ ME/d)

13.52 2.9 39.2

80  C for Western blot. For mRNA analyses tissue pieces were preserved in RNA stabiliser solution (0.5 M EDTA, pH 8.0; 1 M Na-citrate; 700 g ammonium sulfate; 935 ml DEPC-water; adjusted to pH 5.2 with a 1 M H2SO4). 2.2. RNA preparation and reverse transcription (RT) Total RNA of tissue portions (25 mg) was prepared for RT using NucleospinÒ RNA II (Machery and Nagel, Du¨ren, Germany) and checked for quantity and quality via Biophotometer (Eppendorf, Hamburg, Germany) at an absorbance of 260 nm and 260/280 nm, respectively. RT of 1 mg of RNA was carried out in a volume of 50 ml with the M-MLVH() reverse transcriptase (Promega, Madison, WI, USA) including 2.5 mM random hexamers as previously described (Gabler et al., 1997). To detect residual DNA-contamination a negative control RT was performed with the same mixture without reverse transcriptase. 2.3. Selection of MCT1 and ubiquitin (UQ) primers MCT1 primer selection for conventional and real time RTPCR was based on published human (EMBL no. NM003051), bovine (EMBL no. AB250265) and equine (EMBL no. AY457175) MCT1 mRNA sequences. After multiple sequence alignment with the Clustal software program from HUSAR Bioinformatics Laboratory (DKFZ, Heidelberg, Germany) cross-species homologous MCT1 oligonucleotides were chosen from conserved regions near the 50 -end as follows with nucleotide positions (nt) given in parenthesis: forward primer (nt 211e230): 50 -GGTGGAGGTCCTATCAGCAG-30 and reverse primer (nt 379e362): 50 -TGAAGGCAAGCCCAAGAC-30 . Multi-species primer for ubiquitin (UQ, EMBL no. Z18245) were: forward 50 -AGATCCAGGATAAGGAAGGCAT-30 and reverse primer 50 -GCTCCACCTCCAGGGTGAT-30 . MCT1 and UQ primer sets were generated commercially (MWG, Ebersberg, Munich, Germany) and encompass PCR-products of 169 bp and 198 bp, respectively.

640

H. Welter, R. Claus / Cell Biology International 32 (2008) 638e645

2.4. Amplification, purification and sequencing of porcine MCT1 cDNA The optimal annealing temperature for MCT1 was first established in a gradient thermocycler (Mastercycler Gradient, Eppendorf, Hamburg, Germany). Amplification was carried out for 25 cycles in a reaction mixture of 25 ml, as previously described (Gabler et al., 1997), containing 2 ml (40 ng cDNA) with annealing for 45 s at 60  C. A negative control (template was replaced by water) was performed at the same time. The amplified fragment was subjected to agarose gel electrophoresis (1.8% (w/v), 1 mg/ml ethidium bromide), low molecular weight marker (BioLabs, Beverly, MA, USA), excised from the gel and purified with the Min EluteÒ Gel Extraction Kit (Qiagen, Hilden, Germany). The identity of the PCR product was finally confirmed by commercial sequencing (Medigenomix, Martinsried, Munich, Germany) from both strands. 2.5. Real-time RT-PCR The real-time RT-PCR was conducted using the Sequence Detection System ABI Prism 7000 (Applied Biosystems, Foster City, CA, USA) and a QuantiTect SYBR Green PCR Kit (Qiagen Hilden, Germany) in a total volume of 25 ml. One ml PCR template (20 ng reverse transcribed total RNA) was added to 24 ml of Master mix to the indicated end concentrations: 10.7 ml redistilled water; 0.4 ml forward primer (0.32 mM); 0.4 ml reverse primer (0.32 mM); 12.5 ml 2 QuantiTect SYBRÒ Green PCR Master Mix (1). Thermal cycling conditions started with polymerase activation and complete denaturation of the cDNA at 95  C for 15 min followed by the amplification segment consisting of denaturation at 95  C for 15 s, 20 s of annealing at 60  C for UQ and MCT1, and extension for 30 s at 72  C. A final dissociation protocol was included to specify integrity of amplification. As negative controls water and non-transcribed RNA were used instead of cDNA. 2.6. PCR efficiency, data presentation and statistics The PCR efficiency (E) of each primer set was determined within distinct detection ranges (4.9 pg to 40 ng of cDNA) and calculated using the equation: E ¼ 10(1/slope) (Rasmussen, 2001). From resulting cDNA standard curves (n ¼ 3), PCR efficiency (E ), slope (s), and regression (r) in the UQ and MCT1 run were determined as follows: UQ: E ¼ 1.81, s ¼  3.8801, r ¼ 0.995; MCT1: E ¼ 1.91; s ¼  3.5589, r ¼ 0.991. To evaluate equal quantity and quality of the preceding RT reaction in each sample, unregulated reference genes are suggested as a control (Marten et al., 1994). Therefore, all cDNA samples were compared to an endogenous standard. Because of its highly balanced expression (P ¼ 0.532) UQ served as a suitable housekeeping gene in our system. The relative expression of each gene was determined by the cycle threshold (ct) method by setting the fluorescence threshold manually at 0.2 (ABI Sequence Detector program software version 1.1). The ct is the number of PCR cycles when the fluorescence signal of the

