- Email: [email protected]
Expression patterns of some genes involved in tanshinone biosynthesis in Salvia miltiorrhiza roots
Industrial Crops & Products 130 (2019) 606–614
Contents lists available at ScienceDirect
Industrial Crops & Products journal homepage: www.elsevier.com/locate/indcrop
Expression patterns of some genes involved in tanshinone biosynthesis in Salvia miltiorrhiza roots Yanfang Yanga,b, Shuang Houa, Wei Fanc, Lilan Lud, Nan Huib, Xia Wue, Jianhe Weia,
T
⁎
a
Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing, 100193, China State Key Laboratory of Tree Genetics and Breeding, Key Laboratory of Tree Breeding and Cultivation of State Forestry Administration, The Research Institute of Forestry, Chinese Academy of Forestry, Beijing, 100091, China c State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing, 100091,China d Hainan Branch, Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences & Peking Union Medical College, Haikou, 570311, China e Capital Medical University School of Traditional Chinese Medicine, Beijing, 100069, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Salvia miltiorrhiza Tanshinone MEP pathway MVA pathway Gene expression
Tanshinones are the major bioactive components of Salvia miltiorrhiza, and synthesized through the cytosollocalized mevalonic acid (MVA) and plastid-localized methylerythritol 4-phosphate (MEP) pathways. To reveal correlations between gene expression and tanshinone accumulation, transcript-level variations in five candidate genes involved in tanshinone biosynthesis in the roots of S. miltiorrhiza were investigated at different developmental stages. Additionally, the accumulation of tanshinone I, tanshinone IIA, and cryptotanshinone were analyzed by liquid chromatography tandem mass spectrometry. Compared with the other genes examined, SmCMK (encoding the enzyme 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase) expression was significantly positively correlated with tanshinone production, and SmDXR (1-deoxy-D-xylulose 5-phosphate reductoisomerase) likely functions as a non-rate-limiting enzyme in the tanshinone-biosynthesis pathways of S. miltiorrhiza during different developmental stages, with significant correlations observed between SmDXR and SmCMK expression. Furthermore, no significant correlations were observed between the expression of SmAACT (encoding the enzyme acetyl-CoA acyltransferase), SmHMGR2 (encoding the enzyme 3-hydroxy-3-methylglutaryl-COA reductase), and SmFPPS (encoding the enzyme farnesyl diphosphate synthase), which are involved in the MVA pathway, and tanshinone production during the developmental stages examined, suggesting that the MVA pathway might contribute less to tanshinone accumulation as compared with the MEP pathway. The results in this study indicated that SmCMK might play an important role in their biosynthesis and accumulation. Overall, this study contributes to a better understanding of tanshinone biosynthesis during the different developmental stages of S. miltiorrhiza.
1. Introduction Salvia miltiorrhiza Bunge, commonly known as Danshen in China, is among the most well-known and widely used traditional Chinese herbal medicines in Asia. In terms of its chemical composition, the major bioactive components extracted from Danshen contain lipophilic constituents and phenolic acid derivatives. Most of the lipophilic constituents are diterpene quinone compounds, including tanshinone I (TS I), TS IIA, and cryptotanshinone (CTS), which are major components in
the roots of S. miltiorrhiza (Zhou et al., 2005). Preclinical studies show that these lipophilic constituents have multiple pharmacological activities, including anti-inflammatory (Chen and Xu, 2014), antioxidative (Cao et al., 2015), antitumor (Li et al., 2008), and cytotoxic (Kadioglu and Efferth, 2015) properties, and are effective in the treatment of cardiovascular disorders and cerebrovascular diseases (Gao et al., 2012; Su et al., 2015). Because of the medicinal properties of these lipophilic constituents, the regulatory mechanisms involved in their biosynthesis and accumulation have attracted considerable
Abbreviations: HMGR, 3-hydroxy-3-methylglutaryl-COA reductase; CMK, 4-diphosphocytidyl-2-C-methyl-D-erythritolkinase; AACT, acetyl-CoA acyltransferase; ANOVA, analysis of variance; CTS, cryptotanshinone; CT, cycle threshold value; DXR, 1-deoxy-D-xylulose 5-phosphate reductoisomerase; DMAPP, dimethylallyl diphosphate; FPPS, farnesyl diphosphate synthase; IPP, isopentenyl diphosphate; LC–MS-MS, liquid chromatography-tandem mass spectrometry; MEP, methylerythritol 4-phosphate; MVA, mevalonic acid; qRT-PCR, real-time quantitative PCR; TS I, tanshinone I; TS IIA, tanshinone IIA ⁎ Corresponding author. E-mail address: [email protected] (J. Wei). https://doi.org/10.1016/j.indcrop.2019.01.001 Received 24 August 2018; Received in revised form 29 December 2018; Accepted 1 January 2019 0926-6690/ © 2019 Published by Elsevier B.V.
Industrial Crops & Products 130 (2019) 606–614
Y. Yang et al.
developmental stages, using real-time quantitative PCR (qRT-PCR) analysis. Additionally, accumulation of TS I, TS IIA, and CTS in roots was analyzed at the same developmental stages by liquid chromatography tandem mass spectrometry (LC–MS/MS). This work provides a theoretical basis for determining optimal harvest times and sheds new light on the biosynthetic steps that promote or limit tanshinone production.
attention. Currently, > 40 lipophilic diterpene compounds, including TS I, TS IIA, and CTS, have been identified and isolated from Danshen (Xu et al., 2015). The precursors of these lipophilic constituents, the universal isoprene precursor isopentenyl diphosphate (IPP) and its isomer, dimethylallyl diphosphate (DMAPP), are synthesized via the cytosol-localized mevalonic acid (MVA) pathway and the plastid-localized methylerythritol 4-phosphate (MEP) pathway. In plants, the MVA pathway produces cytosolic IPP for the synthesis of sterols, brassinosteroids, triterpenes, sesquiterpenes, polyterpenes, dolichol, and the isoprenyl groups used for protein prenylation and cytokinin biosynthesis (SauretGüeto et al., 2006), whereas the MEP pathway produces IPP and DMAPP for biosynthesis of photosynthesis-related isoprenoids such as carotenoids and the side chains of chlorophylls, plastoquinones, and phylloquinones, as well as gibberellin and abscisic acid hormones (Rodríguez-Concepción et al., 2004). Many genes encoding the enzymes that catalyze steps in the MVA and MEP pathways have been cloned and reported. For example, 3-hydroxy-3-methylglutaryl-COA reductase (HMGR), which catalyzes the first committed step in the MVA pathway, has been reported in many plant species, and is considered to regulate the synthesis of MVA and the MVA-derived C5 prenyl diphosphates IPP and DMAPP (Harker et al., 2002; Manzano et al., 2004). The enzyme 1deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) catalyzes plastid isoprenoid biosynthesis, with improved metabolic flux through the MEP pathway by increasing DXR production (Guggisberg et al., 2014). The root cortex of Danshen, which contains various tanshinones, has traditionally been used for the preparation of medicinal products. In this regard, it has been demonstrated that the content of biologically active constituents, such as TS I, TS IIA, and CTS, in the roots of S. miltiorrhiza vary during different growth periods (Buchwald and Mrozikiewicz, 2007; Zhou et al., 2012; Zhang et al., 2014). These results indicate that there is an “M”-like pattern in the accumulation of lipophilic components throughout the growth period in S. miltiorrhiza; however, there might be differences in the peak production times of the different components. To date, many genes involved in tanshinone biosynthesis have been isolated and functionally characterized (Wang et al., 2008; Wu et al., 2009; Liao et al., 2009; Cui et al., 2015); however, given that the production of tanshinones varies by developmental stage, correlations between transcript levels of biosynthesis-related genes and the accumulation of lipophilic compounds remain unclear, particularly with respect to genes that control the bottleneck steps of tanshinone biosynthesis (Zhou et al., 2012; Zhang et al., 2014). Therefore, to elucidate the relationship between gene expression and the accumulation of lipophilic constituents at different developmental stages, the transcript-level variations between candidate genes (SmAACT, SmCMK, SmDXR, SmFPPS, and SmHMGR, which encode the enzymes acetyl-CoA acyltransferase, 4-diphosphocytidyl-2-C-methyl-Derythritol kinase, 1-deoxy-D-xylulose 5-phosphate reductoisomerase, farnesyl diphosphate synthase, and 3-hydroxy-3-methyl glutaryl coenzyme A reductase, respectively) involved in terpenoid-backbone biosynthesis in the roots of S. miltiorrhiza were examined at different
2. Materials and methods 2.1. Plant materials Salvia miltiorrhiza plants were grown under natural conditions at the Institute of Medicinal Plant Development, Chinese Academy of Medicinal Sciences & Peking Union Medical College, (116°16ʹ18′′E, 40°02ʹ2′′N; Beijing, China). In the spring of 2008, the plants were propagated on April 10 by root sectioning of the same clone line. The roots were collected and divided into two parts, with one part used for RNA extraction, and the remaining root part collected, dried, and crushed to determine the contents of TS I, TS IIA, and CTS. The roots were collected from summer (June, July, and August) to autumn (September and October). The sampling date was on 2 June, 12 June, 23 June, 2 July, 1 August, 1 September, and 1 October in 2008, respectively. During sampling period, the plants entered early flowering stage since early June, and reached peak flowering stage in middle and late June. From the middle of July, a small number of seeds matured, and a large number of seeds could be harvested at the end of July. Although there were still a few flowers blooming in September or even October, they could not form or grow into mature seeds. Each assay was performed with three biological replicates. 2.2. RNA isolation and the first strand cDNA synthesis Total RNA was isolated directly from 100 mg of the roots at seven developmental stages. The total RNA was treated with RNase-free DNase I at 37 °C for 15 min to remove genomic DNA according to the manufacturer′s instructions (Takara, Shiga, Japan), and the purity of RNA was assessed by 1.5% agarose gel electrophoresis, with no degradation observed. Nucleic acid concentrations were measured by a Qubit Fluorometer with a Quant-iT RNA Assay Kit (Invitrogen, USA). The reverse transcriptase reaction using a M-MLV reverse transcriptase system (Invitrogen, USA), oligo(dT)18 and random primers was conducted out at 37 °C for 1 h in a total volume of 20 μL according to the manufacturer’s protocol. 2.3. Gene sequences confirmation The specific primers were designed according to the full length of the target genes with Primer 3 (http://frodo.wi.mit.edu/) (Table 1). All primers were HPLC purified. Total RNA was extracted from a mixture of roots, tender leaves, and flowers and translated into the first strand cDNA. This cDNA was used as a template to amplify the five target
Table 1 Primers used for qRT-PCR analysis of SmAACT, SmCMK, SmDXR, SmFPPS, SmHMGR2 and Ubiquitin. Gene Name
Primer sequences (5'→ 3')
Primer sequences (3'→ 5')
SmAACT SmCMK SmDXR SmFPPS SmHMGR2 Ubiquitin
ATGCTGAAGGACGGACTCTGGGATG ATGAGAAAAGAAGAAGGGGATATCA GAGAATCTACTGCTCCGAGA TTTTACCTCCCAGTTGCTTGTG GCAACATCGTCTCCGCCGTCTACA GTTGATTTTTGCTGGGAAGC
TTGTCAACAATGGTGGATGG TCAGGAAAAAGACAGGGGTTG CTGGTCGTAGTGGATGATCT TTTACAACCAGCCAAGAACATT GATGGTGGCCAGCAGCCTGGAGTT GATCTTGGCCTTCACGTTGT
Note: AACT, acetyl-CoA acyltransferase; CMK, 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase; DXR, deoxyxylulose-5-phosphate reductoisomerase; FPPS, farnesyl diphosphate synthase; HMGR, 3-hydroxy-3-methyl glutaryl coenzyme A reductase. Ubiquitin was used as reference gene. 607
Industrial Crops & Products 130 (2019) 606–614
Y. Yang et al.
Fig. 1. PCR amplification of SmAACT, SmCMK, SmDXR, SmFPPS, and SmHMGR2 using specific primers developed for the qRT-PCR analysis in Salvia miltiorrhiza. Note: AACT, acetyl-CoA acyltransferase; CMK, 4-diphosphocytidyl-2-Cmethyl-D-erythritol kinase; DXR, deoxyxylulose-5-phosphate reductoisomerase; FPPS, farnesyl diphosphate synthase; and HMGR, 3hydroxy-3-methyl glutaryl coenzyme A reductase.
of Danshen was weighed into a 10-mL amber volumetric flask, mixed with methanol, and sonicated for 30 min. The mixture was filtered through a 0.45-μm PTFE filter (Shimadzu, Tokyo, Japan) to obtain the test solution. The HPLC analysis was carried out on a C18 column (Eclipse Plus C18 2.1 × 150 mm, 5 μm; Agilent Technologies, Santa Clara, CA, USA) consisting of isocratic elution with 70% acetonitrile and 30% formic acid aqueous solution (1.6%). The flow rate was 0.20 mL/min, and the injection volume was 10 μL. Agilent XCT ion trap mass spectrometers (Agilent, USA), equipped with an ion-spray (pneumatically assisted electrospray) interface, were employed.
genes using specific primers. The PCR samples were prepared as follows: 0.5 μL RT product was amplified in a 25 μL volume containing 2.5 μL of 10 × PCR buffer with MgCl2, 0.5 μL of 10 mM dNTPs (Takara, Japan), 0.5 μL of Taq DNA polymerase (Takara, Japan), and 0.5 μL of 10 mM each specific primer. Amplifications were performed with the following setting: 94 °C for 2 min, followed by 40 cycles at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s and a final extension 72 °C for 10 min. The PCR products for the five genes were verified by electrophoresis on a 1.5% agarose gel and purified using a QIAquick PCR Purification Kit (Qiagen, Germany) according to the manufacturer’s instructions. The purified products were cloned into the pGEM-T vector (Promega, Madison, WI, USA) and sequenced by an ABI3730 sequencer (Invitrogen, Shanghai, China). The sequences of the amplified products were confirmed using BLAST (NCBI; http://www.ncbi.nlm.nih.gov/).
