- Email: [email protected]
Expression of the type I interferon receptor and the interferon-induced Mx protein in human endometrium during the menstrual cycle
Expression of the type I interferon receptor and the interferon-induced Mx protein in human endometrium during the menstrual cycle Tomoya Ozaki, M.D.,a Kentaro Takahashi, M.D., Ph.D.,b Haruhiko Kanasaki, M.D., Ph.D.c Kohji Iida, M.Sc.,c and Kohji Miyazaki, M.D., Ph.D.c a
Department of Obstetrics and Gynecology, Seirei Hamamatsu General Hospital, Hamamatsu; b Department of Obstetrics and Gynecology, Shiga University of Medical Science, Shiga; and c Department of Obstetrics and Gynecology, Shimane University School of Medicine, Izumo, Japan
Objective: To investigate the expression of the type I interferon receptor (IFNAR) and interferon-induced Mx protein (Mx) in normal human endometrium throughout the menstrual cycle. Design: Prospective study. Setting: Medical university in Japan. Patient(s): Thirty-seven normal endometrial tissues from fertile women who had undergone hysterectomies for reasons other than endometrial disease. Intervention(s): IFNAR-1, IFNAR-2, MxA, and MxB gene expression was analyzed by reverse transcription–realtime quantitative polymerase chain reaction. Moreover, localization of IFNAR-1 and IFNAR-2 were studied by immunohistochemistry. Main Outcome Measure(s): Expression of IFNAR-1, IFNAR-2, MxA, and MxB. Result(s): Expression of IFNAR-2 gene was significantly increased in the menstrual and midsecretory phase as compared with in the proliferative phase. Immunohistochemistry for IFNAR-1 and IFNAR-2 revealed weak staining of glandular epithelium and weak staining of stromal cells during the proliferative phase. However, an intense immunohistochemical staining of IFNAR-2 was observed on the surface and basement membrane of glands in the secretory phase. There was no statistical difference between MxA and MxB gene expression throughout the menstrual cycle. Conclusion(s): Our results suggest that IFNAR and Mx are expressed in the human endometrium and that the expression of IFNAR is cyclically changed during the menstrual cycle. (Fertil Steril威 2005;83:163–70. ©2005 by American Society for Reproductive Medicine.) Key Words: Endometrium, type I interferon receptor, interferon-induced Mx protein
Local interaction between maternal endometrium and the conceptus is believed to play a critical role during the implantation process. Maternal recognition of the presence of the blastocyst is necessary for immunomodulatory, histological, and endocrinological changes to occur in the endometrium. Recently, some investigators reported that the maternal recognition of pregnancy requires the production of interferon, interferon-tau (IFN-), by the preimplantation blastocyst in ruminants (1–5). It is unclear whether human blastocysts produce type I IFNs. Jones et al. (6) reported that human preimplantation embryos release ␣-IFN in culture media. Gunn et al. (7) reported that the human pre-embryo cannot produce a substance similar to the trophoblast IFN secreted by ruminant trophoblasts. The IFN- is a relatively recent evolutionary
Received January 5, 2004; revised and accepted June 1, 2004. Reprint requests: Kentaro Takahashi, M.D., Department of Obstetrics and Gynecology, Shiga University of Medical Science, Seta-Tsukinowacho, Ohtsu, Shiga 520-2192, Japan (FAX: 81-77-548-2406; E-mail: [email protected]).
0015-0282/05/$30.00 doi:10.1016/j.fertnstert.2004.06.064
group, having arisen by duplication from IFN-⍀ genes only about 36 million years ago. As a consequence, the genes are restricted to the ruminant ungulate species and are absent from primates (7). Thus, human endometrium is not exposed to this type I IFN. However, we considered that it is possible that human conceptuses produce other type I IFNs. Type I IFNs can bind to the endometrial type I IFN receptor (IFNAR) (8). The second messenger system mediating effects of type I IFNs on the endometrium is thought to involve the Janus kinase–signal transducers and activators of the transcription (JAK–STAT) pathway that have been characterized for other type I IFNs (9). The type I IFN receptor complex consists of at least two subunits, IFNAR-1 and IFNAR-2 (10 –14). Human IFNAR-1 has low affinity for IFNs (10, 15–17) but contributes to both the affinity for type I IFN binding (11, 18 –24). Human IFNAR-2 contributes more strongly to IFN binding, with moderate and differential affinity for type I IFNs (11, 19 –22, 24, 25). Moreover IFNAR-2 is physiologically associated with the cytoplasmic tyrosine kinase JAK1 and thus, in addition to ligand binding, appears to be functionally involved in signal transduction
Fertility and Sterility姞 Vol. 83, No. 1, January 2005 Copyright ©2005 American Society for Reproductive Medicine, Published by Elsevier Inc.
163
164
Ozaki et al.
AGGCCAGCAAGCGCATCTCCAG CCAGCAAACGTCTCGCCAACCAGAT AGGAATTTACCTTCTCCGCGTACAAGCATC TGCACCCTCCTTCCACCTGGCC
One cellular response to type I IFNs that is demonstrated in many different species and cell types is the induction of Mx proteins (26). Mx proteins are type I IFN-induced antiviral proteins, expression of which is directly induced in response to viral infection and which are strongly up-regulated in response to type I IFN production during a viral infection (26). Mx is a functional guanosine 5=-triphosphatase (GTPase) that shares sequence homology with a class of monomeric GTPases that are identified in diverse species with roles in intracellular protein and vesicle trafficking (27). The Mx gene is not directly induced by virus. Its up-regulation is the result of IFN induction by virus. Mx mRNA is expressed in uterine endometrium of pregnant ewes and sheep and in ewes treated with IFN- or IFN-␣ (28, 29). In sheep, Mx expression is modulated in endometrial epithelium during the estrous cycle (30). The function of the endometrial Mx protein during estrous or early pregnancy in ruminants is unclear but is considered to play a role in preparing the uterus to support the developing conceptus (30). In human endometrium, the expression of Mx protein has still not been investigated.
TGGAGCATGAAGAACTGGATG TCTGCAAGGAGTCACCATTCTCT CAAACTTTATCTCTTCAGACCAAAAAGA TCCTATTTTGGCAGATTCTGCTG
In this study, we investigated the fluctuation of expression and activation of IFNAR and Mx protein in the normal human endometrium throughout the menstrual cycle and suggest a possible participation of the type I IFN families during the menstrual or implantation process.
Ozaki. IFNAR and Mx protein in the human endometrium. Fertil Steril 2005.
CAGCACCTGATGGCCTATCAC CATCCACCTGAATGCCTACTTCT CAAATACCTGACTGTGAAAATGTCAAA GCACAGTGATGAGCAAGCAGTAA IFNAR-1 IFNAR-2 MxA MxB
Reverse primer Forward primer Amplification
Sequences used for quantitative amplification of IFNAR-1, IFNAR-2, MxA, and MxB by TaqMan.
TABLE 1
Probe
(11). In human endometrium during a normal menstrual cycle, the expression of the IFNAR is still in question.