specific amplicon exceeds background fluorescence and correlates inversely with the logarithm of the initial cDNA amount. Quantitative RT-PCR results are depicted as means  SEM from Dct values (ct of target mRNA minus ct of the house keeping gene UQ) for each intestinal compartment. Statistical analyses were computed with SigmaStat 3.0 (SPSS Inc., Chicago, IL, USA) using a one-way ANOVA. The normal distribution was tested by the KolmogoroweSmirnov method. If the analysis of variables showed significant differences between various intestinal compartments, all pairwise multiple comparison procedures (Bonferroni t-test) were used to test the significance at a level of P < 0.05. 2.7. Preparation of post-nuclear membrane fractions for Western Blot Due to limited antibody supply, analogue intestinal sections were pooled from all six barrows. The preparation of postnuclear membrane fractions was conducted according to Lambert et al. (2002) with minor modifications. In brief, one gram of pooled tissue samples was transferred into 10 volumes of ice cold buffer 1 (100 mM mannitol, 2 mM HEPES/Tris, pH 7.1) containing the protease inhibitors Pepstatin A (10 mg/ ml), Leupeptin (10 mg/ml), Aprotinin (10 mg/ml), PMSF (2 mM) and EDTA (1 mM) and homogenised with Ultra Turrax equipment (Jahnke and Kunkel, Staufen, Germany) for 20 s. After centrifugation at 500  g for 10 min at 4  C the supernatant was centrifuged again at 30 000  g for 30 min at 4  C. Membrane fractions were harvested as the pellet following this spin. The sediment was resuspended in 750 ml buffer 2 (300 mM mannitol, 20 mM HEPES/Tris, pH 7.4) including protease inhibitors and homogenised again. 2.8. Preparation of subcellular fractions for Western blot For subcellular fractionation one gram of pooled tissue samples from the small and large intestine was transferred into 2 volumes of lysis buffer (10 mM Tris/HCl pH 7.5, 20 mM sodium molybdate dihydrate, 10 mM DTT, 10% glycerol and 0.05% Triton X 100 including protease inhibitors) and homogenised. After centrifugation at 1000  g for 10 min at 4  C the supernatant was kept on ice for preparation of mitochondria and microsomes while the pellet containing the nuclei was washed twice in TE-buffer, pH 7.4, resuspended in 3.5 ml TE-buffer containing 0.5 M KCl and homogenised again. Mitochondrial pellet was obtained after centrifugation at 21 000  g for 20 min at 4  C and resuspended in 500 ml of 250 mM sucrose, 10 mM Tris/HCl, pH 7.5 and 5 mM EDTA while the supernatant was used for microsomal isolation. The mitochondrial suspension was loaded on a sucrose gradient consisting of 1.4 ml of 1.5 M sucrose, 10 mM Tris/ HCl, pH 7.5 and 2 ml of 1 M sucrose, 10 mM Tris/HCl, pH 7.5 and 5 mM EDTA and centrifuged at 40 000  g for 25 min at 4  C. Mitochondria appearing as a white ring at the interphase of 1.5 M and 1.0 M sucrose were harvested and washed twice in TE-buffer before sonification (Vibra cell 375, Sonics & Materials Inc., Danbury, CT, USA) in