2.6. Statistical analyses For the qRT-PCR experiment, data were analyzed using the 2−ΔΔCT method (Livak and Schmittgen, 2001), and ANOVA and Pearson’s simple correlation were carried out in SAS (version 9.2; SAS Institute, Cary, NC, USA).
2.4. Quantitative real time PCR assay and amplification efficiency of test genes qRT-PCR was performed as previously described, using Ubiquitin as the housekeeping genes (Yang et al., 2010). The qRT-PCR reactions were performed in triplicate in a 25 μL volume containing 1 μL cDNA, 0.3 μM of each primer, and 12.5 μL 2 × SYBR green PCR master mix (Takara, Japan). A negative control with cDNA template replaced by water was included in the same qRT-PCR run for each primer pair. The qRT-PCR assays were performed using three technical and two biological replicates with similar results. Using the cDNA derived from the sample that include root, tender leaf and flower RNA as a template, the primer efficiency of the genes of interest and the reference genes were calculated based on a standard curve generated using a fourfold dilution series over at least four dilution points measured in triplicate.
3. Results 3.1. Sequence confirmation Primers were designed based on five full-length cDNA sequences [SmAACT (EF635969), SmHMGR2 (FJ747636), SmCMK (EF534309), SmDXR (DQ991431), and SmFPPS (EF635968)] and demonstrated as being specific for each gene in subsequent qRT-PCR experiments. Each PCR reaction produced the single predicted band without any artifact bands, such as those associated with primer dimmers, in the electrophoretic diagram (Fig. 1). Sequencing results confirmed that the expected sequences were unique, and the qRT-PCR experiments showed that the primers were specific, yielding a unique absorption peak for each of the examined genes (Fig. 2). Therefore, the results indicated high specificity of the six designed primer pairs and thus their suitability for use in subsequent qRT-PCR assays.
2.5. LC–MS-MS investigation of lipophilic components in the roots of S. miltiorrhiza The LC–MS-MS method was used to investigate the contents of TS I, TS IIA, and CTS at seven time points during the development process of S. miltiorrhiza. The standards of TS I, TS IIA, and CTS were purchased from the National Institute for the Control of Pharmaceutical and Biological Products (Beijing, China) (purity 98%). Methanol with HPLC grade was obtained from Dikma (Beijing, China), and water for HPLC analysis was purified with a Milli-Q water system (Millipore Corp, Bedford, MA, USA). Approximately 10 mg of the powdered crude drug
3.2. Amplification efficiencies of target and reference genes The 2−ΔΔCT (Livak) method is commonly used for the analysis of relative gene expression based on qRT-PCR; however, this method requires that the amplification efficiency of both target and reference genes should be close to 100%. Therefore, amplification efficiencies of the five target genes and Ubiquitin, the reference gene, were confirmed by amplifying the cDNA derived from a sample composing root, tender 608
Industrial Crops & Products 130 (2019) 606–614
Y. Yang et al.
Fig. 2. Melting curves associated with qRT-PCR analysis of SmAACT, SmCMK, SmDXR, SmFPPS, and SmHMGR2 expression in Salvia miltiorrhiza. (A) SmAACT; (B) SmCMK; (C) SmDXR; (D) SmFPPS; and (E) SmHMGR2. (F) Ubiquitin was the reference gene. Note: AACT, acetyl-CoA acyltransferase; CMK, 4-diphosphocytidyl-2-Cmethyl-D-erythritol kinase; DXR, deoxyxylulose-5-phosphate reductoisomerase; FPPS, farnesyl diphosphate synthase; and HMGR, 3-hydroxy-3-methyl glutaryl coenzyme A reductase.
Fig. 3. The standard curves associated with qRT-PCR analysis of SmAACT, SmCMK, SmDXR, SmFPPS, SmHMGR2, and Ubiquitin (reference gene). (A) SmAACT; (B) SmCMK; (C) SmDXR; (D) SmFPPS; (E) SmHMGR2; (F) Ubiquitin. Note: AACT, acetyl-CoA acyltransferase; CMK, 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase; DXR, deoxyxylulose-5-phosphate reductoisomerase; FPPS, farnesyl diphosphate synthase; and HMGR, 3-hydroxy-3-methyl glutaryl coenzyme A reductase.
leaf, and flower RNAs. All six qRT-PCR assays detected the expected sequences, and with the qRT-PCR efficiencies of all assays between 95% and 102% (Fig.3; Table 2). These results showed that the expression data for the target and reference genes were consistent and that the 2ΔΔCT method could be employed for qRT-PCR analysis.
at seven developmental stages from June to October 2008 (Fig. 4). The similar expression patterns for SmAACT and SmHMGR2 that encode MVA-pathway enzymes were observed (Fig. 4A and C), whereas these differed from the expression of genes involved in the MEP pathway (Fig. 4). The highest expression of SmAACT and SmHMGR2 was detected on 23 June, and remained at relatively lower levels thereafter until the end of the experimental period. Although there was no significant difference in SmAACT expression between 12 June and 23 June, SmHMGR2 expression on 23 June was clearly higher than that on 12 June. Notably, expression of the MEP-pathway genes SmDXR and SmCMK gradually increased until 12 June, followed by subsequent
3.3. The expression patterns of the five target genes in different developmental stages The expression patterns of the five genes encoding enzymes catalyzing key steps in the tanshinone-synthesis pathways were investigated 609
Industrial Crops & Products 130 (2019) 606–614
Y. Yang et al.
peaks in expression on 1 Sept and 2 July, respectively (Fig. 4B and D). Transcripts of the other MVA-pathway gene, SmFPPS, showed a different expression pattern, which gradually increased until 23 June, followed by a gradual decrease until the end of the experimental period without any further peaks.
Table 2 PCR efficiency for the examined and reference genes. Gene name
PCR efficiency (%)
r^2
Slope
SmAACT SmCMK SmDXR SmFPPS SmHMGR2 Ubiquitin
101.350 98.476 99.747 96.529 98.072 96.803
0.999 0.974 0.968 0.969 0.988 0.991
−3.290 −3.359 −3.328 −3.408 −3.369 −3.401
3.4. Determination of tanshinone content in the roots of S. miltiorrhiza by LC–MS/MS The content of the major lipophilic components of S. miltiorrhiza (TS I, TS IIA, and CTS) was investigated at different developmental stages. The results showed that all three components increased initially and accumulated to high levels at the blooming stage and peaked on 12 June, followed by a decline until the terminal flowering stage (Fig. 5).
Note: AACT, acetyl-CoA acyltransferase; CMK, 4-diphosphocytidyl-2-C-methylD-erythritol kinase; DXR, deoxyxylulose-5-phosphate reductoisomerase; FPPS, farnesyl diphosphate synthase; HMGR, 3-hydroxy-3-methyl glutaryl coenzyme A reductase. Ubiquitin was used as reference gene.
Fig. 4. The expression levels target genes at different developmental stages of Salvia miltiorrhiza. (A) SmAACT, (B) SmDXR, (C) SmHMGR2, (D) SmCMK, and (E) SmFPPS. Note: AACT, acetyl-CoA acyltransferase; DXR, deoxyxylulose-5-phosphate reductoisomerase; HMGR, 3-hydroxy-3-methyl glutaryl coenzyme A reductase; CMK, 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase; and FPPS, farnesyl diphosphate synthase. 610
Industrial Crops & Products 130 (2019) 606–614
Y. Yang et al.
Fig. 5. The contents of TS I, TS IIA, and CTS at seven different developmental stages of Salvia miltiorrhiza. The letters above the triangles, squares and circles indicate significant differences according to Tukey’s post-hoc test (p < 0.05). The lower, middle and higher letters indicate the different contents of TS I, TS IIA, and CTS, respectively. Note: TS I, tanshinone I; TS IIA, tanshinone IIA; CTS, cryptotanshinone.
expression of SmHMGR2 and SmFPPS, which are involved in the MVA pathway, and the contents of TS I, TS IIA, and CTS, with this correlation also not significant (p > 0.05). Interestingly, the expression of SmHMGR2 was strongly correlated with that of SmFPPS (r = 0.945; p < 0.01), and the significant positive correlations between the content of TS I, TS IIA, and CTS each other were detected (Table 3).
Specifically, the content of TS I and TS IIA clearly increased from 2 June to 12 June, followed by slight decrease until 1 October. However, the content of CTS differed from TS I and TS IIA, it clearly indicated an “M”like pattern of the accumulation, showing a similar pattern as that of TS I and TS IIA from 2 June to 2 July, but there was a second peak on 1 August as compared with 1 October. Moreover, the content of TS I was lower than that of either TS IIA or CTS at the seven developmental stages, and although the contents of TS IIA and CTS were similar on 2 June, CTS content was higher than that of TS IIA on 12 June and 1 August when the lipophilic components accumulated rapidly.
4. Discussion The mechanisms underlying the biosynthesis of plant secondary metabolites constitute highly complex, tightly regulated processes, with many studies having shown that seasonal climate is among the important factors influencing the production and accumulation of these metabolites (Nasiri et al., 2016). For example, in S. miltiorrhiza, Deng et al., (2009) previously observed an initial peak in the accumulation of lipophilic components during the period from May to July, followed by a second peak during the period from October to November. Consequently, a comprehensive understanding of the interactions among molecular mechanisms involved in tanshinone biosynthesis and the inevitable effects of seasonal climate could potentially contribute to approaches designed to enhance the yield of these lipophilic constituents. In this context, the molecular pathway associated with tanshinone biosynthesis in S. miltiorrhiza has been well characterized, and the S. miltiorrhiza genome has been sequenced, allowing discovery of ˜20 different enzymatic steps involved in tanshinone biosynthesis (Xu et al., 2016). However, the simultaneous regulatory roles of developmental- stage cues toward gene expression and tanshinone
3.5. Correlations between tanshinone content and gene-expression data at different developmental stages To determine whether the five target genes might influence tanshinone production at different stages, the correlation analysis to determine the potential relationships between tanshinone content and relative gene-expression data were performed. As shown in Table 3, we detected a relatively high significant positive correlation between the expression of SmCMK and TS I (r = 0.779; p < 0.05), TS IIA (r = 0.799; p < 0.05), and CTS (r = 0.796; p < 0.05) contents, suggesting that it was well correlated with the tanshinone accumulation. Although a strong correlation was detected between the expression of SmCMK and SmDXR (r = 0.855; p < 0.05), there was only a moderate relationship between SmDXR expression and the production of the three tanshinones, with no significance in this correlation (p > 0.05). Moreover, there was low correlation between the
Table 3 Pearson correlation coefficient analysis of relationships between target gene expression and tanshinone contents at different developmental stages. Significant correlations (p < 0.05 and p < 0.01, respectively) according to two-tailed analysis.