MATERIALS AND METHODS Patient Selection Normal endometrial tissues were obtained from fertile women who had undergone hysterectomies conducted for reasons other than endometrial disease. All patients had regular menstrual bleeding with a menstrual cycle of 30 ⫾ 4 days during the previous 3 months. Women who had received any form of exogenous hormones or who had used an intrauterine device in the previous 3 months were excluded from the study. Endometrial tissues were obtained within 2 to 3 cm of the uterine fundus. Sections from each endometrial specimen were classified according to the criteria of Noyes et al. (31) as follows: menstrual phase (n ⫽ 3), early proliferative phase (n ⫽ 4), midproliferative phase (n ⫽ 3), late proliferative phase (n ⫽ 8), early secretory phase (n ⫽ 7), midsecretory phase (n ⫽ 8), and late secretory phase (n ⫽ 4). Appropriate committee permission from our university hospital was obtained for the sample-collection protocol. Informed consent was obtained from all patients undergoing surgical treatment. Tissue Specimen and RNA Preparation Endometrial tissue was rinsed in physiological saline solution to remove excess blood. The tissue samples were stored
IFNAR and Mx protein in the human endometrium
Vol. 83, No. 1, January 2005
FIGURE 1 Quantitative evaluation of IFNAR-1 gene expression in the human endometrium by RT-PCR TaqMan. Results are expressed as the mean ⫾ SEM of the relative yield of each gene as compared with that of the GAPDH gene. *P⬍.01 vs. menstrual phase. EP, early proliferative phase; MP, midproliferative phase; LP, late proliferative phase; ES, early secretory phase; MS, midsecretory phase; LS, late secretory phase.
Ozaki. IFNAR and Mx protein in the human endometrium. Fertil Steril 2005.
at ⫺80°C for subsequent analysis. Human placental tissues derived from volunteers were used as positive control for IFNAR-1, IFNAR-2, MxA, and MxBgene expression. Immunohistochemistry Formalin-fixed and paraffin-embedded tissue sections (6 m) were stained for IFNAR by using the DAKO LSAB kit (DAKO Co, Carpinteria, CA). Briefly, tissue sections were dewaxed in xylene, rehydrated in graded alcohol down to water, washed in phosphate-buffered saline (PBS; pH 7.4) for 5 minutes, and quenched in peroxidase blocking reagent for 5 minutes to remove endogenous peroxidase activity. Sections were then rinsed twice in PBS for 10 minutes each. Slides were subsequently incubated with 2% horse serum for 30 minutes at room temperature in a humidified chamber. After rinsing three times in PBS for 10 minutes each wash, a 1:100 dilution of rabbit anti-human IFN-␣/R (for IFNAR-2) polyclonal primary antibody (Santa Cruz Biochemistry, Lexington, KY) or 1:100 dilution of mouse anti-human IFN-␣R (for IFNAR-1) monoclonal primary antibody was directly added to the sections and incubated for 1.5 hours at room temperature in a humidified chamber. The primary antibody is against the C-terminal region of human IFNAR-2 or IFNAR-1 subunit, respectively. Sections were rinsed three times in PBS for 10 minutes per wash, and a biotinylated horse anti-rabbit and mouse antibody was then added for 30 Fertility and Sterility姞
minutes at room temperature. Diaminobenzidine-H2O2 (30 g) in 0.03% H2O2 was used as the chromogen, and sections were counterstained with methyl green. To assess the immunospecificity of each antibody, normal rabbit serum (as a negative control) was used instead of primary antibodies. Preparation of RNA and Reverse-Transcription–Real-Time Quantitative Polymerase Chain Reaction Procedure Total RNA was isolated from frozen cells by a commercially available extraction method (Isogen; Nippon Gene Inc., Tokyo, Japan). Complementary DNA (cDNA) was prepared by random priming from 1,000 ng of total RNA with a First-Strand cDNA Synthesis kit (Pharmacia-LKB, Uppsala, Sweden). We performed real-time quantitative polymerase chain reaction (PCR) with the TaqMan system (Applied Biosystems, Tokyo, Japan). The expression levels of each gene (IFNAR-1, IFNAR-2, MxA, and MxB) and internal reference GAPDH were measured by multiplex PCR by using TaqMan probes labeled with 6-carboxyfluorescein (FAM) or VIC, respectively. The sequences of each primer and TaqMan probe are shown in Table 1. All primers and probes were designed by using Primer Express v 2.0 software (Applied Biosystems). We purchased the TaqMan Pre-Developed Assay Reagents, GAPDH primer–probe set from Applied Biosystems. 165
FIGURE 2 Quantitative evaluation of IFNAR-2 gene expression in the human endometrium by RT-PCR TaqMan. Results are expressed as the mean ⫾ SEM of the relative yield of each gene as compared with that of the GAPDH gene. *P⬍.01 vs. early proliferative phase (EP). ** P⬍.01 vs. mid-proliferative phase (MP). LP, late proliferative phase; ES, early secretory phase; MS, midsecretory phase; LS, late secretory phase.
Ozaki. IFNAR and Mx protein in the human endometrium. Fertil Steril 2005.
Real-time PCR amplification and product detection was performed by using an ABI PRISM 7000 Sequence Detection System (Applied Biosystems) as recommended by the manufacturer. The simultaneous measurement of each geneFAM and GAPDH-VIC permitted normalization of the amount of cDNA added per sample. The quantity of cDNA for each experimental gene was normalized to the quantity of GAPDH cDNA in each sample. Relative expression was determined by using the ␦Ct method according to the manufacturer’s protocol (User Bulletin 2). Statistical Analysis Values were expressed as mean value ⫾ SEM. Differences between groups were analyzed for statistical differences by one-way analysis of variance followed by Duncan’s multiple-range test. A P value of ⬍.05 denoted the presence of a statistically significant difference. RESULTS Expression of IFNAR-1 and IFNAR-2 Genes in Normal Endometrium Expression of IFNAR-1 gene in endometrial tissues is summarized in Figure 1. Expression of the IFNAR-1gene was increased in the menstrual endometrium. The expression significantly increased in the menstrual as compared with the proliferative phase (P⬍.01). 166
Ozaki et al.
Expression of the IFNAR-2 gene in endometrial tissues is summarized in Figure 2. Expression of the IFNAR-2 gene was increased in the menstrual and mid to late secretory endometrium. The expression significantly increased in the menstrual and midsecretory phase as compared with in the early to midproliferative phase (P⬍.01). Endometrial Immunohistochemistry for IFNAR-1 and IFNAR-2 Immunohistochemistry for IFNAR-1 expression by using endometrial sections revealed weak staining of the luminal epithelium and superficial glandular epithelium of the endometrium and revealed weak staining of stromal cells in the proliferative phase (Fig. 3A). A weak immunohistochemical staining of the luminal epithelium and superficial glandular epithelium of the endometrium was observed in the secretory phase (Fig. 3B). The intensity of IFNAR-1 staining of glands did not change throughout the menstrual cycle. Weak staining of the luminal epithelium and superficial glandular epithelium of the endometrium was observed throughout the menstrual cycle (Fig. 3C). Immunohistochemistry for IFNAR-2 expression by using endometrial sections revealed weak staining, but little stronger than that for IFNAR-1, of the luminal epithelium and superficial glandular epithelium of the endometrium, as well as weak staining of stromal cells in the proliferative phase
IFNAR and Mx protein in the human endometrium
Vol. 83, No. 1, January 2005
FIGURE 3 Representative examples of endometrial tissue immunostained with anti–IFNAR-1 antibody (A–C). (A) Midproliferative phase tissue (cycle date 10) immunostained with anti-IFNAR-1 antibody. (B) Midsecretory phase tissue (cycle date 19) immunostained with anti–IFNAR-1 antibody. (C) Menstrual phase tissue (cycle date 1) immunostained with anti-IFNAR-1 antibody. Original magnification, ⫻100.