H. Welter, R. Claus / Cell Biology International 32 (2008) 638e645

641

TE-KCl-buffer four times for 5 s at a duty of 40%. Microsomes were collected as the pellet following a spin at 100 000  g for 1 h at 4  C, washed twice in TE-buffer and sonicated in TE-KCl-buffer as well. The protein concentration was measured colorimetrically according to Bradford (1996) against standard dilutions of bovine serum albumin. 2.9. Performance of SDS-Page and Western blot Aliquots (20 mg) of protein from post-nuclear membrane fractions and subcellular fractions were separated on a 5e12% SDS-polyacrylamide gel and transferred to nitrocellulose membranes (0.45 mm, Schleicher and Schuell, Darmstadt, Germany) using a ‘‘Semi-Phor’’ semidry blotting chamber (Ho¨fer Scientific Instruments, San Francisco, CA, USA). The membrane was blocked at 4  C over night in 5% nonfat dry milk in PBS-T (0.1% Tween 20 in phosphate-buffered saline) and then probed with the MCT1 antibody (dilution 1:1250) at room temperature for 2 h. Membranes were washed with PBS-T and incubated with horseradish peroxidaseconjugated goat anti-rabbit IgG (1:5000) at room temperature for 1 h, washed again 3 times with PBS-T. Immunoblots were incubated with a luminol-based detection reagent (250 mM luminol; 90 mM p-coumaracid; 1 M Tris/HCl) for 1 min and exposed to X-ray films for 30 s. The negative control included the replacement of the first antibody with the preimmune serum (dilution 1:1250). A prestained protein standard (MBI, Fermentas, Germany) was used as molecular size marker. 2.10. Immunohistochemistry of MCT1 The immunohistochemical methods were conducted as previously described (Mentschel et al., 2001). Serial crosssections (4 mm) were boiled in 10 mM citrate buffer (pH 6.0) for 5  5 min in a microwave oven to retrieve MCT1 antigen. Endogenous peroxidases were blocked with 3% H2O2 in redistilled water and unspecific binding was prevented by incubation with normal sheep serum. The slides were incubated with a rabbit polyclonal antibody against MCT1 (dilution 1:200; Cat. N : BP082, Acris Antibodies, Hiddenhausen, Germany) for 1 h at 37  C. After incubation with a biotinylated sheep anti rabbit secondary antibody, a streptavidin-biotin-peroxidase complex was applied (Dako, Hamburg, Germany). Antibody binding was visualized by the addition of DAB as substrate chromogen followed by counterstaining with Mayer’s hemalum. Control experiment included the substitution of MCT1 antibody by rabbit preimmune serum. 3. Results 3.1. Conventional RT-PCR A hypothetical MCT1 transcript was detected in different regions of the intestinal tract using conventional RT-PCR by a cross-species homologous primer set that resulted in a 169 bp amplicon (Fig. 1A). Putative MCT1 mRNA seemed to be stronger expressed in the entire large intestine compared

Fig. 1. Specific RT-PCR products for MCT1 (A, 169 bp) and UQ (B, 198 bp) in the small and large intestine of barrows in whole homogenates separated by agarose gel electrophoresis. Additional bands seen for UQ (asterisks) are due to tandem repeats of the coding sequence. Their sizes are species specific; intensity of bands can vary depending on RNA/RT-PCR quality as well as on PCR conditions. One representative result is shown for each intestinal compartment. Duo, duodenum; Jej, jejunum; Ile, ileum; CoA, colon ascendens; CoT, colon transversum; CoD, colon descendens; M, low molecular weight marker with an arrow indicates 200 bp band; H2O, negative control.