SmAACT SmHMGR2 SmDXR SmCMK SmFPPS TS I TS IIA CTS
SmAACT
SmHMGR2
SmDXR
SmCMK
SmFPPS
TS I
TS IIA
CTS
1
0.600 1
−0.078 −0.348 1
−0.338 −0.175 0.855* 1
0.415 0.945** −0.419 −0.179 1
0.064 0.468 0.509 0.779* 0.423 1
0.100 0.407 0.568 0.799* 0.330 0.988* 1
0.067 0.358 0.583 0.796* 0.269 0.956* 0.981* 1
Note: AACT, acetyl-CoA acyltransferase; CMK, 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase; DXR, deoxyxylulose-5-phosphate reductoisomerase; FPPS, farnesyl diphosphate synthase; HMGR, 3-hydroxy-3-methyl glutaryl coenzyme A reductase; TS I, tanshinone I; TS IIA, tanshinone IIA; CTS, cryptotanshinone. 611
Industrial Crops & Products 130 (2019) 606–614
Y. Yang et al.
identified as a rate-limiting step in isoprenoid biosynthesis via the MVA pathway (Dai et al., 2011). Kai et al. (2011) reported that overexpression of SmHMGR in S. miltiorrhiza can significantly enhances the production of tanshinones (a 2.1- to 5.7-fold increase as compared with the control). Previously, SmHMGR2 was reported as a novel and important enzyme involved in tanshinone biosynthesis, gene overexpression of which also enhances the production of tanshinones and squalene in cultured hairy roots of S. miltiorrhiza (Dai et al., 2011). As mentioned previously, most isoprenoids in plants are derived from the plastid-localized MEP pathway (Wright et al., 2014). In the present study, the results clearly indicated no significant correlation between the SmHMGR2 expression and the contents of TS I, TS IIA, and CTS. Moreover, a strong correlation between the expression of SmHMGR2 and SmFPPS were detected, which was also not correlated with the contents of TS I, TS IIA, and CTS (Table 3). Similarly, SmAACT, a gene involved in the MVA pathway and examined in the present study, showed no correlation with the contents of TS I, TS IIA, and CTS (Table 3). Therefore, it was speculated that the MVA pathway might play a less prominent role in tanshinone accumulation, and in this regard, further studies should be conducted in order to elucidate correlations among other genes within the MVA and MEP pathways and the biosynthesis and accumulation of tanshinones during different developmental stages. Because it was reported that methyl jasmonate elicit the production of CTS in S. miltiorrhiza cell-suspension cultures (Chen and Chen, 1999), many investigations have been conducted to assess the potential consequences associated with exogenous and endogenous factors, such as environmental perturbations (Dowom et al., 2017; Chen et al., 2018; Yang et al., 2018), different plant tissues (Xu et al., 2010), nutrition stress (He et al., 2013), geo-authentic habitats (Pan et al., 2011), and various differences in genetics and genotypes (Song et al., 2016). Furthermore, efforts have been made to explore possible connections between the transcript levels of the genes involved in tanshinone-biosynthesis pathways and tanshinone accumulation (Li et al., 2018). The results of the present study revealed variations in tanshinones accumulation with the transcription level of specific genes in roots during the developmental stages, suggesting that sampling date or environmental signals play pivotal roles in tanshinone production and/or gene regulation in S. miltiorrhiza.
accumulation remain unclear; therefore, further research should be delved deeper in order to understand tanshinone production and accumulation in S. miltiorrhiza In the present study, maximum accumulations of TS I, TS IIA, and CTS were observed on 12 June, which is consistent with the findings of previous studies (Zhang et al., 2007; Deng et al., 2009; Liu et al., 2012); however, other studies recorded maximal accumulations of TS IIA and CTS in September and November, respectively (Zhao et al., 2015; Zhai et al., 2016). A number of different factors, including cropping pattern, genetic and epigenetics factors, production habitat, and growing time, can be considered to have effects on lipophilic component biosynthesis and accumulation, and consequently the occurrence of different peaks (Zhang et al., 2015). In this regard, a significant positive correlation between SmCMK activity and TS I, TS IIA, and CTS production in the roots of S. miltiorrhiza were observed. CMK, the only kinase known to participate in the MEP pathway, is induced by methyl jasmonate, which in turn contributes to enhancing the tanshinone accumulation (Wang et al., 2008). In the present study, the strong positive correlation detected between SmCMK expression and the tanshinone content indicated that tanshinone biosynthesis is strongly dependent upon CMK activity. Almost all lipophilic components are found to accumulate in roots of S. miltiorrhiza, and particularly in the epidermis of the cortex. To elucidate the related gene expression in the roots of S. miltiorrhiza, the expression patterns of genes of interest in the cortex and xylem were analyzed, and the results accordingly showed that SmCMK was clearly more highly expressed in the cortex than in the xylem (data not shown). Therefore, these results indicate that SmCMK might play important roles in tanshinone biosynthesis and accumulation, and further study about this gene should be attracted attention in order to gain a better understanding of the metabolic control of the MEP pathway at gene and protein levels. The MEP pathway comprises seven enzymatic steps, the second step of which involves the conversion of 1-deoxy-D-xylulose-5-phosphate to MEP catalyzed by DXR (Banerjee and Sharkey, 2014). In previous studies of the key enzymes controlling metabolic flux in the MEP pathway, DXR and 1-deoxy-d-xylulose-5-phosphate synthase (DXS) were isolated in many plant species, with these two genes implicated in plastid isoprenoid biosynthesis (Han et al., 2003; Gong et al., 2006; MuñozBertomeu et al., 2006; Yao et al., 2008; Yan et al., 2009; Zhu et al., 2014). In different plant species, positive correlations have been identified between enhanced isoprenoid biosynthesis and accumulation of the transcripts encoded by DXR and DXS (Mayrhofer et al., 2005; Bede et al., 2006; Muñoz-Bertomeu et al., 2006). Moreover, overexpression of DXR in Arabidopsis and tobacco revealed that elevated DXR levels lead to enhanced accumulation of plastid isoprenoids (Carretero-Paulet et al., 2006; Hasunuma et al., 2008). Other studies reported that the regulatory role of DXR in plants appears species-specific. The DXR enzyme does not play a crucial role in or shows a lack of direct correlation with carotenoid accumulation in tomato (Rodríguez-Concepción et al., 2001), or the accumulation of volatile perpenoids in Antirrhinum majus (Dudareva et al., 2005), or the synthesis of plastidial monoterpene precursors (Mendoza-Poudereux et al., 2014). However, in the present study, no significant correlation between SmDXR expression and the contents of TS I, TS IIA and CTS were found. Nevertheless, it was demonstrated that SmDXR expression was correlated with that of SmCMK (Table 3). These results indicated that although SmDXR plays an important role in tanshinone biosynthesis, unlike SmCMK, it likely functions as a non-rate-limiting enzyme in the tanshinone-biosynthesis pathways of S. miltiorrhiza during different developmental stages. Taken together, previous results and the results of the present study indicate that multiple genes are involved in regulating diterpenoid metabolic flux. The occurrence of cross-talk between the MVA and MEP pathways in plants was previously demonstrated using isotope tracer methods (Skorupinska-Tudek et al., 2008; Mendoza-Poudereux et al., 2015). The conversion of HMG-CoA to mevalonate catalyzed by HMGR was
5. Conclusion In summary, the results in the present study showed that content of the tanshinones TS I, TS IIA, and CTS and the expression patterns of associated genes clearly varied according to the developmental stage in S. miltiorrhiza. In addition to providing important insights into gene expression patterns associated with tanshinone-biosynthesis pathways in S. miltiorrhiza, these observations in the present study make an important contribution to determining harvest times for optimal tanshinone yields. It was demonstrated that the expression pattern of SmCMK was more significantly correlated with tanshinone production than that of other examined genes, particularly those associated with the MVA pathway. Furthermore, the findings of this study enhance the current understanding of the important rate-limiting steps in tanshinone biosynthesis, and provide a foundation for further analyses of the complex mechanistic interactions that underpin tanshinone-biosynthetsis pathways. Conflicts of interest The authors declare no conflicts of interest. Acknowledgments This work was supported by the Special Funds in Basic Scientific Research for Non-Profit Research Institutes financed by the Ministry of 612
Industrial Crops & Products 130 (2019) 606–614
Y. Yang et al.
Finance, People′s Republic of China (No. YZ-08-19), National Natural Science Foundation of China (31570675), and a grant for National nonprofit Research Institutions of Chinese Academy of Forestry (CAFYBB2018SY009). The authors thank Dr. Lingyong Li (Baylor College of Medicine), and Guanghong Cui and Luqi Huang (Institute of Chinese Materia Medica, Academy of Chinese Medical Sciences) for their helpful suggestions. We also thank Professor Zhongwen Huang (Henan Institute of Science and Technology, Henan Collaborative Innovation Center of Modern Biological Breeding) for assistance with ANOVA and Pearson’s simple correlation analyses using SAS 9.2 software.