(Fig. 4A). On the other hand, a distinct immunohistochemical staining of the luminal epithelium and superficial glandular epithelium of the endometrium was observed in the secretory phase (Fig. 4B). We also detected IFNAR-2 on the cytolemma of gland cells. Of special interest, the most intense staining of IFNAR-2 was detected on the surface and basement membrane of glands. The intensity of IFNAR-2 staining of glands increased in the mid- to late secretory phase as compared with in the proliferative phase. The staining intensity of stromal cells did not change throughout the menstrual cycle. Weak staining of the luminal epithelium and superficial glandular epithelium of the endometrium was observed throughout the menstrual cycle, whereas almost no staining of stromal cells but distinct staining of red blood cells and lymphocytes was seen in the menstrual phase (Fig. 4C). Expression of MxA and MxB Gene in Normal Endometrium The result of MxA gene expression observed within endometrial tissues is presented in Figure 5. There was no statistical difference in MxAgene expression throughout the menstrual cycle. Additionally, there was no statistical difference in MxBgene expression throughout the menstrual cycle (data not shown). Therefore, there was no significant correlation between IFNAR-1 or IFNAR-2 and MxA or MxB gene expression (data not shown). DISCUSSION In this study, we describe the localization of IFNAR in human endometrium. IFNAR-1 and IFNAR-2 were predominantly localized in the epithelial cells and glands of the endometrium, with little detection or localization in the stroma. The expression of IFNAR-2 was more intense than that of IFNAR-1 in human endometrium throughout the menstrual cycle. This suggests that human endometrium can respond to type I IFNs and that the receptor-mediated site of action for type I IFNs is mainly in gland cells. Additionally, in the present study, the expression of both IFNAR-2 RNA and protein was increased in the epithelial and gland cells during the secretory phase. This finding is similar to that of a previous study using an 125I-labeled IFN assay (32). The notable point was an appearance of intensively expressed IFNAR-2 on the surface and basement membrane of glands in mid-secretory endometrium. Therefore, we suggest that human endometrium can respond to type I IFNs in a paracrine manner. However, it is unclear whether human blastocysts produce type I IFN.
Ozaki. IFNAR and Mx protein in the human endometrium. Fertil Steril 2005.
Fertility and Sterility姞
Interferon- has antiluteolytic, antiviral, antiproliferative, and immunomodulatory effects on the endometrial epithelium (33–38). Isoforms of IFN-, which are expressed only in ruminant trophoblasts, represent one of the five families of related type I IFNs, named IFN-␣, -, -␦, -, and - (39). The ovine conceptus produces IFN- between days 9 and 24 of pregnancy (40). Interferon- acts in a paracrine manner to 167
FIGURE 4 Representative examples of endometrial tissue immunostained with anti-IFNAR-2 antibody (A–C). (A) Midproliferative phase tissue (cycle date 10) immunostained with anti-IFNAR-2 antibody. (B) Midsecretory phase tissue (cycle date 19) immunostained with anti–IFNAR-2 antibody. (C) Menstrual phase tissue (cycle date 1) immunostained with anti-IFNAR-2 antibody. Original magnification, ⫻100.
suppress transcription of estrogen receptor-␣ and oxytocin receptor gene expression in the luminal epithelium and superficial glandular epithelium of the endometrium (41, 42). The oxytocin receptor is not formed on the endometrial luminal epithelium or superficial glandular epithelium, and oxytocin-induced release of luteolytic prostaglandin F2␣ pulses are abrogated to maintain the corpus luteum and production of progesterone (43, 44). Several investigators have studied expression and localization of the oxytocin receptor in human endometrium (45, 46). They have reported that the oxytocin receptor was localized predominantly in the epithelial cells and glands of the endometrium, with little detection or localization in the stroma. The same localization for the oxytocin receptor and IFNAR suggests that type I IFNs may suppress the expression of oxytocin receptors in human endometrium in the same manner as in ruminants. However, the role of oxytocin in human endometrium is not fully understood. Additional investigation is needed to clarify the relationship between the oxytocin response and type I IFN in human endometrium and whether they play a role in the human implantation system. We examined Mx gene expression in human endometrium during a normal menstrual cycle. From the present study, we found that there were nonsignificant differences of Mx A and B gene expression at various stages of the menstrual cycle. Expression of Mx was previously examined in the murine and ovine uterus (28 –30). The Mx gene is expressed constitutively and was IFN inducible in the murine endometrium. Ovine endometrial Mx gene expression is exhibited in uterine luminal and glandular epithelial cells during the estrous cycle (30). The authors speculated from these findings that some immune response involving IFNs was occurring in endometrial epithelial cells. Expression of Mx is thought to be tightly regulated by type I IFNs in immune systems (26). Uterine endometrium is a mucosal tissue and, as a first line of defense against invading pathogens, supports a dynamic resident population of lymphocytes. Many of these cells are situated within or just beneath the luminal epithelium and may respond to viral pathogens with the production of type I IFN (47). Immune cells and red blood cells invading the stroma indicated strong intensity of IFNAR immunoreactivity. The immunoreactivity that is observed in red blood cells may be caused by a nonspecific peroxidase reaction. Even with blocking the sections with hydrogen peroxide, some nonspecific peroxidase reaction might be observed in red blood cells. These findings suggested that, in human endometrium, type I IFN and its induced Mx protein may play a role in these immune responses, such as in the regulation of immune cells, as an antiviral mechanism, and/or in the regulation of cyclic changes during the menstrual cycle.
Ozaki. IFNAR and Mx protein in the human endometrium. Fertil Steril 2005.
168
Ozaki et al.
In conclusion, we demonstrated in this study the expression of IFNAR and IFN-induced Mx protein in human endometrium. Furthermore, the expression of IFNAR was strongest at the menstrual and midsecretory phases. The
IFNAR and Mx protein in the human endometrium
Vol. 83, No. 1, January 2005
FIGURE 5 Quantitative evaluation of MxA gene expression in the human endometrium by RT-PCR TaqMan. Results are expressed as the mean ⫾ SEM of the relative yield of each gene as compared with that of the GAPDH gene. There was no statistical difference in MxAgene expression throughout the menstrual cycle. EP, early proliferative phase; MP, midproliferative phase; LP, late proliferative phase; ES, early secretory phase; MS, midsecretory phase; LS, late secretory phase.
Ozaki. IFNAR and Mx protein in the human endometrium. Fertil Steril 2005.
physiological role of type I IFNs in the human endometrium is unknown at present. Further characterization of the signal transduction cascade may broaden our understanding of the physiological role of type I IFNs in human endometrium. Acknowledgments: The authors acknowledge the helpful advice provided by Kohkichi Hata, M.D., and Ritsuto Fujiwaki, M.D., on the quantitative RT-PCR studies.
REFERENCES 1. Kristina JD, Kamila D, Anthony F. Trophoblast interferon and pregnancy. Reproduction 2001;121:41–9. 2. Bazer FW, Spencer TE, Ott TL. Placental interferons. Am J Reprod Immunol 1996;35:297–308. 3. Martal J, Lacroix MC, Loudes C, Saunier M, Wintenberger-Torres S. Trophoblastin, a luteolytic protein present in early pregnancy in sheep. J Reprod Fertil 1979;56:63–73. 4. Martal JL, Chene NM, Huynh LP, L’Haridon RM, Reinaud PB, Guillomot MW, et al. IFN-tau: a novel subtype I IFN. Structural characteristics, non-ubiquitous expression, structure-function relationships, a pregnancy hormonal embryonic signal and cross-species therapeutic potentialities. Biochimie 1998;80:755–77. 5. Roberts RM, Ealy AD, Alexenko AP, Han CS, Ezashi T. Trophoblast interferons. Placenta 1996;20:259 – 64. 6. Jones KP, Edwin SS, Warnock SH, Mitchell MD, Urry RL. Immunosuppressive activity and alpha interferon concentrations in human embryo culture media as an index of potential for successful implantation. Fertil Steril 1992;57:637– 40.