to the small intestine. Product specificity was evaluated by sequencing as outlined below. Conventional RT-PCR of the housekeeping gene UQ was performed to check the integrity of the RNA as well as the efficiency of the reverse transcription for each sample. UQ mRNA amounts were unchanged in samples along the whole intestinal tract (Fig. 1B). 3.2. Sequencing Sequencing of the 169 bp PCR product identified the porcine MCT1 mRNA. Its nucleotide and deduced amino acid sequence are shown in Fig. 2. The porcine MCT1 cDNA fragment was 94% homologous to the known equine MCT1 (EMBL no. AY457175), 92% homologous to the human (EMBL no. NM_003051), bovine (EMBL no. AB218693) and rat (EMBL no. D63834) MCT1 and only 87% homologous to murine MCT1 (EMBL no. AF058055). Partial nucleotide sequence of the porcine MCT1 transcript is held in the EMBL database (EMBL no. AM286425). 3.3. Real time RT-PCR As shown in Fig. 3, real time RT-PCR data of MCT1 confirmed those obtained by conventional RT-PCR. MCT1 mRNA

H. Welter, R. Claus / Cell Biology International 32 (2008) 638e645

642

5´-GGT GGAGGTCCTATCAGCAGTATCCTGGTGAATAAATATGGCAGTCGTCCAGTCATGATT G G G P I S S I L V N K Y G S R P V M I

60

ATTGGCGGCTGCTTGTCAGGCTGTGGCTTGATTGCAGCTTCCTTCTGTAACACCGTGCAG I G G C L S G C G L I A A S F C N T V Q

120

GAACTTTACTTGTGCATTGGAGTCATTGGAGGTCTTGGGCTTGCCTTCA -3´ E L Y L C I G V I G GL G L A F

169

Fig. 2. Partial cDNA sequence of porcine MCT1. The nucleotide and deduced amino acid sequence of porcine MCT1 is shown; oligonucleotide primers used to amplify MCT1 are overlined.

Polyclonal antibody against MCT1 stained one specific band of approximately 41 kDa (Fig. 4A, top) in immunoblots of postnuclear membrane protein fractions from the porcine intestine. MCT1 antigen was detected in all intestinal samples. Likewise, the greatest amounts of MCT1 protein were found in the large intestine while much less protein was expressed in the duodenum with nearly undetectable levels in the jejunum and ileum. The expression of MCT1 within both intestinal sections remained relatively stable. As shown in Fig. 4B (bottom) a fraction from colonic mitochondria was strongly MCT1 positive and a nuclear isolate seemingly contained MCT1 protein. Contrary, colonic microsomes and corresponding subcellular fractions from the small intestine did not express MCT1. When both membranes were probed with the preimmune serum instead of primary antibody the band disappeared, verifying specific MCT1 immunostaining (Figs. 4A,B, bottom).

enterocytes were consistently negative. Based on morphological criteria, the only cells expressing MCT1 protein appear to be immune cells, predominantly in the crypt and glandular region of the lamina propria of duodenum (Fig. 5A1, arrows), jejunum (Fig. 5B, arrows) and ileum (Fig. 5C, arrows) as well as in the lymphoid follicles (Fig. 5C, black arrowhead). Among these, immune cells with dense granular structures were stained dark brown (Figs. 5A2,A3,C, white arrowheads). These cells can easily be differentiated from agranular weakly stained cells localized in the lamina propria and lymphoid follicles of the small intestine. In contrast to the small intestine, MCT1 protein was strongly expressed in the colonic epithelia (Figs. 5DeF). Expression in the longitudinal axis of the colonic epithelial cells is strongest towards the lumen and weakest at the base of the colonic crypts in the stem cell compartment. As also observed for the small intestine, MCT1 is weakly expressed in immune cells of the lamina propria (Figs. 5DeF, arrows) and in a small single lymph node of the colon descendens (Fig. 5F, black arrowhead). Among them, several scattered strongly stained cells (Fig. 5F insert, white arrowheads) could be detected as well. Staining was absent in the control section from the ileum (Fig. 5G) and colon transversum (Fig. 5G insert) when the antibody was substituted by preimmune serum.