Metabolic engineering tanshinone biosynthetic pathway in Salvia miltiorrhiza hairy root cultures. Metab. Eng. 13, 319–327. Li, Q.F., Shi, S.L., Liu, Q.R., Tang, J., Song, J., Liang, Y., 2008. Anticancer effects of ginsenoside Rg1, cinnamic acid, and tanshinone IIA in osteosarcoma MG-63 cells: nuclear matrix downregulation and cytoplasmic trafficking of nucleophosmin. Int. J. Biochem. Cell Biol. 40, 1918–1929. Li, S., Lin, A.Z., Yang, Y., Shen, Y.F., Rao, Y., Yang, J., Liu, Y.H., Zhou, W., 2018. Research progress on molecular regulation mechanism involved in the biosynthetic pathway of tanshinone in Salvia miltiorrhiza. J. Zhejiang A&F Univ. 35 (2), 367–375. Liao, P., Zhou, W., Zhang, L., Wang, J., Yan, X.M., Zhang, Y., Zhang, R., Li, L., Zhou, G.Y., Kai, G.Y., 2009. Molecular cloning, characterization and expression analysis of a new gene encoding 3-hydroxy-3-methylglutaryl coenzyme A reductase from Salvia miltiorrhiza. Acta Physiol. Plant. 31, 565–572. Liu, L.D., Xie, X.L., Wen, C.X., Tian, W., Liu, M., Zhou, Q.M., 2012. Study on accumulation of effective components of Salvia miltiorrhiza. J. Hebei Agric. Sci. 16, 32–34 (In Chinese). Livak, K., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25 (4), 402–408. Manzano, D., Fernández-Busquets, X., Schaller, H., González, V., Boronat, A., Arró, M., Ferrer, A., 2004. The metabolic imbalance underlying lesion formation in Arabidopsis thaliana overexpressing farnesyl diphospate synthase (isoform 1S) leads to oxidative stress and is trigged by the developmental decline of endogenous HMGR activity. Planta 219, 982–992. Mayrhofer, S., Teuber, M., Zimmer, I., Louis, S., Fischbach, R.J., Schnitzier, J.P., 2005. Diurnal and seasonal variation of isoprene biosynthesis-related genes in grey poplar leaves. Plant Physiol. 139, 474–484. Mendoza-Poudereux, I., Muñoz-Bertomeu, J., Arrillaga, I., Segura, J., 2014. Deoxyxylulose 5-phosphate reductoisomerase is not a rate-determining enzyme for essential oil production in spike lavender. J. Plant Physiol. 171 (17), 1564–1570. Mendoza-Poudereux, I., Kutzner, E., Huber, C., Segura, J., Eisenreich, W., Arrillaga, I., 2015. Metabolic cross-talk between pathways of terpenoid backbone biosynthesis in spike lavender. Plant Physiol. Biochem. 95, 113–120. Muñoz-Bertomeu, J., Arrillaga, I., Ros, R., Segura, J., 2006. Up-regulation of 1-deoxy-Dxylulose-5-phosphate synthase enhances production of essential oils in transgenic spike lavender. Plant Physiol. 142, 890–900. Nasiri, J., Naghavi, M.R., Alizadeh, H., Moghadam, M.R.F., 2016. Seasonal-based temporal changes fluctuate expression patterns of txs, dbat, bapt, and dbtnbt, genes alongside production of associated taxanes in taxus baccata. Plant Cell Rep. 35 (5), 1103–1119. Pan, X.M., Wei, H., Liu, Y., Liu, S.X., Zhang, T.J., Ma, X.W., Han, F.N., 2011. Study on quality of Salvia miltiorrhiza from different habitats. Chin. Trad. Herbal Drugs 42 (9), 1833–1836. Rodríguez-Concepción, M., Ahumada, I., Diez-Juez, E., Sauret-Güeto, S., Lois, L.M., Gallego, F., Carretero-Paulet, L., Campos, N., Boronat, A., 2001. 1-Deoxy-d-xylulose 5-phosphate reductoisomerase and plastid isoprenoidbiosynthesis during tomato fruit ripening. Plant J. 27, 213–222. Rodríguez-Concepción, M., Forés, O., Martínez-García, J.F., González, V., Phillips, M.A., Ferrer, A., Boronat, A., 2004. Distinct light-mediated pathways regulate the biosynthesis and exchange of isoprenoid precursors during Arabidopsis seedling development. Plant Cell 16, 144–156. Sauret-Güeto, S., Botella-Pavía, P., Flores-Pérez, Ú., Martínez-García, J.F., Román, C.S., León, P., Boronat, A., Rodríguez-Concepción, M., 2006. Plastid cues posttranscriptionally regulate the accumulation of key enzymes of the methylerythritol phosphate pathway in Arabidopsis. Plant Physiol. 141, 75–84. Skorupinska-Tudek, K., Poznanski, J., Wojcik, J., Bienkowski, T., Szostkiewicz, I., Zelman-Femiak, M., Bajda, A., Chojnacki, T., Olszowska, O., Grunler, J., Meyer, O., Rohmer, M., Danikiewicz, W., Swiezewska, E., 2008. Contribution of the mevalonate and methylerythritol phosphate pathways to the biosynthesis of dolichols in plants. J. Biol. Chem. 283, 21024–21035. Song, Z.Q., Wang, J.H., Li, X.F., 2016. Expression profiles of genes involved in tanshinone biosynthesis of two Salvia miltiorrhiza genotypes with different tanshinone contents. J. Genet. 95 (2), 433–439. Su, C.Y., Ming, Q.L., Rahman, K., Han, T., Qin, L.P., 2015. Salvia miltiorrhiza: traditional medicinal uses, chemistry, and pharmacology. Chin. J. Nat. Med. 13 (3), 163. Wang, X.Y., Cui, G.H., Huang, L.Q., Gao, W., Yuan, Y., 2008. A full length cDNA of 4(cytidine 5’-diphospho)-2-C-methyl-D-erythritol kinase cloning and analysis of introduced gene expression in Salvia miltiorrhiza. Yao Xue Xue Bao 43, 1251–1257 (in Chinese). Wright, L.P., Rohwer, J.M., Ghirardo, A., Hammerbacher, A., Ortiz-Alcaide, M., Raguschke, B., Schnitzler, J.P., Gershenzon, J., Phillips, M.A., 2014. Deoxyxylulose 5Phosphate synthase controls flux through the methylerythritol 4-Phosphate pathway in Arabidopsis. Plant Physiol. 165, 1488–1504. Wu, S.J., Shi, M., Wu, J.Y., 2009. Cloning and characterization of the 1-deoxy-D-xylulose 5-phosphate reductoisomerase gene for diterpenoid tanshinone biosynthesis in Salvia miltiorrhiza (Chinese sage) hairy roots. Biotechnol. Appl. Biochem. 52, 89–95. Xu, C.H., Shu, Z.M., Wang, Y., Miao, F., Zhou, L., 2010. The accumulation rule of the main medicinal components in different organs of Salvia miltiorrhiza Bunge. And Salvia miltiorrhiza Bunge.f. Alba. Lishizhen Med. Materia Med. Res. 21 (9), 2129–2132. Xu, Z.C., Peters, R.J., Weirather, J., Luo, H.M., Liao, B.S., Zhang, X., Zhu, Y.J., Ji, A.J., Zhang, B., Hu, S.N., Au, K.F., Song, J.Y., Chen, S.L., 2015. Full‐length transcriptome sequences and splice variants obtained by a combination of sequencing platforms applied to different root tissues of salvia miltiorrhiza and tanshinone biosynthesis. Plant J. 82 (6), 951–961. Xu, H., Song, J., Luo, H., Zhang, Y., Li, Q., Zhu, Y., Xu, J., Li, Y., Song, C., Wang, B., Sun, W., Shen, G., Zhang, X., Qian, J., Ji, A., Xu, Z., Luo, X., He, L., Li, C., Sun, C., Yan, H., Cui, G., Li, X., Li, X., Wei, J., Liu, J., Wang, Y., Hayward, A., Nelson, D., Ning, Z.,
References Banerjee, A., Sharkey, T.D., 2014. Methylerythritol 4-phosphate (MEP) pathway metabolic regulation. Nat. Prod. Rep. 31, 1043. Bede, J.C., Musser, R.O., Felton, G.W., Korth, K.L., 2006. Caterpillar herbivory and salivary enzymes decrease transcript levels of Medicago truncatula genes encoding early enzymes in terpenoid biosynthesis. Plant Mol. Biol. 60, 519–531. Buchwald, W., Mrozikiewicz, P.M., 2007. Influence of development stage on the content of biologicaly active compounds of Salvia miltiorrhiza Bunge roots. Herba Pol. 53, 15–19. Cao, H., Zhang, L., Sun, Z.B., Cheng, X.H., Zhang, Y., Zou, H.B., 2015. Salvia miltiorrhiza prevents deep vein thrombosis via antioxidative effects in endothelial cells. Mol. Med. Rep. 11, 3593–3600. Carretero-Paulet, L., Cairó, A., Botella-Pavía, P., Besumbes, O., Campos, N., Boronat, A., Rodríguez-Concepción, M., 2006. Enhanced flux through the methylerythritol 4phosphate pathway in Arabidopsis plants overexpressing deoxyxylulose 5-phosphate reductoisomerase. Plant Mol. Biol. 62, 683–695. Chen, H., Chen, F., 1999. Effects of methyl jasmonate and salicylic acid on cell growth and cryptotanshinone formation in Ti transformed Salvia miltiorrhiza cell suspension cultures. Biotechnol. Lett. 21 (9), 803–807. Chen, Z., Xu, H., 2014. Anti-Inflammatory and immunomodulatory mechanism of tanshinone IIA for atherosclerosis. Evid. Based Complement. Alternat. Med. 2014, 267976. Chen, I.J., Lee, M.S., Lin, M.K., Ko, C.Y., Chang, W.T., 2018. Blue light decreases tanshinone IIA content in Salvia miltiorrhiza hairy roots via genes regulation. J. Photochem. Photobiol. B, Biol. 183, 164–171. Cui, G.H., Duan, L.X., Jin, B.L., Qian, J., Xue, Z.Y., Shen, G.A., Snyder, J.H., Song, J.Y., Chen, S.L., Huang, L.Q., Peters, R.J., Qi, X.Q., 2015. Functional divergence of diterpene syntheses in the medicinal plant Salvia miltiorrhiza Bunge. Plant Physiol. 169, 1607–1618. Dai, Z.B., Cui, G.H., Zhou, S.F., Zhang, X.A., Huang, L.Q., 2011. Cloning and characterization of a novel 3-hydroxy-3-methylglutaryl coenzyme A reductase gene from Salvia miltiorrhiza involved in diterpenoid tanshinone accumulation. J. J. Plant Physiol. 168 (2), 148–157. Deng, Q.H., Pan, Y.C., Peng, Y., Cao, J.B., Gao, Z.M., 2009. Study on the optimal collection time of Salvia miltiorrhiza. Res. Pract. Chin. Med. 23, 3–5 (In Chinese). Dowom, S.A., Abrishamchi, P., Radjabian, T., Salami, S.A., 2017. Enhanced phenolic acids production in regenerated shoot cultures of Salvia virgata Jacq. After elicitation with Ag+ ions, methyl jasmonate and yeast extract. Ind. Crops Prod. 103, 81–88. Dudareva, N., Andersson, S., Orlova, I., Gatto, N., Reichelt, M., Rhodes, D., Wilhelm, B., Jonathan, G., 2005. The non-mevalonate pathway supports both monoterpene and sesquiterpene formationin snapdragon flowers. Proc. Natl. Acad. Sci. U. S. A. 102, 933–938. Gao, S., Liu, Z.P., Li, H., Little, P.J., Liu, P.Q., Xu, S.W., 2012. Cardiovascular actions and therapeutic potential of tanshinone iia. Atherosclerosis 220 (1), 3. Gong, Y.F., Liao, Z.H., Guo, B.H., Sun, X.F., Tang, K.X., 2006. Molecular cloning and expression profile analysis of Gingo biloba DXS gene encoding 1-Deoxy-D-xylulose 5phosphate synthase, the first committed enzyme of the 2-C-Methyl-D-erythritol 4phosphate pathway. Planta Med. 72, 329–335. Guggisberg, A.M., Park, J., Edwards, R.L., Kelly, M.L., Hodge, D.M., Tolia, N.H., Odom, A.R., 2014. A sugar phosphatase regulates the methylerythritol phosphate (MEP) pathway in malaria parasites. Nat. Commun. 5 (4) 4467. Han, Y.S., Roytrakul, S., Verberne, M.C., Heijden, R.V.D., Linthorstc, H.J.M., Verpoortea, R., 2003. Cloning of a cDNA encoding 1-deoxy-d-xylulose 5-phosphate synthase from Morinda citrifolia and analysis of its expression in relation to anthraquinone accumulation. Plant Sci. 164, 911–917. Harker, M., Hellyer, A., Clayton, J.C., Duvoix, A., Lanot, A., Safford, R., 2002. Co-ordinate regulation of sterol biosynthesis enzyme activity during accumulation of sterol biosynthesis enzyme activity during accumulation of sterols in developing rape and tobacco seed. Planta 216, 707–715. Hasunuma, T., Takeno, S., Hayashi, S., Sendai, M., Bamba, T., Yoshimura, S., Tomizawa, K., Fukusaki, E., Miyake, C., 2008. Overexpression of 1-Deoxy-D-xylulose-5-phosphate reductoisomerase gene in chloroplast contributes to increment of isoprenoid production. J. Biosci. Bioeng. 105, 518–526. He, C.E., Lu, L.L., Jin, Y., 2013. Effects of nitrogen on root development and contents of bioactive compounds in Salvia miltiorrhiza bunge. Crop Sci. 53 (5), 2028–2039. Kadioglu, O., Efferth, T., 2015. Pharmacogenomic characterization of cytotoxic compounds from Salvia officinalis in cancer cells. J. Nat. Prod. 78, 762–775. Kai, G.Y., Xu, H., Zhou, C.C., Liao, P., Xiao, J.B., Luo, X.Q., You, L.J., Zhang, L., 2011.
613
Industrial Crops & Products 130 (2019) 606–614
Y. Yang et al.
time of Salvia miltiorrhiza Bunge f. Alba. Shandong Agric. Sci. 46, 82–84 (in Chinese). Zhang, C.L., Liang, Z.S., Guo, H.B., Liu, J.L., Liu, Y., Liu, F.H., Wei, L.Z., 2015. Correlation analysis between meteorological factors, biomass, and active components of Salvia miltiorrhiza in different climatic zones. China J. Chin. Matera Med. 40 (4), 607–613. Zhao, Z.G., Gao, S.R., Xie, J., Yan, B.B., Hou, J.L., Wang, W.Q., Song, Y., Zhang, X.M., Li, J., 2015. Dynamic study on biomass and bioactive ingredients accumulation of roots of Salvia miltiorrhizae in different growth periods. Modern Chin. Med. 11, 1171–1176 (in Chinese). Zhou, L.M., Zuo, Z., Chow, M.S., 2005. Danshen: an overview of its chemistry, pharmacology, pharmacokinetics, and clinical use. J. Clin. Pharmacol. 45, 1345–1359. Zhou, L.L., Yi, W.Z., Qi, J.J., Sun, P., Li, X.E., 2012. Effect of varieties and growth years on root yield and bioactive components accumulation dynamics of Salvia miltiorrhizae. Chin. Wild Plant Resour. 31, 8–17 (in Chinese). Zhu, C.S., Chen, X., Guo, J., Miao, G.P., Feng, J.T., Zhang, X., 2014. Remove from marked records cloning and expression analysis of 1-deoxy-D-xylulose 5-phosphate reductoisomerase gene (DXR) in Tripterygiun wilfordii. J. Agric. Biotechnol. Sustain. Dev. 22, 298–308.