Fertility and Sterility姞
7. Gunn LK, Homa ST, Searle MJ, Chard T. Lack of evidence for the production of interferon-alpha-like species by the cultured human preembryo. Hum Reprod 1994;9:1522–7. 8. Li J, Roberts RM. Interferon-tau and interferon-alpha interact with the same receptors in uterine endometrium: use of a readily iodinatable form of recombinant interferon-tau for binding studies. J Biol Chem 1994;269:13544 –50. 9. Darnell JE Jr, Kerr IM, Stark GR. JAK-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 1994;264:1415–21. 10. Uze G, Lutfalla G, Gresser I. Genetic transfer of a functional human interferon a receptor into mouse cells: cloning and expression of its cDNA. Cell 1990;60:225–34. 11. Novick D, Cohen B, Rubinstein M. The human interferon ␣/ receptor: characterization and molecular cloning. Cell 1994;77:391– 400. 12. Domanski P, Colamonici OR. The type-I interferon receptor. The long and short of it. Cytokine Growth Factor Rev 1996;7:143–51. 13. Langer J, Garotta G, Pestka S. Interferon receptors. Biotherapy 1996; 8:163–74. 14. Goldman LA, Cutrone EC, Dang A, Hao X, Lim J, Langer JA. Mapping human interferon-alpha (IFN-a2) binding determinants of type I interferon receptor subunit IFNAR-1 with human/bovine IFNAR-1 chimeras. Biochemistry 1998;37:13003–10. 15. Lim JK, Xiong J, Carrasco N, Langer JA. Intrinsic ligand binding properties of the human and bovine alpha-interferon receptors. FEBS Lett 1994;350:281– 6. 16. Nguyen NY, Sackett D, Hirata RD, Levy DE, Enterline JC, Bekisz JB, et al. Isolation of a biologically active soluble human interferon-alpha receptor-GST fusion protein expressed in Escherichia coli. J Interferon Cytokine Res 1996;16:835– 44.
169
17. Hwang SY, Holland KA, Kola I, Hertzog PJ. Binding of interferonalpha and -beta to a component of the human type I interferon receptor expressed in simian cells. Int J Biochem Cell Biol 1996;28:911– 6. 18. Cleary CM, Donnelly RJ, Soh J, Mariano TM, Pestka S. Knockout and reconstitution of a functional human type I interferon receptor complex. J Biol Chem 1994;269:18747–9. 19. Cohen B, Novick D, Barak S, Rubinstein M. Ligand-induced association of the type I interferon receptor components. Mol Cell Biol 1995;15:4208 –14. 20. Domanski P, Witte M, Kellum M, Rubinstein M, Hackett R, Pitha P, et al. Cloning and expression of a long form of the beta subunit of the interferon alpha beta receptor that is required for signaling. J Biol Chem 1995;270:21606 –11. 21. Lutfalla G, Holland SJ, Cinato E, Monneron D, Reboul J, Rogers NC, et al. Mutant U5A cells are complemented by an interferon-alpha beta receptor subunit generated by alternative processing of a new member of a cytokine receptor gene cluster. EMBO J 1995;14:5100 – 8. 22. Russell-Harde D, Pu H, Betts M, Harkins RN, Perez HD, Croze E. Reconstitution of a high affinity binding site for type I interferons. J Biol Chem 1995;270:26033– 6. 23. Cook JR, Cleary CM, Mariano TM, Izotova L, Pestka S. Differential responsiveness of a splice variant of the human type I interferon receptor to interferons. J Biol Chem 1996;271:13448 –53. 24. Curtone EC, Langer JA. Contributions of cloned type I interferon receptor subunits to differential ligand binding. FEBS Lett 1997;404: 197–202. 25. Novick D, Cohen B, Rubinstein M. Soluble interferon-alpha receptor molecules are present in body fluids. FEBS Lett 1992;314:445– 8. 26. Horisberger MA, Gunst MC. Interferon-induced proteins: identification of Mx proteins in various mammalian species. Virology 1991;180: 185–90. 27. Horisberger MA. Interferon-induced protein MxA is a GTPase which binds transiently to cellular proteins. J Virol 1992;66:4705–9. 28. Chang K, Goldspink G, Lida J. Studies on the in vitro expression of influenza resistance gene Mx by in situ hybridization. Arch Virol 1990;110:151– 64. 29. Charleston B, Stewart HJ. An interferon-induced Mx protein: cDNA sequence and high-level expression in the endometrium of pregnant sheep. Gene 1993;137:327–31. 30. Ott TL, Yin J, Wile AA, Kim HT, Gerami-Nami B, Spencer TE, et al. Effects of the estrous cycle and early pregnancy on uterine expression of Mx protein in sheep (Ovis aries). Biol Reprod 1998;59:784 –94. 31. Noyes RW, Hertig AT, Rock J. Dating the endometrial biopsy. Am J Obstet Gynecol 1975;122:262–3. 32. Russell DL, Manalo GG Jr, Findlay JK, Salamonsen LA. Binding sites for interferons on ovine and human endometrial membranes. Reprod Fertil Dev 1993;5:219 –27.
170
Ozaki et al.
33. Flint APF, Stewart HJ, Lamming GE, Payne JH. Role of oxytocin receptor in the choice between cyclicity and gestation in ruminants. J Reprod Fertil 1992;45:53– 8. 34. Bazer FW, Spencer TE, Ott TL. Interferon tau: a novel pregnancy recognition signal. Am J Reprod Immunol 1997;37:412–20. 35. Alexenko AP, Leaman DW, Li JZ, Roberts RM. The antiproliferative and antiviral activities of IFN-tau variants in human cells. J Interferon Cytokine Res 1997;17:769 –79. 36. Godkin JD, Smith SE, Johnson RD, Dore JJE. The role of trophoblast interferons in the maintenance of early pregnancy in ruminants. Am J Reprod Immunol 1997;37:137– 43. 37. Stark GR, Kerr IM, Williams BRG, Silverman RH, Schreiber RD. How cells respond to interferons. Annu Rev Biochem 1998;67:227– 64. 38. Hansen TR, Austin KJ, Perry DJ, Pru JK, Teixeira MG, Johnson GA. Mechanism of action of interferon-tau in the uterus during early pregnancy. J Reprod Fertil Suppl 1999;54:329 –39. 39. Roberts RM, Liu LM, Guo QT, Leaman D, Bixby J. The evolution of type I interferons. J Interferon Cytokine Res 1998;18:805–16. 40. Godkin JD, Bazer FW, Thatcher WW, Roberts RM. Proteins released by cultured day 15–16 conceptus prolong luteal maintenance when introduced into the uterine lumen of cyclic ewes. J Reprod Fertil 1984;71:57– 64. 41. Spencer TE, Bazer FW. Ovine interferon-tau suppresses transcription of estrogen receptor and oxytocin receptor genes in ovine endometrium. Endocrinology 1996;137:1144 –7. 42. Spencer TE, Mirando MA, Mayes JS, Watson GH, Ott TL, Bazer FW. Effects of interferon-tau and progesterone on oestrogen-stimulated expression of receptors for oestrogen, progesterone and oxytocin in the endometrium of ovariectomized ewes. Reprod Fertil Dev 1996;8: 843–53. 43. Wathes DC, Hamon M. Localization of oestradiol, progesterone and oxytocin receptors in the uterus during the oestrous cycle and early pregnancy of the ewe. J Endocrinol 1993;138:479 –91. 44. McCracken JA, Schramm W, Okulicz WC. Hormone receptor control of pulsatile secretion of PGF2a from the ovine uterus during luteolysis and it’s abrogation in early pregnancy. Anim Reprod Sci 1984;7:31–5. 45. Baker PN, Peat ML, Symonds EM, Maynard PV. Endometrial oxytocin binding sites in normal women and in subfertile patients. Postgrad Med J 1990;66:195–9. 46. Takemura M, Nomura S, Kimura T, Inoue T, Onoue H, Azuma C, et al. Expression and localization of oxytocin receptor gene in human uterine endometrium in relation to the menstrual cycle. Endocrinology 1993; 132:1830 –5. 47. Segerson EC, Matterson PM, Gunsett FC. Endometrial T-lymphocyte subset infiltration during the ovine estrous cycle and early pregnancy. J Reprod Immunol 1991;20:221–36.