3.5. Immunolocalisation of MCT1 protein

4. Discussion

Immunoreactive MCT1 protein was detected in the small and large intestine (Fig. 5). In the small intestine, however,

So far, studies on monocarboxylate transporters were performed in the porcine intestinal tract to characterise the properties of butyrate transport in purified pig colonic luminal membrane vesicles (Ritzhaupt et al., 1998a,b). Additionally, the relative abundance of different monocarboxylate transporters in the intestinal tract of different pig breeds was studied by immunoblotting (Sepponen et al., 2007). A systematic comparison both at the mRNA level and protein level by immunohistochemistry has not yet been published. For this reason, a part of the putative porcine MCT1 cDNA was produced from intestinal RNA extracts and its nucleotide and amino acid sequence were determined. The amplicon was confirmed as porcine MCT1 mRNA which revealed 94% homology to the equine (EMBL no. AY457175) and 92% to human (EMBL no. NM_003051), bovine (EMBL no. AB218693) and rat (EMBL no. D63834) MCT1 sequence. In consequence, pig specific mRNA was used for quantitative real time PCR. Due to the high sequence homology among species, Western blot and immunohistochemical studies were conducted with an antibody that had been raised

expression in each of the three colonic compartments was higher (P < 0.001) compared to each of the compartments of the small intestine. No difference (P > 0.05) was measured between samples within small and large intestine, respectively. 3.4. Western blot

***

0

***

***

Δ ct

2

4

6 Duo

Jej

Small intestine

Ile

CoA

CoT

CoD

Large intestine

Fig. 3. Relative expression of MCT1 mRNA (D ct) in different compartments of the small and large intestine of barrows. Duo, duodenum; Jej, jejunum; Ile, ileum; CoA, colon ascendens; CoT, colon transversum; CoD, colon descendens. Mean  SEM. n ¼ 6; ***: highly significant (P < 0.001) compared to the small intestine. One Dct denotes a doubling of mRNA.

H. Welter, R. Claus / Cell Biology International 32 (2008) 638e645

A

130 100 72 56

643

B

40 33 24

Duo

Jej Ile Small intestine

CoT CoD M CoA Large intestine (kDa)

Nuc Mito Micr Small intestine

Nu Mito M Micr (kDa) Large intestine

Fig. 4. Western Blot analysis of small and large intestinal tissue compartments of barrows (A), and of different subcellular fractions (B) after incubation with MCT1 antibody (top) and preimmune serum (bottom), respectively. MCT1 specific antiserum reacted with a single band of an apparent molecular mass of about 41 kDa. Sample lanes were loaded equally with 20 mg of corresponding protein extracts. Duo, duodenum; Jej, jejunum; Ile, ileum; CoA, colon ascendens; CoT, colon transversum; CoD, colon descendens; Nuc, nuclear; Mito, mitochondrial; Micr, microsomal fraction; M, protein standard as molecular size marker (kDa).

against human MCT1 and shown to lead to specific staining. Accordingly, our observation of a single protein band of about 41 kDa agrees with previous findings of Ritzhaupt et al. (1998b) on pig colonic luminal membrane vesicle. These data slightly differ from studies referring to a 55 kDa protein in porcine muscles and intestine (Sepponen et al., 2003, 2007). Others have even found MCT1 running at 43 kDa in dogs (Shimoyama et al., 2007) and reindeers (Koho et al., 2005). Reasons for this discrepancy may be species specific, different experimental conditions during sample preparation and protein separation by SDS-PAGE. Another discrepancy with Sepponen et al. (2007) is that they found no difference in the amount of protein in the small vs. the large intestine. We do not know the exact reason for that but consistent data of weak MCT1 signals in the small intestine at both mRNA and protein levels have also been reported by Iwanaga et al. (2006) beyond any species difference, as well. In the entire large intestine expression studies revealed high transcript and protein levels. As shown earlier, MCT1 localization could be demonstrated in the large intestine of humans (Gill et al., 2005), cattle (Kirat and Kato, 2006) and sheep (Kirat et al., 2006). As expected MCT1 expression was approved in the forestomach of ruminants (Kirat et al., 2005, 2006). However, for the porcine species, precise immunolocalisation along the intestinal tract has not been performed thus far. MCT1 is known to also transport other SCFA (Halestrap and Meredith, 2004) but in the large intestine, butyrate is the preferred fuel for colonic epithelial cells (Roediger, 1982). Its transport depends on MCT1 which is supposed to be necessary to maintain metabolic energy at both cytoplasmic and nuclear level (Cuff et al., 2002). Since mitochondria are the site of energy processing in the cell, MCT1 expression in