Peters, R.J., Qi, X., Chen, S., 2016. Analysis of the genome sequence of the medicinal plant Salvia miltiorrhiza. Mol. Plant 9, 949–952. Yang, Y.F., Hou, S., Cui, G.H., Chen, S.L., Wei, J.H., Huang, L.Q., 2010. Characterization of reference genes for quantitative real-time PCR analysis in various tissues of Salvia miltiorrhiza. Mol. Biol. Rep. 37, 507–513. Yang, D.F., Fang, Y.M., Xia, P.G., Zhang, X.D., Liang, Z.S., 2018. Diverse responses of tanshinone biosynthesis to biotic and abiotic elicitors in hairy root cultures of Salvia miltiorrhiza and Salvia castanea Diels f. Tomentosa. Gene 643, 61–67. Yao, H.Y., Gong, Y.F., Zuo, K.J., Ling, H., Qiu, C.X., Zhang, F., Wang, Y.C., Yan, P.Y., Liu, X., Sun, X.F., Tang, K.X., 2008. Molecular cloning, expression profiling and functional analysis of a DXR gene encoding 1-deoxy-d-xylulose 5-phosphate reductoisomerase from Camptotheca acuminata. J. Plant Physiol. 165, 203–213. Zhai, J.J., Zhang, H.R., Zhao, X.H., Gao, Z.M., 2016. Study on Optimal Harvesting Time of Salva miltiorrhizaBge. in Henan. J. Henan Agric. Sci. 45 (3), 112–115. Zhang, H.R., Li, Z.M., Gao, Z.M., 2007. Preliminary study on the characteristics of growth and development in Salvia miltiorrhiza. J. Anhui Agric. Sci. 35, 5783–5785 (in Chinese). Zhang, F., Wang, W.T., Xue, J., Shan, C.G., Wang, Z.F., 2014. Study on optimal harvest
614
Contents lists available at ScienceDirect
Industrial Crops & Products journal homepage: www.elsevier.com/locate/indcrop
Expression patterns of some genes involved in tanshinone biosynthesis in Salvia miltiorrhiza roots Yanfang Yanga,b, Shuang Houa, Wei Fanc, Lilan Lud, Nan Huib, Xia Wue, Jianhe Weia,
T
⁎
a
Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing, 100193, China State Key Laboratory of Tree Genetics and Breeding, Key Laboratory of Tree Breeding and Cultivation of State Forestry Administration, The Research Institute of Forestry, Chinese Academy of Forestry, Beijing, 100091, China c State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of Forestry, Beijing, 100091,China d Hainan Branch, Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences & Peking Union Medical College, Haikou, 570311, China e Capital Medical University School of Traditional Chinese Medicine, Beijing, 100069, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Salvia miltiorrhiza Tanshinone MEP pathway MVA pathway Gene expression
Tanshinones are the major bioactive components of Salvia miltiorrhiza, and synthesized through the cytosollocalized mevalonic acid (MVA) and plastid-localized methylerythritol 4-phosphate (MEP) pathways. To reveal correlations between gene expression and tanshinone accumulation, transcript-level variations in five candidate genes involved in tanshinone biosynthesis in the roots of S. miltiorrhiza were investigated at different developmental stages. Additionally, the accumulation of tanshinone I, tanshinone IIA, and cryptotanshinone were analyzed by liquid chromatography tandem mass spectrometry. Compared with the other genes examined, SmCMK (encoding the enzyme 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase) expression was significantly positively correlated with tanshinone production, and SmDXR (1-deoxy-D-xylulose 5-phosphate reductoisomerase) likely functions as a non-rate-limiting enzyme in the tanshinone-biosynthesis pathways of S. miltiorrhiza during different developmental stages, with significant correlations observed between SmDXR and SmCMK expression. Furthermore, no significant correlations were observed between the expression of SmAACT (encoding the enzyme acetyl-CoA acyltransferase), SmHMGR2 (encoding the enzyme 3-hydroxy-3-methylglutaryl-COA reductase), and SmFPPS (encoding the enzyme farnesyl diphosphate synthase), which are involved in the MVA pathway, and tanshinone production during the developmental stages examined, suggesting that the MVA pathway might contribute less to tanshinone accumulation as compared with the MEP pathway. The results in this study indicated that SmCMK might play an important role in their biosynthesis and accumulation. Overall, this study contributes to a better understanding of tanshinone biosynthesis during the different developmental stages of S. miltiorrhiza.
1. Introduction Salvia miltiorrhiza Bunge, commonly known as Danshen in China, is among the most well-known and widely used traditional Chinese herbal medicines in Asia. In terms of its chemical composition, the major bioactive components extracted from Danshen contain lipophilic constituents and phenolic acid derivatives. Most of the lipophilic constituents are diterpene quinone compounds, including tanshinone I (TS I), TS IIA, and cryptotanshinone (CTS), which are major components in
the roots of S. miltiorrhiza (Zhou et al., 2005). Preclinical studies show that these lipophilic constituents have multiple pharmacological activities, including anti-inflammatory (Chen and Xu, 2014), antioxidative (Cao et al., 2015), antitumor (Li et al., 2008), and cytotoxic (Kadioglu and Efferth, 2015) properties, and are effective in the treatment of cardiovascular disorders and cerebrovascular diseases (Gao et al., 2012; Su et al., 2015). Because of the medicinal properties of these lipophilic constituents, the regulatory mechanisms involved in their biosynthesis and accumulation have attracted considerable
Abbreviations: HMGR, 3-hydroxy-3-methylglutaryl-COA reductase; CMK, 4-diphosphocytidyl-2-C-methyl-D-erythritolkinase; AACT, acetyl-CoA acyltransferase; ANOVA, analysis of variance; CTS, cryptotanshinone; CT, cycle threshold value; DXR, 1-deoxy-D-xylulose 5-phosphate reductoisomerase; DMAPP, dimethylallyl diphosphate; FPPS, farnesyl diphosphate synthase; IPP, isopentenyl diphosphate; LC–MS-MS, liquid chromatography-tandem mass spectrometry; MEP, methylerythritol 4-phosphate; MVA, mevalonic acid; qRT-PCR, real-time quantitative PCR; TS I, tanshinone I; TS IIA, tanshinone IIA ⁎ Corresponding author. E-mail address: [email protected] (J. Wei). https://doi.org/10.1016/j.indcrop.2019.01.001 Received 24 August 2018; Received in revised form 29 December 2018; Accepted 1 January 2019 0926-6690/ © 2019 Published by Elsevier B.V.
Industrial Crops & Products 130 (2019) 606–614
Y. Yang et al.
developmental stages, using real-time quantitative PCR (qRT-PCR) analysis. Additionally, accumulation of TS I, TS IIA, and CTS in roots was analyzed at the same developmental stages by liquid chromatography tandem mass spectrometry (LC–MS/MS). This work provides a theoretical basis for determining optimal harvest times and sheds new light on the biosynthetic steps that promote or limit tanshinone production.
attention. Currently, > 40 lipophilic diterpene compounds, including TS I, TS IIA, and CTS, have been identified and isolated from Danshen (Xu et al., 2015). The precursors of these lipophilic constituents, the universal isoprene precursor isopentenyl diphosphate (IPP) and its isomer, dimethylallyl diphosphate (DMAPP), are synthesized via the cytosol-localized mevalonic acid (MVA) pathway and the plastid-localized methylerythritol 4-phosphate (MEP) pathway. In plants, the MVA pathway produces cytosolic IPP for the synthesis of sterols, brassinosteroids, triterpenes, sesquiterpenes, polyterpenes, dolichol, and the isoprenyl groups used for protein prenylation and cytokinin biosynthesis (SauretGüeto et al., 2006), whereas the MEP pathway produces IPP and DMAPP for biosynthesis of photosynthesis-related isoprenoids such as carotenoids and the side chains of chlorophylls, plastoquinones, and phylloquinones, as well as gibberellin and abscisic acid hormones (Rodríguez-Concepción et al., 2004). Many genes encoding the enzymes that catalyze steps in the MVA and MEP pathways have been cloned and reported. For example, 3-hydroxy-3-methylglutaryl-COA reductase (HMGR), which catalyzes the first committed step in the MVA pathway, has been reported in many plant species, and is considered to regulate the synthesis of MVA and the MVA-derived C5 prenyl diphosphates IPP and DMAPP (Harker et al., 2002; Manzano et al., 2004). The enzyme 1deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) catalyzes plastid isoprenoid biosynthesis, with improved metabolic flux through the MEP pathway by increasing DXR production (Guggisberg et al., 2014). The root cortex of Danshen, which contains various tanshinones, has traditionally been used for the preparation of medicinal products. In this regard, it has been demonstrated that the content of biologically active constituents, such as TS I, TS IIA, and CTS, in the roots of S. miltiorrhiza vary during different growth periods (Buchwald and Mrozikiewicz, 2007; Zhou et al., 2012; Zhang et al., 2014). These results indicate that there is an “M”-like pattern in the accumulation of lipophilic components throughout the growth period in S. miltiorrhiza; however, there might be differences in the peak production times of the different components. To date, many genes involved in tanshinone biosynthesis have been isolated and functionally characterized (Wang et al., 2008; Wu et al., 2009; Liao et al., 2009; Cui et al., 2015); however, given that the production of tanshinones varies by developmental stage, correlations between transcript levels of biosynthesis-related genes and the accumulation of lipophilic compounds remain unclear, particularly with respect to genes that control the bottleneck steps of tanshinone biosynthesis (Zhou et al., 2012; Zhang et al., 2014). Therefore, to elucidate the relationship between gene expression and the accumulation of lipophilic constituents at different developmental stages, the transcript-level variations between candidate genes (SmAACT, SmCMK, SmDXR, SmFPPS, and SmHMGR, which encode the enzymes acetyl-CoA acyltransferase, 4-diphosphocytidyl-2-C-methyl-Derythritol kinase, 1-deoxy-D-xylulose 5-phosphate reductoisomerase, farnesyl diphosphate synthase, and 3-hydroxy-3-methyl glutaryl coenzyme A reductase, respectively) involved in terpenoid-backbone biosynthesis in the roots of S. miltiorrhiza were examined at different
2. Materials and methods 2.1. Plant materials Salvia miltiorrhiza plants were grown under natural conditions at the Institute of Medicinal Plant Development, Chinese Academy of Medicinal Sciences & Peking Union Medical College, (116°16ʹ18′′E, 40°02ʹ2′′N; Beijing, China). In the spring of 2008, the plants were propagated on April 10 by root sectioning of the same clone line. The roots were collected and divided into two parts, with one part used for RNA extraction, and the remaining root part collected, dried, and crushed to determine the contents of TS I, TS IIA, and CTS. The roots were collected from summer (June, July, and August) to autumn (September and October). The sampling date was on 2 June, 12 June, 23 June, 2 July, 1 August, 1 September, and 1 October in 2008, respectively. During sampling period, the plants entered early flowering stage since early June, and reached peak flowering stage in middle and late June. From the middle of July, a small number of seeds matured, and a large number of seeds could be harvested at the end of July. Although there were still a few flowers blooming in September or even October, they could not form or grow into mature seeds. Each assay was performed with three biological replicates. 2.2. RNA isolation and the first strand cDNA synthesis Total RNA was isolated directly from 100 mg of the roots at seven developmental stages. The total RNA was treated with RNase-free DNase I at 37 °C for 15 min to remove genomic DNA according to the manufacturer′s instructions (Takara, Shiga, Japan), and the purity of RNA was assessed by 1.5% agarose gel electrophoresis, with no degradation observed. Nucleic acid concentrations were measured by a Qubit Fluorometer with a Quant-iT RNA Assay Kit (Invitrogen, USA). The reverse transcriptase reaction using a M-MLV reverse transcriptase system (Invitrogen, USA), oligo(dT)18 and random primers was conducted out at 37 °C for 1 h in a total volume of 20 μL according to the manufacturer’s protocol. 2.3. Gene sequences confirmation The specific primers were designed according to the full length of the target genes with Primer 3 (http://frodo.wi.mit.edu/) (Table 1). All primers were HPLC purified. Total RNA was extracted from a mixture of roots, tender leaves, and flowers and translated into the first strand cDNA. This cDNA was used as a template to amplify the five target
Table 1 Primers used for qRT-PCR analysis of SmAACT, SmCMK, SmDXR, SmFPPS, SmHMGR2 and Ubiquitin. Gene Name
Primer sequences (5'→ 3')
Primer sequences (3'→ 5')
SmAACT SmCMK SmDXR SmFPPS SmHMGR2 Ubiquitin
ATGCTGAAGGACGGACTCTGGGATG ATGAGAAAAGAAGAAGGGGATATCA GAGAATCTACTGCTCCGAGA TTTTACCTCCCAGTTGCTTGTG GCAACATCGTCTCCGCCGTCTACA GTTGATTTTTGCTGGGAAGC
TTGTCAACAATGGTGGATGG TCAGGAAAAAGACAGGGGTTG CTGGTCGTAGTGGATGATCT TTTACAACCAGCCAAGAACATT GATGGTGGCCAGCAGCCTGGAGTT GATCTTGGCCTTCACGTTGT
Note: AACT, acetyl-CoA acyltransferase; CMK, 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase; DXR, deoxyxylulose-5-phosphate reductoisomerase; FPPS, farnesyl diphosphate synthase; HMGR, 3-hydroxy-3-methyl glutaryl coenzyme A reductase. Ubiquitin was used as reference gene. 607
Industrial Crops & Products 130 (2019) 606–614
Y. Yang et al.
Fig. 1. PCR amplification of SmAACT, SmCMK, SmDXR, SmFPPS, and SmHMGR2 using specific primers developed for the qRT-PCR analysis in Salvia miltiorrhiza. Note: AACT, acetyl-CoA acyltransferase; CMK, 4-diphosphocytidyl-2-Cmethyl-D-erythritol kinase; DXR, deoxyxylulose-5-phosphate reductoisomerase; FPPS, farnesyl diphosphate synthase; and HMGR, 3hydroxy-3-methyl glutaryl coenzyme A reductase.
of Danshen was weighed into a 10-mL amber volumetric flask, mixed with methanol, and sonicated for 30 min. The mixture was filtered through a 0.45-μm PTFE filter (Shimadzu, Tokyo, Japan) to obtain the test solution. The HPLC analysis was carried out on a C18 column (Eclipse Plus C18 2.1 × 150 mm, 5 μm; Agilent Technologies, Santa Clara, CA, USA) consisting of isocratic elution with 70% acetonitrile and 30% formic acid aqueous solution (1.6%). The flow rate was 0.20 mL/min, and the injection volume was 10 μL. Agilent XCT ion trap mass spectrometers (Agilent, USA), equipped with an ion-spray (pneumatically assisted electrospray) interface, were employed.
genes using specific primers. The PCR samples were prepared as follows: 0.5 μL RT product was amplified in a 25 μL volume containing 2.5 μL of 10 × PCR buffer with MgCl2, 0.5 μL of 10 mM dNTPs (Takara, Japan), 0.5 μL of Taq DNA polymerase (Takara, Japan), and 0.5 μL of 10 mM each specific primer. Amplifications were performed with the following setting: 94 °C for 2 min, followed by 40 cycles at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s and a final extension 72 °C for 10 min. The PCR products for the five genes were verified by electrophoresis on a 1.5% agarose gel and purified using a QIAquick PCR Purification Kit (Qiagen, Germany) according to the manufacturer’s instructions. The purified products were cloned into the pGEM-T vector (Promega, Madison, WI, USA) and sequenced by an ABI3730 sequencer (Invitrogen, Shanghai, China). The sequences of the amplified products were confirmed using BLAST (NCBI; http://www.ncbi.nlm.nih.gov/).