IFNAR and Mx protein in the human endometrium
Vol. 83, No. 1, January 2005
Department of Obstetrics and Gynecology, Seirei Hamamatsu General Hospital, Hamamatsu; b Department of Obstetrics and Gynecology, Shiga University of Medical Science, Shiga; and c Department of Obstetrics and Gynecology, Shimane University School of Medicine, Izumo, Japan
Objective: To investigate the expression of the type I interferon receptor (IFNAR) and interferon-induced Mx protein (Mx) in normal human endometrium throughout the menstrual cycle. Design: Prospective study. Setting: Medical university in Japan. Patient(s): Thirty-seven normal endometrial tissues from fertile women who had undergone hysterectomies for reasons other than endometrial disease. Intervention(s): IFNAR-1, IFNAR-2, MxA, and MxB gene expression was analyzed by reverse transcription–realtime quantitative polymerase chain reaction. Moreover, localization of IFNAR-1 and IFNAR-2 were studied by immunohistochemistry. Main Outcome Measure(s): Expression of IFNAR-1, IFNAR-2, MxA, and MxB. Result(s): Expression of IFNAR-2 gene was significantly increased in the menstrual and midsecretory phase as compared with in the proliferative phase. Immunohistochemistry for IFNAR-1 and IFNAR-2 revealed weak staining of glandular epithelium and weak staining of stromal cells during the proliferative phase. However, an intense immunohistochemical staining of IFNAR-2 was observed on the surface and basement membrane of glands in the secretory phase. There was no statistical difference between MxA and MxB gene expression throughout the menstrual cycle. Conclusion(s): Our results suggest that IFNAR and Mx are expressed in the human endometrium and that the expression of IFNAR is cyclically changed during the menstrual cycle. (Fertil Steril威 2005;83:163–70. ©2005 by American Society for Reproductive Medicine.) Key Words: Endometrium, type I interferon receptor, interferon-induced Mx protein
Local interaction between maternal endometrium and the conceptus is believed to play a critical role during the implantation process. Maternal recognition of the presence of the blastocyst is necessary for immunomodulatory, histological, and endocrinological changes to occur in the endometrium. Recently, some investigators reported that the maternal recognition of pregnancy requires the production of interferon, interferon-tau (IFN-), by the preimplantation blastocyst in ruminants (1–5). It is unclear whether human blastocysts produce type I IFNs. Jones et al. (6) reported that human preimplantation embryos release ␣-IFN in culture media. Gunn et al. (7) reported that the human pre-embryo cannot produce a substance similar to the trophoblast IFN secreted by ruminant trophoblasts. The IFN- is a relatively recent evolutionary
Received January 5, 2004; revised and accepted June 1, 2004. Reprint requests: Kentaro Takahashi, M.D., Department of Obstetrics and Gynecology, Shiga University of Medical Science, Seta-Tsukinowacho, Ohtsu, Shiga 520-2192, Japan (FAX: 81-77-548-2406; E-mail: [email protected]).
0015-0282/05/$30.00 doi:10.1016/j.fertnstert.2004.06.064
group, having arisen by duplication from IFN-⍀ genes only about 36 million years ago. As a consequence, the genes are restricted to the ruminant ungulate species and are absent from primates (7). Thus, human endometrium is not exposed to this type I IFN. However, we considered that it is possible that human conceptuses produce other type I IFNs. Type I IFNs can bind to the endometrial type I IFN receptor (IFNAR) (8). The second messenger system mediating effects of type I IFNs on the endometrium is thought to involve the Janus kinase–signal transducers and activators of the transcription (JAK–STAT) pathway that have been characterized for other type I IFNs (9). The type I IFN receptor complex consists of at least two subunits, IFNAR-1 and IFNAR-2 (10 –14). Human IFNAR-1 has low affinity for IFNs (10, 15–17) but contributes to both the affinity for type I IFN binding (11, 18 –24). Human IFNAR-2 contributes more strongly to IFN binding, with moderate and differential affinity for type I IFNs (11, 19 –22, 24, 25). Moreover IFNAR-2 is physiologically associated with the cytoplasmic tyrosine kinase JAK1 and thus, in addition to ligand binding, appears to be functionally involved in signal transduction
Fertility and Sterility姞 Vol. 83, No. 1, January 2005 Copyright ©2005 American Society for Reproductive Medicine, Published by Elsevier Inc.
163
164
Ozaki et al.
AGGCCAGCAAGCGCATCTCCAG CCAGCAAACGTCTCGCCAACCAGAT AGGAATTTACCTTCTCCGCGTACAAGCATC TGCACCCTCCTTCCACCTGGCC
One cellular response to type I IFNs that is demonstrated in many different species and cell types is the induction of Mx proteins (26). Mx proteins are type I IFN-induced antiviral proteins, expression of which is directly induced in response to viral infection and which are strongly up-regulated in response to type I IFN production during a viral infection (26). Mx is a functional guanosine 5=-triphosphatase (GTPase) that shares sequence homology with a class of monomeric GTPases that are identified in diverse species with roles in intracellular protein and vesicle trafficking (27). The Mx gene is not directly induced by virus. Its up-regulation is the result of IFN induction by virus. Mx mRNA is expressed in uterine endometrium of pregnant ewes and sheep and in ewes treated with IFN- or IFN-␣ (28, 29). In sheep, Mx expression is modulated in endometrial epithelium during the estrous cycle (30). The function of the endometrial Mx protein during estrous or early pregnancy in ruminants is unclear but is considered to play a role in preparing the uterus to support the developing conceptus (30). In human endometrium, the expression of Mx protein has still not been investigated.
TGGAGCATGAAGAACTGGATG TCTGCAAGGAGTCACCATTCTCT CAAACTTTATCTCTTCAGACCAAAAAGA TCCTATTTTGGCAGATTCTGCTG
In this study, we investigated the fluctuation of expression and activation of IFNAR and Mx protein in the normal human endometrium throughout the menstrual cycle and suggest a possible participation of the type I IFN families during the menstrual or implantation process.
Ozaki. IFNAR and Mx protein in the human endometrium. Fertil Steril 2005.
CAGCACCTGATGGCCTATCAC CATCCACCTGAATGCCTACTTCT CAAATACCTGACTGTGAAAATGTCAAA GCACAGTGATGAGCAAGCAGTAA IFNAR-1 IFNAR-2 MxA MxB
Reverse primer Forward primer Amplification
Sequences used for quantitative amplification of IFNAR-1, IFNAR-2, MxA, and MxB by TaqMan.
TABLE 1
Probe
(11). In human endometrium during a normal menstrual cycle, the expression of the IFNAR is still in question.
MATERIALS AND METHODS Patient Selection Normal endometrial tissues were obtained from fertile women who had undergone hysterectomies conducted for reasons other than endometrial disease. All patients had regular menstrual bleeding with a menstrual cycle of 30 ⫾ 4 days during the previous 3 months. Women who had received any form of exogenous hormones or who had used an intrauterine device in the previous 3 months were excluded from the study. Endometrial tissues were obtained within 2 to 3 cm of the uterine fundus. Sections from each endometrial specimen were classified according to the criteria of Noyes et al. (31) as follows: menstrual phase (n ⫽ 3), early proliferative phase (n ⫽ 4), midproliferative phase (n ⫽ 3), late proliferative phase (n ⫽ 8), early secretory phase (n ⫽ 7), midsecretory phase (n ⫽ 8), and late secretory phase (n ⫽ 4). Appropriate committee permission from our university hospital was obtained for the sample-collection protocol. Informed consent was obtained from all patients undergoing surgical treatment. Tissue Specimen and RNA Preparation Endometrial tissue was rinsed in physiological saline solution to remove excess blood. The tissue samples were stored
IFNAR and Mx protein in the human endometrium
Vol. 83, No. 1, January 2005
FIGURE 1 Quantitative evaluation of IFNAR-1 gene expression in the human endometrium by RT-PCR TaqMan. Results are expressed as the mean ⫾ SEM of the relative yield of each gene as compared with that of the GAPDH gene. *P⬍.01 vs. menstrual phase. EP, early proliferative phase; MP, midproliferative phase; LP, late proliferative phase; ES, early secretory phase; MS, midsecretory phase; LS, late secretory phase.