such an organelle would be reasonable for the transport through the mitochondrial membranes. Consequently, our findings of abundant amounts of MCT1 protein by Western blotting, particularly in the mitochondrial fraction of colonic tissue, supports this assumption. Therefore, MCT1 in this organelle may reflect an important link between cellular energy, availability and tissue homeostasis due to the antiapoptotic function of butyrate in the pig colon in vivo (Mentschel and Claus et al., 2003). MCT1 signal seen in the nuclear fraction after Western blotting may be due to plasma membrane contamination, as it was not observed in nuclei of histological slides, or it may have escaped light microscopical resolution. In contrast to the colon, MCT1 mRNA expression as well as protein levels were much lower in the small intestine and comprised only 5% of colonic mRNA levels. These differences are explained by substrate dependant expression (Cuff et al., 2002). This also fits the quantitative differences between expression of colon and small intestine because microbial fermentation is limited to the colon. Apparently, considerable species differences exist because MCT1 protein was found in the basolateral membranes of crypt cells and the microvilli of the villus tip in the rat and dog small intestine (Cong et al., 2001; Shimoyama et al., 2007). Similarly, Lin et al. (1998) and Orsenigo et al. (1999) reported the presence of MCT1 mRNA in the small intestine of humans by Northern blot and in rat jejunal enterocytes by RT-PCR, respectively. Yet, our immunohistochemical analysis excludes enterocytes as the origin of a transcriptional signal. Instead immune cells are probably the source of MCT1 protein. Differences in their staining intensity appear to be related to the amount of cytoplasmic granules. These granules most likely represent subcellular structures such as mitochondria and/or lysosomes.

H. Welter, R. Claus / Cell Biology International 32 (2008) 638e645

644

A2

A1

B

C

50 µm

A3

50 µm

10 µm

D

E

50 µm

20 µm

50 µm

100 µm

F

50 µm

50 µm

G

50 µm

20 µm

50µm

Fig. 5. Immunohistochemical localization of MCT1 protein (brown staining) in the small and large intestine of barrows. Representative graphics for duodenum (A1eA3), jejunum (B), ileum (C), colon ascendes (D), colon transversum (E) and colon descendens (F) are given. Consider the intense MCT1 protein in the large but not small intestine epithelium. Arrows indicate MCT1 positive immune cells, white arrowheads point to cells containing dense granules while black arrowheads mark MCT1 stained lymph nodes. Control sections from jejunum (G) and colon transversum (G insert) displayed no immunostaining after incubation with rabbit preimmune serum. Each section was counterstained with Mayer’s hemalum. Scale bars are given.

As reported before, MCT1 is abundant in different fractions of human leucocytes (Merezhinskaya et al., 2004), as well as in macrophages (Hahn et al., 2000) and lymph nodes (Lin et al., 1998). It may be speculated that MCT1 in such cells mediates the role of butyrate as a survival factor and thus increases the lifespan of T lymphocytes. In this context, MCT1 was recently suggested as a possible target for modulating T cell response (Murray et al., 2005). In conclusion, we provided detailed quantitative and the first immunohistological data concerning the cellular occurrence and regional distribution of MCT1 along the porcine small and large intestine. A possible role of MCT1 for cellular of butyrate uptake into immune cells and its overall role for intestinal immune cell function remain elusive. Acknowledgments The authors thank H. Ha¨gele for performing the histological staining and C. Ostertag for molecular biological analysis.

References Andoh A, Tsujikawa T, Fujiyama Y. Role of dietary fiber and short-chain fatty acids in the colon. Curr Pharm Des 2003;9:347e58. Ashy AA, Ardawi MSM. Glucose, glutamine and ketone body metabolism in human enterocytes. Metabolism 1988;37:602e9. Bergman EN. Energy contributions of volatile fatty acids from the gastrointestinal tract in various species. Physiol Rev 1990;70:567e90. Bradford MM. A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye-binding. Anal Biochem 1996;72:248e54. Brooks GA, Brown MA, Butz CE, Sicurello JP, Dubouchaud H. Cardiac and skeletal muscle mitochondria have a monocarboxylate transporter MCT1. J Appl Physiol 1999a;87:1713e8. Brooks GA, Dubouchaud H, Brown M, Sicurello JP, Butz CE. Role of mitochondrial lactate dehydrogenase and lactate oxidation in the intracellular lactate shuttle. Proc Natl Acad Sci U S A 1999b;96:1129e34. Claus R, Gu¨nthner D, Letzguß H. Effects of feeding fat-coated butyrate on mucosal morphology and function in the small intestine of the pig. J Anim Physiol Anim Nutr 2007;91:312e8. Cong D, Fong AKY, Lee R, Pang KS. Absorption of benzoic acid in segmental regions of the vascularly perfused rat small intestine preparation. Drug Metab Dispos 2001;29:1539e47.