2.6. Statistical analyses For the qRT-PCR experiment, data were analyzed using the 2−ΔΔCT method (Livak and Schmittgen, 2001), and ANOVA and Pearson’s simple correlation were carried out in SAS (version 9.2; SAS Institute, Cary, NC, USA).
2.4. Quantitative real time PCR assay and amplification efficiency of test genes qRT-PCR was performed as previously described, using Ubiquitin as the housekeeping genes (Yang et al., 2010). The qRT-PCR reactions were performed in triplicate in a 25 μL volume containing 1 μL cDNA, 0.3 μM of each primer, and 12.5 μL 2 × SYBR green PCR master mix (Takara, Japan). A negative control with cDNA template replaced by water was included in the same qRT-PCR run for each primer pair. The qRT-PCR assays were performed using three technical and two biological replicates with similar results. Using the cDNA derived from the sample that include root, tender leaf and flower RNA as a template, the primer efficiency of the genes of interest and the reference genes were calculated based on a standard curve generated using a fourfold dilution series over at least four dilution points measured in triplicate.
3. Results 3.1. Sequence confirmation Primers were designed based on five full-length cDNA sequences [SmAACT (EF635969), SmHMGR2 (FJ747636), SmCMK (EF534309), SmDXR (DQ991431), and SmFPPS (EF635968)] and demonstrated as being specific for each gene in subsequent qRT-PCR experiments. Each PCR reaction produced the single predicted band without any artifact bands, such as those associated with primer dimmers, in the electrophoretic diagram (Fig. 1). Sequencing results confirmed that the expected sequences were unique, and the qRT-PCR experiments showed that the primers were specific, yielding a unique absorption peak for each of the examined genes (Fig. 2). Therefore, the results indicated high specificity of the six designed primer pairs and thus their suitability for use in subsequent qRT-PCR assays.
2.5. LC–MS-MS investigation of lipophilic components in the roots of S. miltiorrhiza The LC–MS-MS method was used to investigate the contents of TS I, TS IIA, and CTS at seven time points during the development process of S. miltiorrhiza. The standards of TS I, TS IIA, and CTS were purchased from the National Institute for the Control of Pharmaceutical and Biological Products (Beijing, China) (purity 98%). Methanol with HPLC grade was obtained from Dikma (Beijing, China), and water for HPLC analysis was purified with a Milli-Q water system (Millipore Corp, Bedford, MA, USA). Approximately 10 mg of the powdered crude drug
3.2. Amplification efficiencies of target and reference genes The 2−ΔΔCT (Livak) method is commonly used for the analysis of relative gene expression based on qRT-PCR; however, this method requires that the amplification efficiency of both target and reference genes should be close to 100%. Therefore, amplification efficiencies of the five target genes and Ubiquitin, the reference gene, were confirmed by amplifying the cDNA derived from a sample composing root, tender 608
Industrial Crops & Products 130 (2019) 606–614
Y. Yang et al.
Fig. 2. Melting curves associated with qRT-PCR analysis of SmAACT, SmCMK, SmDXR, SmFPPS, and SmHMGR2 expression in Salvia miltiorrhiza. (A) SmAACT; (B) SmCMK; (C) SmDXR; (D) SmFPPS; and (E) SmHMGR2. (F) Ubiquitin was the reference gene. Note: AACT, acetyl-CoA acyltransferase; CMK, 4-diphosphocytidyl-2-Cmethyl-D-erythritol kinase; DXR, deoxyxylulose-5-phosphate reductoisomerase; FPPS, farnesyl diphosphate synthase; and HMGR, 3-hydroxy-3-methyl glutaryl coenzyme A reductase.
Fig. 3. The standard curves associated with qRT-PCR analysis of SmAACT, SmCMK, SmDXR, SmFPPS, SmHMGR2, and Ubiquitin (reference gene). (A) SmAACT; (B) SmCMK; (C) SmDXR; (D) SmFPPS; (E) SmHMGR2; (F) Ubiquitin. Note: AACT, acetyl-CoA acyltransferase; CMK, 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase; DXR, deoxyxylulose-5-phosphate reductoisomerase; FPPS, farnesyl diphosphate synthase; and HMGR, 3-hydroxy-3-methyl glutaryl coenzyme A reductase.
leaf, and flower RNAs. All six qRT-PCR assays detected the expected sequences, and with the qRT-PCR efficiencies of all assays between 95% and 102% (Fig.3; Table 2). These results showed that the expression data for the target and reference genes were consistent and that the 2ΔΔCT method could be employed for qRT-PCR analysis.
at seven developmental stages from June to October 2008 (Fig. 4). The similar expression patterns for SmAACT and SmHMGR2 that encode MVA-pathway enzymes were observed (Fig. 4A and C), whereas these differed from the expression of genes involved in the MEP pathway (Fig. 4). The highest expression of SmAACT and SmHMGR2 was detected on 23 June, and remained at relatively lower levels thereafter until the end of the experimental period. Although there was no significant difference in SmAACT expression between 12 June and 23 June, SmHMGR2 expression on 23 June was clearly higher than that on 12 June. Notably, expression of the MEP-pathway genes SmDXR and SmCMK gradually increased until 12 June, followed by subsequent
3.3. The expression patterns of the five target genes in different developmental stages The expression patterns of the five genes encoding enzymes catalyzing key steps in the tanshinone-synthesis pathways were investigated 609
Industrial Crops & Products 130 (2019) 606–614
Y. Yang et al.
peaks in expression on 1 Sept and 2 July, respectively (Fig. 4B and D). Transcripts of the other MVA-pathway gene, SmFPPS, showed a different expression pattern, which gradually increased until 23 June, followed by a gradual decrease until the end of the experimental period without any further peaks.
Table 2 PCR efficiency for the examined and reference genes. Gene name
PCR efficiency (%)
r^2
Slope
SmAACT SmCMK SmDXR SmFPPS SmHMGR2 Ubiquitin
101.350 98.476 99.747 96.529 98.072 96.803
0.999 0.974 0.968 0.969 0.988 0.991
−3.290 −3.359 −3.328 −3.408 −3.369 −3.401
3.4. Determination of tanshinone content in the roots of S. miltiorrhiza by LC–MS/MS The content of the major lipophilic components of S. miltiorrhiza (TS I, TS IIA, and CTS) was investigated at different developmental stages. The results showed that all three components increased initially and accumulated to high levels at the blooming stage and peaked on 12 June, followed by a decline until the terminal flowering stage (Fig. 5).
Note: AACT, acetyl-CoA acyltransferase; CMK, 4-diphosphocytidyl-2-C-methylD-erythritol kinase; DXR, deoxyxylulose-5-phosphate reductoisomerase; FPPS, farnesyl diphosphate synthase; HMGR, 3-hydroxy-3-methyl glutaryl coenzyme A reductase. Ubiquitin was used as reference gene.
Fig. 4. The expression levels target genes at different developmental stages of Salvia miltiorrhiza. (A) SmAACT, (B) SmDXR, (C) SmHMGR2, (D) SmCMK, and (E) SmFPPS. Note: AACT, acetyl-CoA acyltransferase; DXR, deoxyxylulose-5-phosphate reductoisomerase; HMGR, 3-hydroxy-3-methyl glutaryl coenzyme A reductase; CMK, 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase; and FPPS, farnesyl diphosphate synthase. 610
Industrial Crops & Products 130 (2019) 606–614
Y. Yang et al.
Fig. 5. The contents of TS I, TS IIA, and CTS at seven different developmental stages of Salvia miltiorrhiza. The letters above the triangles, squares and circles indicate significant differences according to Tukey’s post-hoc test (p < 0.05). The lower, middle and higher letters indicate the different contents of TS I, TS IIA, and CTS, respectively. Note: TS I, tanshinone I; TS IIA, tanshinone IIA; CTS, cryptotanshinone.
expression of SmHMGR2 and SmFPPS, which are involved in the MVA pathway, and the contents of TS I, TS IIA, and CTS, with this correlation also not significant (p > 0.05). Interestingly, the expression of SmHMGR2 was strongly correlated with that of SmFPPS (r = 0.945; p < 0.01), and the significant positive correlations between the content of TS I, TS IIA, and CTS each other were detected (Table 3).
Specifically, the content of TS I and TS IIA clearly increased from 2 June to 12 June, followed by slight decrease until 1 October. However, the content of CTS differed from TS I and TS IIA, it clearly indicated an “M”like pattern of the accumulation, showing a similar pattern as that of TS I and TS IIA from 2 June to 2 July, but there was a second peak on 1 August as compared with 1 October. Moreover, the content of TS I was lower than that of either TS IIA or CTS at the seven developmental stages, and although the contents of TS IIA and CTS were similar on 2 June, CTS content was higher than that of TS IIA on 12 June and 1 August when the lipophilic components accumulated rapidly.
4. Discussion The mechanisms underlying the biosynthesis of plant secondary metabolites constitute highly complex, tightly regulated processes, with many studies having shown that seasonal climate is among the important factors influencing the production and accumulation of these metabolites (Nasiri et al., 2016). For example, in S. miltiorrhiza, Deng et al., (2009) previously observed an initial peak in the accumulation of lipophilic components during the period from May to July, followed by a second peak during the period from October to November. Consequently, a comprehensive understanding of the interactions among molecular mechanisms involved in tanshinone biosynthesis and the inevitable effects of seasonal climate could potentially contribute to approaches designed to enhance the yield of these lipophilic constituents. In this context, the molecular pathway associated with tanshinone biosynthesis in S. miltiorrhiza has been well characterized, and the S. miltiorrhiza genome has been sequenced, allowing discovery of ˜20 different enzymatic steps involved in tanshinone biosynthesis (Xu et al., 2016). However, the simultaneous regulatory roles of developmental- stage cues toward gene expression and tanshinone
3.5. Correlations between tanshinone content and gene-expression data at different developmental stages To determine whether the five target genes might influence tanshinone production at different stages, the correlation analysis to determine the potential relationships between tanshinone content and relative gene-expression data were performed. As shown in Table 3, we detected a relatively high significant positive correlation between the expression of SmCMK and TS I (r = 0.779; p < 0.05), TS IIA (r = 0.799; p < 0.05), and CTS (r = 0.796; p < 0.05) contents, suggesting that it was well correlated with the tanshinone accumulation. Although a strong correlation was detected between the expression of SmCMK and SmDXR (r = 0.855; p < 0.05), there was only a moderate relationship between SmDXR expression and the production of the three tanshinones, with no significance in this correlation (p > 0.05). Moreover, there was low correlation between the
Table 3 Pearson correlation coefficient analysis of relationships between target gene expression and tanshinone contents at different developmental stages. Significant correlations (p < 0.05 and p < 0.01, respectively) according to two-tailed analysis.