Ozaki. IFNAR and Mx protein in the human endometrium. Fertil Steril 2005.
at ⫺80°C for subsequent analysis. Human placental tissues derived from volunteers were used as positive control for IFNAR-1, IFNAR-2, MxA, and MxBgene expression. Immunohistochemistry Formalin-fixed and paraffin-embedded tissue sections (6 m) were stained for IFNAR by using the DAKO LSAB kit (DAKO Co, Carpinteria, CA). Briefly, tissue sections were dewaxed in xylene, rehydrated in graded alcohol down to water, washed in phosphate-buffered saline (PBS; pH 7.4) for 5 minutes, and quenched in peroxidase blocking reagent for 5 minutes to remove endogenous peroxidase activity. Sections were then rinsed twice in PBS for 10 minutes each. Slides were subsequently incubated with 2% horse serum for 30 minutes at room temperature in a humidified chamber. After rinsing three times in PBS for 10 minutes each wash, a 1:100 dilution of rabbit anti-human IFN-␣/R (for IFNAR-2) polyclonal primary antibody (Santa Cruz Biochemistry, Lexington, KY) or 1:100 dilution of mouse anti-human IFN-␣R (for IFNAR-1) monoclonal primary antibody was directly added to the sections and incubated for 1.5 hours at room temperature in a humidified chamber. The primary antibody is against the C-terminal region of human IFNAR-2 or IFNAR-1 subunit, respectively. Sections were rinsed three times in PBS for 10 minutes per wash, and a biotinylated horse anti-rabbit and mouse antibody was then added for 30 Fertility and Sterility姞
minutes at room temperature. Diaminobenzidine-H2O2 (30 g) in 0.03% H2O2 was used as the chromogen, and sections were counterstained with methyl green. To assess the immunospecificity of each antibody, normal rabbit serum (as a negative control) was used instead of primary antibodies. Preparation of RNA and Reverse-Transcription–Real-Time Quantitative Polymerase Chain Reaction Procedure Total RNA was isolated from frozen cells by a commercially available extraction method (Isogen; Nippon Gene Inc., Tokyo, Japan). Complementary DNA (cDNA) was prepared by random priming from 1,000 ng of total RNA with a First-Strand cDNA Synthesis kit (Pharmacia-LKB, Uppsala, Sweden). We performed real-time quantitative polymerase chain reaction (PCR) with the TaqMan system (Applied Biosystems, Tokyo, Japan). The expression levels of each gene (IFNAR-1, IFNAR-2, MxA, and MxB) and internal reference GAPDH were measured by multiplex PCR by using TaqMan probes labeled with 6-carboxyfluorescein (FAM) or VIC, respectively. The sequences of each primer and TaqMan probe are shown in Table 1. All primers and probes were designed by using Primer Express v 2.0 software (Applied Biosystems). We purchased the TaqMan Pre-Developed Assay Reagents, GAPDH primer–probe set from Applied Biosystems. 165
FIGURE 2 Quantitative evaluation of IFNAR-2 gene expression in the human endometrium by RT-PCR TaqMan. Results are expressed as the mean ⫾ SEM of the relative yield of each gene as compared with that of the GAPDH gene. *P⬍.01 vs. early proliferative phase (EP). ** P⬍.01 vs. mid-proliferative phase (MP). LP, late proliferative phase; ES, early secretory phase; MS, midsecretory phase; LS, late secretory phase.
Ozaki. IFNAR and Mx protein in the human endometrium. Fertil Steril 2005.
Real-time PCR amplification and product detection was performed by using an ABI PRISM 7000 Sequence Detection System (Applied Biosystems) as recommended by the manufacturer. The simultaneous measurement of each geneFAM and GAPDH-VIC permitted normalization of the amount of cDNA added per sample. The quantity of cDNA for each experimental gene was normalized to the quantity of GAPDH cDNA in each sample. Relative expression was determined by using the ␦Ct method according to the manufacturer’s protocol (User Bulletin 2). Statistical Analysis Values were expressed as mean value ⫾ SEM. Differences between groups were analyzed for statistical differences by one-way analysis of variance followed by Duncan’s multiple-range test. A P value of ⬍.05 denoted the presence of a statistically significant difference. RESULTS Expression of IFNAR-1 and IFNAR-2 Genes in Normal Endometrium Expression of IFNAR-1 gene in endometrial tissues is summarized in Figure 1. Expression of the IFNAR-1gene was increased in the menstrual endometrium. The expression significantly increased in the menstrual as compared with the proliferative phase (P⬍.01). 166
Ozaki et al.
Expression of the IFNAR-2 gene in endometrial tissues is summarized in Figure 2. Expression of the IFNAR-2 gene was increased in the menstrual and mid to late secretory endometrium. The expression significantly increased in the menstrual and midsecretory phase as compared with in the early to midproliferative phase (P⬍.01). Endometrial Immunohistochemistry for IFNAR-1 and IFNAR-2 Immunohistochemistry for IFNAR-1 expression by using endometrial sections revealed weak staining of the luminal epithelium and superficial glandular epithelium of the endometrium and revealed weak staining of stromal cells in the proliferative phase (Fig. 3A). A weak immunohistochemical staining of the luminal epithelium and superficial glandular epithelium of the endometrium was observed in the secretory phase (Fig. 3B). The intensity of IFNAR-1 staining of glands did not change throughout the menstrual cycle. Weak staining of the luminal epithelium and superficial glandular epithelium of the endometrium was observed throughout the menstrual cycle (Fig. 3C). Immunohistochemistry for IFNAR-2 expression by using endometrial sections revealed weak staining, but little stronger than that for IFNAR-1, of the luminal epithelium and superficial glandular epithelium of the endometrium, as well as weak staining of stromal cells in the proliferative phase
IFNAR and Mx protein in the human endometrium
Vol. 83, No. 1, January 2005
FIGURE 3 Representative examples of endometrial tissue immunostained with anti–IFNAR-1 antibody (A–C). (A) Midproliferative phase tissue (cycle date 10) immunostained with anti-IFNAR-1 antibody. (B) Midsecretory phase tissue (cycle date 19) immunostained with anti–IFNAR-1 antibody. (C) Menstrual phase tissue (cycle date 1) immunostained with anti-IFNAR-1 antibody. Original magnification, ⫻100.