H. Welter, R. Claus / Cell Biology International 32 (2008) 638e645 Cuff MA, Lambert DW, Shirazi-Beechey SR. Substrate-induced regulation of the human colonic monocarboxylate transporter, MCT1. J Physiol 2002;539:361e71. Fleming SE, Fitch MD, Chansler MW. High-fiber diets: influence on characteristics of cecal digesta including short-chain fatty acid concentrations and pH. Am J Clin Nutr 1989;50:93e9. Gabler C, Lauer B, Einspanier A, Schams D, Einspanier R. Detection of mRNA and immunoreactive proteins for acidic and basic fibroblast growth factor and expression of the fibroblast growth factor receptors in the bovine oviduct. J Reprod Fertil 1997;109:213e21. Gill RK, Saksena S, Alrefai WA, Sarwar Z, Goldstein JL, Carroll RE, et al. Expression and membrane localization of MCT isoforms along the length of the human intestine. Am J Physiol Cell Physiol 2005;289:C846e52. Hague A, Diaz GD, Hicks DJ, Krajewski S, Reed JC, Paraskeva C. Bcl-2 and Bak may play a pivotal role in sodium butyrate-induced apoptosis in colonic epithelial cells; however overexpression of Bcl-2 does not protect against Bak-mediated apoptosis. Int J Cancer 1997;72:898e905. Hahn EL, Halestrap AP, Gamelli RL. Expression of the lactate transporter MCT1 in macrophages. Shock 2000;13:253e60. Halestrap AP, Meredith D. The SLC16 gene family-from monocarboxylate transporters (MCTs) to aromatic amino acid transporters and beyond. Pflugers Arch 2004;447:619e28. Halestrap AP, Price NT. The proton-linked monocarboxylate transporter (MCT) family: structure, function and regulation. Biochem J 1999;343: 281e99. Heerdt BG, Houston MA, Augenlicht LH. Potentiation by specific short-chain fatty acids of differentiation and apoptosis in human colonic carcinoma cell lines. Cancer Res 1994;54:3288e93. Iwanaga T, Takebe K, Kato I, Karaki S, Kuwahara A. Cellular expression of monocarboxylate transporters (MCT) in the digestive tract of the mouse, rat, and humans, with special reference to slc5a8. Biomed Res 2006;27: 243e54. Kirat D, Kato S. Monocarboxylate transporter 1 (MCT1) mediates short chain fatty acids transport in bovine cecum. Exp Physiol 2006;91:35e44. Kirat D, Inoue H, Iwano H, Hirayama K, Yokota H, Taniyama H, et al. Expression and distribution of monocarboxylate transporter 1 (MCT1) in the gastrointestinal tract of calves. Res Vet Sci 2005;79:45e50. Kirat D, Inoue H, Iwano H, Hirayama K, Yokota H, Taniyama H, et al. Monocarboxylate transporter 1 gene expression in the ovine gastrointestinal tract. Vet J 2006;171:462e7. Koho N, Maijala V, Norberg H, Nieminen M, Po¨so¨ AR. Expression of MCT1, MCT2 and MCT4 in the rumen, small intestine and liver of reindeer (rangifer tarandus tarandus L.). Comp Biochem Physiol A Mol Integr Physiol 2005;141:29e34. Kripke SA, Fox AD, Berman JM, Settle RG, Rombeau JL. Stimulation of intestinal mucosal growth with intracolonic infusion of short-chain fatty acids. JPEN 1989;13:109e16. Lambert DW, Wood IS, Ellis A, Shirazi-Beechey SP. Molecular changes in the expression of human colonic nutrient transporters during the transition from normality to malignancy. Br J Cancer 2002;86:1262e9. Lin RY, Vera JC, Chaganti RSK, Golde DW. Human monocarboxylate transporter 2 (MCT2) is a high affinity pyruvate transporter. J Biol Chem 1998;273:28959e65.