SmAACT SmHMGR2 SmDXR SmCMK SmFPPS TS I TS IIA CTS
SmAACT
SmHMGR2
SmDXR
SmCMK
SmFPPS
TS I
TS IIA
CTS
1
0.600 1
−0.078 −0.348 1
−0.338 −0.175 0.855* 1
0.415 0.945** −0.419 −0.179 1
0.064 0.468 0.509 0.779* 0.423 1
0.100 0.407 0.568 0.799* 0.330 0.988* 1
0.067 0.358 0.583 0.796* 0.269 0.956* 0.981* 1
Note: AACT, acetyl-CoA acyltransferase; CMK, 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase; DXR, deoxyxylulose-5-phosphate reductoisomerase; FPPS, farnesyl diphosphate synthase; HMGR, 3-hydroxy-3-methyl glutaryl coenzyme A reductase; TS I, tanshinone I; TS IIA, tanshinone IIA; CTS, cryptotanshinone. 611
Industrial Crops & Products 130 (2019) 606–614
Y. Yang et al.
identified as a rate-limiting step in isoprenoid biosynthesis via the MVA pathway (Dai et al., 2011). Kai et al. (2011) reported that overexpression of SmHMGR in S. miltiorrhiza can significantly enhances the production of tanshinones (a 2.1- to 5.7-fold increase as compared with the control). Previously, SmHMGR2 was reported as a novel and important enzyme involved in tanshinone biosynthesis, gene overexpression of which also enhances the production of tanshinones and squalene in cultured hairy roots of S. miltiorrhiza (Dai et al., 2011). As mentioned previously, most isoprenoids in plants are derived from the plastid-localized MEP pathway (Wright et al., 2014). In the present study, the results clearly indicated no significant correlation between the SmHMGR2 expression and the contents of TS I, TS IIA, and CTS. Moreover, a strong correlation between the expression of SmHMGR2 and SmFPPS were detected, which was also not correlated with the contents of TS I, TS IIA, and CTS (Table 3). Similarly, SmAACT, a gene involved in the MVA pathway and examined in the present study, showed no correlation with the contents of TS I, TS IIA, and CTS (Table 3). Therefore, it was speculated that the MVA pathway might play a less prominent role in tanshinone accumulation, and in this regard, further studies should be conducted in order to elucidate correlations among other genes within the MVA and MEP pathways and the biosynthesis and accumulation of tanshinones during different developmental stages. Because it was reported that methyl jasmonate elicit the production of CTS in S. miltiorrhiza cell-suspension cultures (Chen and Chen, 1999), many investigations have been conducted to assess the potential consequences associated with exogenous and endogenous factors, such as environmental perturbations (Dowom et al., 2017; Chen et al., 2018; Yang et al., 2018), different plant tissues (Xu et al., 2010), nutrition stress (He et al., 2013), geo-authentic habitats (Pan et al., 2011), and various differences in genetics and genotypes (Song et al., 2016). Furthermore, efforts have been made to explore possible connections between the transcript levels of the genes involved in tanshinone-biosynthesis pathways and tanshinone accumulation (Li et al., 2018). The results of the present study revealed variations in tanshinones accumulation with the transcription level of specific genes in roots during the developmental stages, suggesting that sampling date or environmental signals play pivotal roles in tanshinone production and/or gene regulation in S. miltiorrhiza.
accumulation remain unclear; therefore, further research should be delved deeper in order to understand tanshinone production and accumulation in S. miltiorrhiza In the present study, maximum accumulations of TS I, TS IIA, and CTS were observed on 12 June, which is consistent with the findings of previous studies (Zhang et al., 2007; Deng et al., 2009; Liu et al., 2012); however, other studies recorded maximal accumulations of TS IIA and CTS in September and November, respectively (Zhao et al., 2015; Zhai et al., 2016). A number of different factors, including cropping pattern, genetic and epigenetics factors, production habitat, and growing time, can be considered to have effects on lipophilic component biosynthesis and accumulation, and consequently the occurrence of different peaks (Zhang et al., 2015). In this regard, a significant positive correlation between SmCMK activity and TS I, TS IIA, and CTS production in the roots of S. miltiorrhiza were observed. CMK, the only kinase known to participate in the MEP pathway, is induced by methyl jasmonate, which in turn contributes to enhancing the tanshinone accumulation (Wang et al., 2008). In the present study, the strong positive correlation detected between SmCMK expression and the tanshinone content indicated that tanshinone biosynthesis is strongly dependent upon CMK activity. Almost all lipophilic components are found to accumulate in roots of S. miltiorrhiza, and particularly in the epidermis of the cortex. To elucidate the related gene expression in the roots of S. miltiorrhiza, the expression patterns of genes of interest in the cortex and xylem were analyzed, and the results accordingly showed that SmCMK was clearly more highly expressed in the cortex than in the xylem (data not shown). Therefore, these results indicate that SmCMK might play important roles in tanshinone biosynthesis and accumulation, and further study about this gene should be attracted attention in order to gain a better understanding of the metabolic control of the MEP pathway at gene and protein levels. The MEP pathway comprises seven enzymatic steps, the second step of which involves the conversion of 1-deoxy-D-xylulose-5-phosphate to MEP catalyzed by DXR (Banerjee and Sharkey, 2014). In previous studies of the key enzymes controlling metabolic flux in the MEP pathway, DXR and 1-deoxy-d-xylulose-5-phosphate synthase (DXS) were isolated in many plant species, with these two genes implicated in plastid isoprenoid biosynthesis (Han et al., 2003; Gong et al., 2006; MuñozBertomeu et al., 2006; Yao et al., 2008; Yan et al., 2009; Zhu et al., 2014). In different plant species, positive correlations have been identified between enhanced isoprenoid biosynthesis and accumulation of the transcripts encoded by DXR and DXS (Mayrhofer et al., 2005; Bede et al., 2006; Muñoz-Bertomeu et al., 2006). Moreover, overexpression of DXR in Arabidopsis and tobacco revealed that elevated DXR levels lead to enhanced accumulation of plastid isoprenoids (Carretero-Paulet et al., 2006; Hasunuma et al., 2008). Other studies reported that the regulatory role of DXR in plants appears species-specific. The DXR enzyme does not play a crucial role in or shows a lack of direct correlation with carotenoid accumulation in tomato (Rodríguez-Concepción et al., 2001), or the accumulation of volatile perpenoids in Antirrhinum majus (Dudareva et al., 2005), or the synthesis of plastidial monoterpene precursors (Mendoza-Poudereux et al., 2014). However, in the present study, no significant correlation between SmDXR expression and the contents of TS I, TS IIA and CTS were found. Nevertheless, it was demonstrated that SmDXR expression was correlated with that of SmCMK (Table 3). These results indicated that although SmDXR plays an important role in tanshinone biosynthesis, unlike SmCMK, it likely functions as a non-rate-limiting enzyme in the tanshinone-biosynthesis pathways of S. miltiorrhiza during different developmental stages. Taken together, previous results and the results of the present study indicate that multiple genes are involved in regulating diterpenoid metabolic flux. The occurrence of cross-talk between the MVA and MEP pathways in plants was previously demonstrated using isotope tracer methods (Skorupinska-Tudek et al., 2008; Mendoza-Poudereux et al., 2015). The conversion of HMG-CoA to mevalonate catalyzed by HMGR was
5. Conclusion In summary, the results in the present study showed that content of the tanshinones TS I, TS IIA, and CTS and the expression patterns of associated genes clearly varied according to the developmental stage in S. miltiorrhiza. In addition to providing important insights into gene expression patterns associated with tanshinone-biosynthesis pathways in S. miltiorrhiza, these observations in the present study make an important contribution to determining harvest times for optimal tanshinone yields. It was demonstrated that the expression pattern of SmCMK was more significantly correlated with tanshinone production than that of other examined genes, particularly those associated with the MVA pathway. Furthermore, the findings of this study enhance the current understanding of the important rate-limiting steps in tanshinone biosynthesis, and provide a foundation for further analyses of the complex mechanistic interactions that underpin tanshinone-biosynthetsis pathways. Conflicts of interest The authors declare no conflicts of interest. Acknowledgments This work was supported by the Special Funds in Basic Scientific Research for Non-Profit Research Institutes financed by the Ministry of 612
Industrial Crops & Products 130 (2019) 606–614
Y. Yang et al.
Finance, People′s Republic of China (No. YZ-08-19), National Natural Science Foundation of China (31570675), and a grant for National nonprofit Research Institutions of Chinese Academy of Forestry (CAFYBB2018SY009). The authors thank Dr. Lingyong Li (Baylor College of Medicine), and Guanghong Cui and Luqi Huang (Institute of Chinese Materia Medica, Academy of Chinese Medical Sciences) for their helpful suggestions. We also thank Professor Zhongwen Huang (Henan Institute of Science and Technology, Henan Collaborative Innovation Center of Modern Biological Breeding) for assistance with ANOVA and Pearson’s simple correlation analyses using SAS 9.2 software.
Metabolic engineering tanshinone biosynthetic pathway in Salvia miltiorrhiza hairy root cultures. Metab. Eng. 13, 319–327. Li, Q.F., Shi, S.L., Liu, Q.R., Tang, J., Song, J., Liang, Y., 2008. Anticancer effects of ginsenoside Rg1, cinnamic acid, and tanshinone IIA in osteosarcoma MG-63 cells: nuclear matrix downregulation and cytoplasmic trafficking of nucleophosmin. Int. J. Biochem. Cell Biol. 40, 1918–1929. Li, S., Lin, A.Z., Yang, Y., Shen, Y.F., Rao, Y., Yang, J., Liu, Y.H., Zhou, W., 2018. Research progress on molecular regulation mechanism involved in the biosynthetic pathway of tanshinone in Salvia miltiorrhiza. J. Zhejiang A&F Univ. 35 (2), 367–375. Liao, P., Zhou, W., Zhang, L., Wang, J., Yan, X.M., Zhang, Y., Zhang, R., Li, L., Zhou, G.Y., Kai, G.Y., 2009. Molecular cloning, characterization and expression analysis of a new gene encoding 3-hydroxy-3-methylglutaryl coenzyme A reductase from Salvia miltiorrhiza. Acta Physiol. Plant. 31, 565–572. Liu, L.D., Xie, X.L., Wen, C.X., Tian, W., Liu, M., Zhou, Q.M., 2012. Study on accumulation of effective components of Salvia miltiorrhiza. J. Hebei Agric. Sci. 16, 32–34 (In Chinese). Livak, K., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25 (4), 402–408. Manzano, D., Fernández-Busquets, X., Schaller, H., González, V., Boronat, A., Arró, M., Ferrer, A., 2004. The metabolic imbalance underlying lesion formation in Arabidopsis thaliana overexpressing farnesyl diphospate synthase (isoform 1S) leads to oxidative stress and is trigged by the developmental decline of endogenous HMGR activity. Planta 219, 982–992. Mayrhofer, S., Teuber, M., Zimmer, I., Louis, S., Fischbach, R.J., Schnitzier, J.P., 2005. Diurnal and seasonal variation of isoprene biosynthesis-related genes in grey poplar leaves. Plant Physiol. 139, 474–484. Mendoza-Poudereux, I., Muñoz-Bertomeu, J., Arrillaga, I., Segura, J., 2014. Deoxyxylulose 5-phosphate reductoisomerase is not a rate-determining enzyme for essential oil production in spike lavender. J. Plant Physiol. 