(Fig. 4A). On the other hand, a distinct immunohistochemical staining of the luminal epithelium and superficial glandular epithelium of the endometrium was observed in the secretory phase (Fig. 4B). We also detected IFNAR-2 on the cytolemma of gland cells. Of special interest, the most intense staining of IFNAR-2 was detected on the surface and basement membrane of glands. The intensity of IFNAR-2 staining of glands increased in the mid- to late secretory phase as compared with in the proliferative phase. The staining intensity of stromal cells did not change throughout the menstrual cycle. Weak staining of the luminal epithelium and superficial glandular epithelium of the endometrium was observed throughout the menstrual cycle, whereas almost no staining of stromal cells but distinct staining of red blood cells and lymphocytes was seen in the menstrual phase (Fig. 4C). Expression of MxA and MxB Gene in Normal Endometrium The result of MxA gene expression observed within endometrial tissues is presented in Figure 5. There was no statistical difference in MxAgene expression throughout the menstrual cycle. Additionally, there was no statistical difference in MxBgene expression throughout the menstrual cycle (data not shown). Therefore, there was no significant correlation between IFNAR-1 or IFNAR-2 and MxA or MxB gene expression (data not shown). DISCUSSION In this study, we describe the localization of IFNAR in human endometrium. IFNAR-1 and IFNAR-2 were predominantly localized in the epithelial cells and glands of the endometrium, with little detection or localization in the stroma. The expression of IFNAR-2 was more intense than that of IFNAR-1 in human endometrium throughout the menstrual cycle. This suggests that human endometrium can respond to type I IFNs and that the receptor-mediated site of action for type I IFNs is mainly in gland cells. Additionally, in the present study, the expression of both IFNAR-2 RNA and protein was increased in the epithelial and gland cells during the secretory phase. This finding is similar to that of a previous study using an 125I-labeled IFN assay (32). The notable point was an appearance of intensively expressed IFNAR-2 on the surface and basement membrane of glands in mid-secretory endometrium. Therefore, we suggest that human endometrium can respond to type I IFNs in a paracrine manner. However, it is unclear whether human blastocysts produce type I IFN.
Ozaki. IFNAR and Mx protein in the human endometrium. Fertil Steril 2005.
Fertility and Sterility姞
Interferon- has antiluteolytic, antiviral, antiproliferative, and immunomodulatory effects on the endometrial epithelium (33–38). Isoforms of IFN-, which are expressed only in ruminant trophoblasts, represent one of the five families of related type I IFNs, named IFN-␣, -, -␦, -, and - (39). The ovine conceptus produces IFN- between days 9 and 24 of pregnancy (40). Interferon- acts in a paracrine manner to 167
FIGURE 4 Representative examples of endometrial tissue immunostained with anti-IFNAR-2 antibody (A–C). (A) Midproliferative phase tissue (cycle date 10) immunostained with anti-IFNAR-2 antibody. (B) Midsecretory phase tissue (cycle date 19) immunostained with anti–IFNAR-2 antibody. (C) Menstrual phase tissue (cycle date 1) immunostained with anti-IFNAR-2 antibody. Original magnification, ⫻100.
suppress transcription of estrogen receptor-␣ and oxytocin receptor gene expression in the luminal epithelium and superficial glandular epithelium of the endometrium (41, 42). The oxytocin receptor is not formed on the endometrial luminal epithelium or superficial glandular epithelium, and oxytocin-induced release of luteolytic prostaglandin F2␣ pulses are abrogated to maintain the corpus luteum and production of progesterone (43, 44). Several investigators have studied expression and localization of the oxytocin receptor in human endometrium (45, 46). They have reported that the oxytocin receptor was localized predominantly in the epithelial cells and glands of the endometrium, with little detection or localization in the stroma. The same localization for the oxytocin receptor and IFNAR suggests that type I IFNs may suppress the expression of oxytocin receptors in human endometrium in the same manner as in ruminants. However, the role of oxytocin in human endometrium is not fully understood. Additional investigation is needed to clarify the relationship between the oxytocin response and type I IFN in human endometrium and whether they play a role in the human implantation system. We examined Mx gene expression in human endometrium during a normal menstrual cycle. From the present study, we found that there were nonsignificant differences of Mx A and B gene expression at various stages of the menstrual cycle. Expression of Mx was previously examined in the murine and ovine uterus (28 –30). The Mx gene is expressed constitutively and was IFN inducible in the murine endometrium. Ovine endometrial Mx gene expression is exhibited in uterine luminal and glandular epithelial cells during the estrous cycle (30). The authors speculated from these findings that some immune response involving IFNs was occurring in endometrial epithelial cells. Expression of Mx is thought to be tightly regulated by type I IFNs in immune systems (26). Uterine endometrium is a mucosal tissue and, as a first line of defense against invading pathogens, supports a dynamic resident population of lymphocytes. Many of these cells are situated within or just beneath the luminal epithelium and may respond to viral pathogens with the production of type I IFN (47). Immune cells and red blood cells invading the stroma indicated strong intensity of IFNAR immunoreactivity. The immunoreactivity that is observed in red blood cells may be caused by a nonspecific peroxidase reaction. Even with blocking the sections with hydrogen peroxide, some nonspecific peroxidase reaction might be observed in red blood cells. These findings suggested that, in human endometrium, type I IFN and its induced Mx protein may play a role in these immune responses, such as in the regulation of immune cells, as an antiviral mechanism, and/or in the regulation of cyclic changes during the menstrual cycle.
Ozaki. IFNAR and Mx protein in the human endometrium. Fertil Steril 2005.
168
Ozaki et al.
In conclusion, we demonstrated in this study the expression of IFNAR and IFN-induced Mx protein in human endometrium. Furthermore, the expression of IFNAR was strongest at the menstrual and midsecretory phases. The
IFNAR and Mx protein in the human endometrium
Vol. 83, No. 1, January 2005
FIGURE 5 Quantitative evaluation of MxA gene expression in the human endometrium by RT-PCR TaqMan. Results are expressed as the mean ⫾ SEM of the relative yield of each gene as compared with that of the GAPDH gene. There was no statistical difference in MxAgene expression throughout the menstrual cycle. EP, early proliferative phase; MP, midproliferative phase; LP, late proliferative phase; ES, early secretory phase; MS, midsecretory phase; LS, late secretory phase.
Ozaki. IFNAR and Mx protein in the human endometrium. Fertil Steril 2005.
physiological role of type I IFNs in the human endometrium is unknown at present. Further characterization of the signal transduction cascade may broaden our understanding of the physiological role of type I IFNs in human endometrium. Acknowledgments: The authors acknowledge the helpful advice provided by Kohkichi Hata, M.D., and Ritsuto Fujiwaki, M.D., on the quantitative RT-PCR studies.
REFERENCES 1. Kristina JD, Kamila D, Anthony F. Trophoblast interferon and pregnancy. Reproduction 2001;121:41–9. 2. Bazer FW, Spencer TE, Ott TL. Placental interferons. Am J Reprod Immunol 1996;35:297–308. 3. Martal J, Lacroix MC, Loudes C, Saunier M, Wintenberger-Torres S. Trophoblastin, a luteolytic protein present in early pregnancy in sheep. J Reprod Fertil 1979;56:63–73. 4. Martal JL, Chene NM, Huynh LP, L’Haridon RM, Reinaud PB, Guillomot MW, et al. IFN-tau: a novel subtype I IFN. Structural characteristics, non-ubiquitous expression, structure-function relationships, a pregnancy hormonal embryonic signal and cross-species therapeutic potentialities. Biochimie 1998;80:755–77. 5. Roberts RM, Ealy AD, Alexenko AP, Han CS, Ezashi T. Trophoblast interferons. Placenta 1996;20:259 – 64. 6. Jones KP, Edwin SS, Warnock SH, Mitchell MD, Urry RL. Immunosuppressive activity and alpha interferon concentrations in human embryo culture media as an index of potential for successful implantation. Fertil Steril 1992;57:637– 40.