645

Marten NW, Burke EJ, Hayden JM, Straus DS. Effect of amino acid limitation on the expression of 19 genes in rat hepatoma cells. FASEB J 1994;8: 538e44. Mentschel J, Claus R. Increased butyrate formation in the pig colon by feeding raw potato starch leads to a reduction of colonocyte apoptosis and a shift to the stem cell compartment. Metabolism 2003;52: 1400e5. Mentschel J, Leiser R, Mulling C, Pfarrer C, Claus R. Butyric acid stimulates rumen mucosa development in the calf mainly by a reduction of apoptosis. Arch Tierernahr 2001;55:85e102. Merezhinskaya N, Ogunwuyi SA, Mullick FG, Fishbein WN. Presence and localization of three lactic acid transporters (MCT1, -2, and -4) in separated human granulocytes, lymphocytes, and monocytes. J Histochem Cytochem 2004;52:1483e93. Murray CM, Hutchinson R, Bantick JR, Belfield GP, Benjamin AD, Brazma D, et al. Monocarboxylate transporter MCT1 is a target for immunosuppression. Nat Chem Biol 2005;1:371e6. Orsenigo MN, Tosco M, Bazzini C, Laforenza U, Faelli A. A monocarboxylate transporter MCT1 is located at the basolateral pole of rat jejunum. Exp Physiol 1999;84:1033e42. Rasmussen R. Quantification on the LightCycler. In: Meuer S, Wittner C, Nakagawara K, editors. Rapid cycle real-time RT-PCR: methods and application. Heidelberg: Springer Press; 2001. p. 21e34. Ritzhaupt A, Ellis A, Hosie KB, Shirazi-Beechey SP. The characterization of butyrate transport across pig and human colonic luminal membrane. J Physiol 1998a;507:819e30. Ritzhaupt A, Wood IS, Ellis A, Hosie KB, Shirazi-Beechey SP. Identification and characterization of a monocarboxylate transporter (MCT1) in pig and human colon: its potential to transport L-lactate as well as butyrate. J Physiol 1998b;513:719e32. Roediger WE. Utilization of nutrients by isolated epithelial cells of the rat colon. Gastroenterology 1982;83:424e9. Scheppach W, Sommer H, Kirchner T, Paganelli GM, Bartram P, Christl S, et al. Effect of butyrate enemas on the colonic mucosa in distal ulcerative colitis. Gastroenterology 1992;103:51e6. Sepponen K, Koho N, Puolanne E, Ruusunen M, Po¨so¨ AR. Distribution of monocarboxylate transporter isoforms MCT1, MCT2 and MCT4 in porcine muscles. Acta Physiol Scand 2003;177:79e86. Sepponen K, Ruusunen M, Pakkanen JA, Po¨so¨ AR. Expression of CD147 and monocarboxylate transporters MCT1, MCT2 and MCT4 in porcine small intestine and colon. Vet J 2007;174:122e8. Shimoyama Y, Kirat D, Akihara Y, Kawasako K, Komine M, Hirayama K, et al. Expression of monocarboxylate transporter 1 (MCT1) in the dog intestine. J Vet Med Sci 2007;69:599e604. Tamai I, Takanaga H, Ogihara T, Higashida H, Maeda H, Sai Y, et al. Participation of a proton-cotransporter, MCT1, in the intestinal transport of monocarboxylic acids. Biochem Biophys Res Commun 1995;214: 482e9. Voet D, Voet JG, Pratt CW, Beck-Sickinger AG, Hahn U. Lehrbuch der Biochemie. 1st ed.). Weinheim: Wiley-VCH; 2002. von Engelhardt W, Ro¨nnau K, Rechkemmer G, Sakata T. Absorption of shortchain fatty acids and their role in the hindgut of monogastric animals. Anim Feed Sci Tech 1989;23:43e53.