171 (17), 1564–1570. Mendoza-Poudereux, I., Kutzner, E., Huber, C., Segura, J., Eisenreich, W., Arrillaga, I., 2015. Metabolic cross-talk between pathways of terpenoid backbone biosynthesis in spike lavender. Plant Physiol. Biochem. 95, 113–120. Muñoz-Bertomeu, J., Arrillaga, I., Ros, R., Segura, J., 2006. Up-regulation of 1-deoxy-Dxylulose-5-phosphate synthase enhances production of essential oils in transgenic spike lavender. Plant Physiol. 142, 890–900. Nasiri, J., Naghavi, M.R., Alizadeh, H., Moghadam, M.R.F., 2016. Seasonal-based temporal changes fluctuate expression patterns of txs, dbat, bapt, and dbtnbt, genes alongside production of associated taxanes in taxus baccata. Plant Cell Rep. 35 (5), 1103–1119. Pan, X.M., Wei, H., Liu, Y., Liu, S.X., Zhang, T.J., Ma, X.W., Han, F.N., 2011. Study on quality of Salvia miltiorrhiza from different habitats. Chin. Trad. Herbal Drugs 42 (9), 1833–1836. Rodríguez-Concepción, M., Ahumada, I., Diez-Juez, E., Sauret-Güeto, S., Lois, L.M., Gallego, F., Carretero-Paulet, L., Campos, N., Boronat, A., 2001. 1-Deoxy-d-xylulose 5-phosphate reductoisomerase and plastid isoprenoidbiosynthesis during tomato fruit ripening. Plant J. 27, 213–222. Rodríguez-Concepción, M., Forés, O., Martínez-García, J.F., González, V., Phillips, M.A., Ferrer, A., Boronat, A., 2004. Distinct light-mediated pathways regulate the biosynthesis and exchange of isoprenoid precursors during Arabidopsis seedling development. Plant Cell 16, 144–156. Sauret-Güeto, S., Botella-Pavía, P., Flores-Pérez, Ú., Martínez-García, J.F., Román, C.S., León, P., Boronat, A., Rodríguez-Concepción, M., 2006. Plastid cues posttranscriptionally regulate the accumulation of key enzymes of the methylerythritol phosphate pathway in Arabidopsis. Plant Physiol. 141, 75–84. Skorupinska-Tudek, K., Poznanski, J., Wojcik, J., Bienkowski, T., Szostkiewicz, I., Zelman-Femiak, M., Bajda, A., Chojnacki, T., Olszowska, O., Grunler, J., Meyer, O., Rohmer, M., Danikiewicz, W., Swiezewska, E., 2008. Contribution of the mevalonate and methylerythritol phosphate pathways to the biosynthesis of dolichols in plants. J. Biol. Chem. 283, 21024–21035. Song, Z.Q., Wang, J.H., Li, X.F., 2016. Expression profiles of genes involved in tanshinone biosynthesis of two Salvia miltiorrhiza genotypes with different tanshinone contents. J. Genet. 95 (2), 433–439. Su, C.Y., Ming, Q.L., Rahman, K., Han, T., Qin, L.P., 2015. Salvia miltiorrhiza: traditional medicinal uses, chemistry, and pharmacology. Chin. J. Nat. Med. 13 (3), 163. Wang, X.Y., Cui, G.H., Huang, L.Q., Gao, W., Yuan, Y., 2008. A full length cDNA of 4(cytidine 5’-diphospho)-2-C-methyl-D-erythritol kinase cloning and analysis of introduced gene expression in Salvia miltiorrhiza. Yao Xue Xue Bao 43, 1251–1257 (in Chinese). Wright, L.P., Rohwer, J.M., Ghirardo, A., Hammerbacher, A., Ortiz-Alcaide, M., Raguschke, B., Schnitzler, J.P., Gershenzon, J., Phillips, M.A., 2014. Deoxyxylulose 5Phosphate synthase controls flux through the methylerythritol 4-Phosphate pathway in Arabidopsis. Plant Physiol. 165, 1488–1504. Wu, S.J., Shi, M., Wu, J.Y., 2009. Cloning and characterization of the 1-deoxy-D-xylulose 5-phosphate reductoisomerase gene for diterpenoid tanshinone biosynthesis in Salvia miltiorrhiza (Chinese sage) hairy roots. Biotechnol. Appl. Biochem. 52, 89–95. Xu, C.H., Shu, Z.M., Wang, Y., Miao, F., Zhou, L., 2010. The accumulation rule of the main medicinal components in different organs of Salvia miltiorrhiza Bunge. And Salvia miltiorrhiza Bunge.f. Alba. Lishizhen Med. Materia Med. Res. 21 (9), 2129–2132. Xu, Z.C., Peters, R.J., Weirather, J., Luo, H.M., Liao, B.S., Zhang, X., Zhu, Y.J., Ji, A.J., Zhang, B., Hu, S.N., Au, K.F., Song, J.Y., Chen, S.L., 2015. Full‐length transcriptome sequences and splice variants obtained by a combination of sequencing platforms applied to different root tissues of salvia miltiorrhiza and tanshinone biosynthesis. Plant J. 82 (6), 951–961. Xu, H., Song, J., Luo, H., Zhang, Y., Li, Q., Zhu, Y., Xu, J., Li, Y., Song, C., Wang, B., Sun, W., Shen, G., Zhang, X., Qian, J., Ji, A., Xu, Z., Luo, X., He, L., Li, C., Sun, C., Yan, H., Cui, G., Li, X., Li, X., Wei, J., Liu, J., Wang, Y., Hayward, A., Nelson, D., Ning, Z.,
References Banerjee, A., Sharkey, T.D., 2014. Methylerythritol 4-phosphate (MEP) pathway metabolic regulation. Nat. Prod. Rep. 31, 1043. Bede, J.C., Musser, R.O., Felton, G.W., Korth, K.L., 2006. Caterpillar herbivory and salivary enzymes decrease transcript levels of Medicago truncatula genes encoding early enzymes in terpenoid biosynthesis. Plant Mol. Biol. 60, 519–531. Buchwald, W., Mrozikiewicz, P.M., 2007. Influence of development stage on the content of biologicaly active compounds of Salvia miltiorrhiza Bunge roots. Herba Pol. 53, 15–19. Cao, H., Zhang, L., Sun, Z.B., Cheng, X.H., Zhang, Y., Zou, H.B., 2015. Salvia miltiorrhiza prevents deep vein thrombosis via antioxidative effects in endothelial cells. Mol. Med. Rep. 11, 3593–3600. Carretero-Paulet, L., Cairó, A., Botella-Pavía, P., Besumbes, O., Campos, N., Boronat, A., Rodríguez-Concepción, M., 2006. Enhanced flux through the methylerythritol 4phosphate pathway in Arabidopsis plants overexpressing deoxyxylulose 5-phosphate reductoisomerase. Plant Mol. Biol. 62, 683–695. Chen, H., Chen, F., 1999. Effects of methyl jasmonate and salicylic acid on cell growth and cryptotanshinone formation in Ti transformed Salvia miltiorrhiza cell suspension cultures. Biotechnol. Lett. 21 (9), 803–807. Chen, Z., Xu, H., 2014. Anti-Inflammatory and immunomodulatory mechanism of tanshinone IIA for atherosclerosis. Evid. Based Complement. Alternat. Med. 2014, 267976. Chen, I.J., Lee, M.S., Lin, M.K., Ko, C.Y., Chang, W.T., 2018. Blue light decreases tanshinone IIA content in Salvia miltiorrhiza hairy roots via genes regulation. J. Photochem. Photobiol. B, Biol. 183, 164–171. Cui, G.H., Duan, L.X., Jin, B.L., Qian, J., Xue, Z.Y., Shen, G.A., Snyder, J.H., Song, J.Y., Chen, S.L., Huang, L.Q., Peters, R.J., Qi, X.Q., 2015. Functional divergence of diterpene syntheses in the medicinal plant Salvia miltiorrhiza Bunge. Plant Physiol. 169, 1607–1618. Dai, Z.B., Cui, G.H., Zhou, S.F., Zhang, X.A., Huang, L.Q., 2011. Cloning and characterization of a novel 3-hydroxy-3-methylglutaryl coenzyme A reductase gene from Salvia miltiorrhiza involved in diterpenoid tanshinone accumulation. J. J. Plant Physiol. 168 (2), 148–157. Deng, Q.H., Pan, Y.C., Peng, Y., Cao, J.B., Gao, Z.M., 2009. Study on the optimal collection time of Salvia miltiorrhiza. Res. Pract. Chin. Med. 23, 3–5 (In Chinese). Dowom, S.A., Abrishamchi, P., Radjabian, T., Salami, S.A., 2017. Enhanced phenolic acids production in regenerated shoot cultures of Salvia virgata Jacq. After elicitation with Ag+ ions, methyl jasmonate and yeast extract. Ind. Crops Prod. 103, 81–88. Dudareva, N., Andersson, S., Orlova, I., Gatto, N., Reichelt, M., Rhodes, D., Wilhelm, B., Jonathan, G., 2005. The non-mevalonate pathway supports both monoterpene and sesquiterpene formationin snapdragon flowers. Proc. Natl. Acad. Sci. U. S. A. 102, 933–938. Gao, S., Liu, Z.P., Li, H., Little, P.J., Liu, P.Q., Xu, S.W., 2012. Cardiovascular actions and therapeutic potential of tanshinone iia. Atherosclerosis 220 (1), 3. Gong, Y.F., Liao, Z.H., Guo, B.H., Sun, X.F., Tang, K.X., 2006. Molecular cloning and expression profile analysis of Gingo biloba DXS gene encoding 1-Deoxy-D-xylulose 5phosphate synthase, the first committed enzyme of the 2-C-Methyl-D-erythritol 4phosphate pathway. Planta Med. 72, 329–335. Guggisberg, A.M., Park, J., Edwards, R.L., Kelly, M.L., Hodge, D.M., Tolia, N.H., Odom, A.R., 2014. A sugar phosphatase regulates the methylerythritol phosphate (MEP) pathway in malaria parasites. Nat. Commun. 5 (4) 4467. Han, Y.S., Roytrakul, S., Verberne, M.C., Heijden, R.V.D., Linthorstc, H.J.M., Verpoortea, R., 2003. Cloning of a cDNA encoding 1-deoxy-d-xylulose 5-phosphate synthase from Morinda citrifolia and analysis of its expression in relation to anthraquinone accumulation. Plant Sci. 164, 911–917. Harker, M., Hellyer, A., Clayton, J.C., Duvoix, A., Lanot, A., Safford, R., 2002. Co-ordinate regulation of sterol biosynthesis enzyme activity during accumulation of sterol biosynthesis enzyme activity during accumulation of sterols in developing rape and tobacco seed. Planta 216, 707–715. Hasunuma, T., Takeno, S., Hayashi, S., Sendai, M., Bamba, T., Yoshimura, S., Tomizawa, K., Fukusaki, E., Miyake, C., 2008. Overexpression of 1-Deoxy-D-xylulose-5-phosphate reductoisomerase gene in chloroplast contributes to increment of isoprenoid production. J. Biosci. Bioeng. 105, 518–526. He, C.E., Lu, L.L., Jin, Y., 2013. Effects of nitrogen on root development and contents of bioactive compounds in Salvia miltiorrhiza bunge. Crop Sci. 53 (5), 2028–2039. Kadioglu, O., Efferth, T., 2015. Pharmacogenomic characterization of cytotoxic compounds from Salvia officinalis in cancer cells. J. Nat. Prod. 78, 762–775. Kai, G.Y., Xu, H., Zhou, C.C., Liao, P., Xiao, J.B., Luo, X.Q., You, L.J., Zhang, L., 2011.
613
Industrial Crops & Products 130 (2019) 606–614
Y. Yang et al.
time of Salvia miltiorrhiza Bunge f. Alba. Shandong Agric. Sci. 46, 82–84 (in Chinese). Zhang, C.L., Liang, Z.S., Guo, H.B., Liu, J.L., Liu, Y., Liu, F.H., Wei, L.Z., 2015. Correlation analysis between meteorological factors, biomass, and active components of Salvia miltiorrhiza in different climatic zones. China J. Chin. Matera Med. 40 (4), 607–613. Zhao, Z.G., Gao, S.R., Xie, J., Yan, B.B., Hou, J.L., Wang, W.Q., Song, Y., Zhang, X.M., Li, J., 2015. Dynamic study on biomass and bioactive ingredients accumulation of roots of Salvia miltiorrhizae in different growth periods. Modern Chin. Med. 11, 1171–1176 (in Chinese). Zhou, L.M., Zuo, Z., Chow, M.S., 2005. Danshen: an overview of its chemistry, pharmacology, pharmacokinetics, and clinical use. J. Clin. Pharmacol. 45, 1345–1359. Zhou, L.L., Yi, W.Z., Qi, J.J., Sun, P., Li, X.E., 2012. Effect of varieties and growth years on root yield and bioactive components accumulation dynamics of Salvia miltiorrhizae. Chin. Wild Plant Resour. 31, 8–17 (in Chinese). Zhu, C.S., Chen, X., Guo, J., Miao, G.P., Feng, J.T., Zhang, X., 2014. Remove from marked records cloning and expression analysis of 1-deoxy-D-xylulose 5-phosphate reductoisomerase gene (DXR) in Tripterygiun wilfordii. J. Agric. Biotechnol. Sustain. Dev. 22, 298–308.
Peters, R.J., Qi, X., Chen, S., 2016. Analysis of the genome sequence of the medicinal plant Salvia miltiorrhiza. Mol. Plant 9, 949–952. Yang, Y.F., Hou, S., Cui, G.H., Chen, S.L., Wei, J.H., Huang, L.Q., 2010. Characterization of reference genes for quantitative real-time PCR analysis in various tissues of Salvia miltiorrhiza. Mol. Biol. Rep. 37, 507–513. Yang, D.F., Fang, Y.M., Xia, P.G., Zhang, X.D., Liang, Z.S., 2018. Diverse responses of tanshinone biosynthesis to biotic and abiotic elicitors in hairy root cultures of Salvia miltiorrhiza and Salvia castanea Diels f. Tomentosa. Gene 643, 61–67. Yao, H.Y., Gong, Y.F., Zuo, K.J., Ling, H., Qiu, C.X., Zhang, F., Wang, Y.C., Yan, P.Y., Liu, X., Sun, X.F., Tang, K.X., 2008. Molecular cloning, expression profiling and functional analysis of a DXR gene encoding 1-deoxy-d-xylulose 5-phosphate reductoisomerase from Camptotheca acuminata. J. Plant Physiol. 165, 203–213. Zhai, J.J., Zhang, H.R., Zhao, X.H., Gao, Z.M., 2016. Study on Optimal Harvesting Time of Salva miltiorrhizaBge. in Henan. J. Henan Agric. Sci. 45 (3), 112–115. Zhang, H.R., Li, Z.M., Gao, Z.M., 2007. Preliminary study on the characteristics of growth and development in Salvia miltiorrhiza. J. Anhui Agric. Sci. 35, 5783–5785 (in Chinese). Zhang, F., Wang, W.T., Xue, J., Shan, C.G., Wang, Z.F., 2014. Study on optimal harvest
614