Fertility and Sterility姞
7. Gunn LK, Homa ST, Searle MJ, Chard T. Lack of evidence for the production of interferon-alpha-like species by the cultured human preembryo. Hum Reprod 1994;9:1522–7. 8. Li J, Roberts RM. Interferon-tau and interferon-alpha interact with the same receptors in uterine endometrium: use of a readily iodinatable form of recombinant interferon-tau for binding studies. J Biol Chem 1994;269:13544 –50. 9. Darnell JE Jr, Kerr IM, Stark GR. JAK-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 1994;264:1415–21. 10. Uze G, Lutfalla G, Gresser I. Genetic transfer of a functional human interferon a receptor into mouse cells: cloning and expression of its cDNA. Cell 1990;60:225–34. 11. Novick D, Cohen B, Rubinstein M. The human interferon ␣/ receptor: characterization and molecular cloning. Cell 1994;77:391– 400. 12. Domanski P, Colamonici OR. The type-I interferon receptor. The long and short of it. Cytokine Growth Factor Rev 1996;7:143–51. 13. Langer J, Garotta G, Pestka S. Interferon receptors. Biotherapy 1996; 8:163–74. 14. Goldman LA, Cutrone EC, Dang A, Hao X, Lim J, Langer JA. Mapping human interferon-alpha (IFN-a2) binding determinants of type I interferon receptor subunit IFNAR-1 with human/bovine IFNAR-1 chimeras. Biochemistry 1998;37:13003–10. 15. Lim JK, Xiong J, Carrasco N, Langer JA. Intrinsic ligand binding properties of the human and bovine alpha-interferon receptors. FEBS Lett 1994;350:281– 6. 16. Nguyen NY, Sackett D, Hirata RD, Levy DE, Enterline JC, Bekisz JB, et al. Isolation of a biologically active soluble human interferon-alpha receptor-GST fusion protein expressed in Escherichia coli. J Interferon Cytokine Res 1996;16:835– 44.
169
17. Hwang SY, Holland KA, Kola I, Hertzog PJ. Binding of interferonalpha and -beta to a component of the human type I interferon receptor expressed in simian cells. Int J Biochem Cell Biol 1996;28:911– 6. 18. Cleary CM, Donnelly RJ, Soh J, Mariano TM, Pestka S. Knockout and reconstitution of a functional human type I interferon receptor complex. J Biol Chem 1994;269:18747–9. 19. Cohen B, Novick D, Barak S, Rubinstein M. Ligand-induced association of the type I interferon receptor components. Mol Cell Biol 1995;15:4208 –14. 20. Domanski P, Witte M, Kellum M, Rubinstein M, Hackett R, Pitha P, et al. Cloning and expression of a long form of the beta subunit of the interferon alpha beta receptor that is required for signaling. J Biol Chem 1995;270:21606 –11. 21. Lutfalla G, Holland SJ, Cinato E, Monneron D, Reboul J, Rogers NC, et al. Mutant U5A cells are complemented by an interferon-alpha beta receptor subunit generated by alternative processing of a new member of a cytokine receptor gene cluster. EMBO J 1995;14:5100 – 8. 22. Russell-Harde D, Pu H, Betts M, Harkins RN, Perez HD, Croze E. Reconstitution of a high affinity binding site for type I interferons. J Biol Chem 1995;270:26033– 6. 23. Cook JR, Cleary CM, Mariano TM, Izotova L, Pestka S. Differential responsiveness of a splice variant of the human type I interferon receptor to interferons. J Biol Chem 1996;271:13448 –53. 24. Curtone EC, Langer JA. Contributions of cloned type I interferon receptor subunits to differential ligand binding. FEBS Lett 1997;404: 197–202. 25. Novick D, Cohen B, Rubinstein M. Soluble interferon-alpha receptor molecules are present in body fluids. FEBS Lett 1992;314:445– 8. 26. Horisberger MA, Gunst MC. Interferon-induced proteins: identification of Mx proteins in various mammalian species. Virology 1991;180: 185–90. 27. Horisberger MA. Interferon-induced protein MxA is a GTPase which binds transiently to cellular proteins. J Virol 1992;66:4705–9. 28. Chang K, Goldspink G, Lida J. Studies on the in vitro expression of influenza resistance gene Mx by in situ hybridization. Arch Virol 1990;110:151– 64. 29. Charleston B, Stewart HJ. An interferon-induced Mx protein: cDNA sequence and high-level expression in the endometrium of pregnant sheep. Gene 1993;137:327–31. 30. Ott TL, Yin J, Wile AA, Kim HT, Gerami-Nami B, Spencer TE, et al. Effects of the estrous cycle and early pregnancy on uterine expression of Mx protein in sheep (Ovis aries). Biol Reprod 1998;59:784 –94. 31. Noyes RW, Hertig AT, Rock J. Dating the endometrial biopsy. Am J Obstet Gynecol 1975;122:262–3. 32. Russell DL, Manalo GG Jr, Findlay JK, Salamonsen LA. Binding sites for interferons on ovine and human endometrial membranes. Reprod Fertil Dev 1993;5:219 –27.
170
Ozaki et al.
33. Flint APF, Stewart HJ, Lamming GE, Payne JH. Role of oxytocin receptor in the choice between cyclicity and gestation in ruminants. J Reprod Fertil 1992;45:53– 8. 34. Bazer FW, Spencer TE, Ott TL. Interferon tau: a novel pregnancy recognition signal. Am J Reprod Immunol 1997;37:412–20. 35. Alexenko AP, Leaman DW, Li JZ, Roberts RM. The antiproliferative and antiviral activities of IFN-tau variants in human cells. J Interferon Cytokine Res 1997;17:769 –79. 36. Godkin JD, Smith SE, Johnson RD, Dore JJE. The role of trophoblast interferons in the maintenance of early pregnancy in ruminants. Am J Reprod Immunol 1997;37:137– 43. 37. Stark GR, Kerr IM, Williams BRG, Silverman RH, Schreiber RD. How cells respond to interferons. Annu Rev Biochem 1998;67:227– 64. 38. Hansen TR, Austin KJ, Perry DJ, Pru JK, Teixeira MG, Johnson GA. Mechanism of action of interferon-tau in the uterus during early pregnancy. J Reprod Fertil Suppl 1999;54:329 –39. 39. Roberts RM, Liu LM, Guo QT, Leaman D, Bixby J. The evolution of type I interferons. J Interferon Cytokine Res 1998;18:805–16. 40. Godkin JD, Bazer FW, Thatcher WW, Roberts RM. Proteins released by cultured day 15–16 conceptus prolong luteal maintenance when introduced into the uterine lumen of cyclic ewes. J Reprod Fertil 1984;71:57– 64. 41. Spencer TE, Bazer FW. Ovine interferon-tau suppresses transcription of estrogen receptor and oxytocin receptor genes in ovine endometrium. Endocrinology 1996;137:1144 –7. 42. Spencer TE, Mirando MA, Mayes JS, Watson GH, Ott TL, Bazer FW. Effects of interferon-tau and progesterone on oestrogen-stimulated expression of receptors for oestrogen, progesterone and oxytocin in the endometrium of ovariectomized ewes. Reprod Fertil Dev 1996;8: 843–53. 43. Wathes DC, Hamon M. Localization of oestradiol, progesterone and oxytocin receptors in the uterus during the oestrous cycle and early pregnancy of the ewe. J Endocrinol 1993;138:479 –91. 44. McCracken JA, Schramm W, Okulicz WC. Hormone receptor control of pulsatile secretion of PGF2a from the ovine uterus during luteolysis and it’s abrogation in early pregnancy. Anim Reprod Sci 1984;7:31–5. 45. Baker PN, Peat ML, Symonds EM, Maynard PV. Endometrial oxytocin binding sites in normal women and in subfertile patients. Postgrad Med J 1990;66:195–9. 46. Takemura M, Nomura S, Kimura T, Inoue T, Onoue H, Azuma C, et al. Expression and localization of oxytocin receptor gene in human uterine endometrium in relation to the menstrual cycle. Endocrinology 1993; 132:1830 –5. 47. Segerson EC, Matterson PM, Gunsett FC. Endometrial T-lymphocyte subset infiltration during the ovine estrous cycle and early pregnancy. J Reprod Immunol 1991;20:221–36.
IFNAR and Mx protein in the human endometrium
Vol. 83, No. 1, January 2005