- Email: [email protected]
Expression, purification, and characterization of a neovasculature targeted rmhTNF-α in Escherichia coli
Protein Expression and PuriWcation 45 (2006) 60–65 www.elsevier.com/locate/yprep
Expression, puriWcation, and characterization of a neovasculature targeted rmhTNF- in Escherichia coli 夽 Hui Wang, Zhen Yan, Jihong Shi, Wei Han ¤, Yingqi Zhang ¤ Biotechnology Center of The Fourth Military Medical University, 17 Changle West Road, 710032 Xi’an, PR China State Key Laboratory of Cancer Biology, 17 Changle West Road, 710032 Xi’an, PR China Received 30 March 2005, and in revised form 8 May 2005 Available online 21 June 2005
Abstract The tumor vasculature is a suitable target for cancer treatment. RGD-4C (CDCRGDCFC) peptide can bind to human v integrins, which are known to be selectively expressed in human tumor blood vessels. Some studies showed that coupling anticancer drugs or peptides to the RGD peptides yielded compounds with increased eYcacy against tumors and lowered toxicity to normal tissues in mice. TNF- mutant (rmhTNF-) that we previously constructed has been proved to have stronger antitumor eVect compared with TNF-. To increase antitumor eVect and lower toxicity of rmhTNF-, we coupled RGD4C to the N-terminal of rmhTNF- (termed RGD4C-rmhTNF) and expressed RGD4C-rmhTNF in Escherichia coli. Here, we describe the expression, puriWcation, and characterization of RGD4C-rmhTNF. 2005 Elsevier Inc. All rights reserved.
Tumor necrosis factor- (TNF-)1 plays multiple roles as a mediator of inXammation and the immune response [1]. TNF- has synergistic antitumor eVects, including direct cytotoxicity against tumor cells, indirect activation of antitumor eVector immune cells in the blood, including macrophages, cytotoxic lymphocytes, and neutrophils [2,3]. Clinical applications of TNF- have been attempted as novel antineoplastic agents to tumors [4,5]. However, clinical applications of TNF- for cancer therapy are still limited because TNF- has been found to have toxic side eVects [6,7], such as a fever
夽 This work has been supported by program for Changjiang Scholars and Innovative Research Team in University (PCSIRT) in China. * Corresponding authors. Fax: +86 2983247213. E-mail addresses: [email protected] (W. Han), zhangyqh@ fmmu.edu.cn (Y. Zhang). 1 Abbreviations used: TNF-, tumor necrosis factor-; PMSF, phenylmethylsulfonyl Xuoride; LB, Luria–Bertani; ELISA, enzyme-linked immunosorbent assay.
1046-5928/$ - see front matter 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.pep.2005.05.009
and decreased blood pressure the same as an endotoxinlike shock, before therapeutic doses could be reached [8]. The progressive growth and metastasis of malignant neoplasms depend on new blood vessel formation. The reduction of tumor growth by attacking the vascular supply of the tumor oVers a primary target for therapeutic intervention. Endothelial cells are believed to play a central role in tumor growth because they act as the primary building blocks of the tumor microvasculature [9]. Integrin v3 has been found to play a very signiWcant role in the process of angiogenesis. Integrin v3 is minimally expressed on resting or normal blood vessels, but is signiWcantly up-regulated on vascular cells within human tumors or in response to certain growth factors in vitro [10–13]. Integrin v3 is also expressed on certain invasive tumors including metastatic melanoma [14] and late-stage glioblastoma [15,16]. Several tumor-homing peptides have been found [17], such as NGR, RGD, RGD-4C, and GSL. Coupling anticancer drugs or peptides to the RGD or NGR peptides
H. Wang et al. / Protein Expression and PuriWcation 45 (2006) 60–65
yield compounds with increased eYcacy against tumors [17–20] and lowered toxicity to normal tissues in mice [17,18]. RGD-4C (CDCRGDCFC) can bind selectively to v3 and v5 integrins and home to several tumor types (including carcinoma, sarcoma, and melanoma) in a highly selective manner [21]. TNF- mutant (rmhTNF-) that we previously constructed has been proved to have stronger antitumor eVect compared with TNF- [22]. To improve antitumor eVect and reduce toxicity of rmhTNF-, we fused RGD4C to the N-terminal of rmhTNF- (termed RGD4CrmhTNF) and express this fusion protein in Escherichia coli. We have developed a strategy for puriWcation of RGD4C-rmhTNF. RGD4C-rmhTNF was precipitated by step-wise ammonia sulfate and then the protein was puriWed by two-step ion exchange chromatography. The Wnal purity of RGD4C-rmhTNF was 95%. The speciWc cytotoxicity of the protein was 2.7 £ 108 U/mg. In addition, RGD4C-rmhTNF could bind to v3 integrin. These results showed that the process for puriWcation of RGD4C-rmhTNF was eVective.
Materials and methods Chemicals and enzymes The restriction endonucleases and T4 DNA ligase were purchased from Takara Dalian, China. Phenylmethylsulfonyl Xuoride (PMSF) and -mercaptoethanol were purchased from Sigma. The plasmid pBV220 containing the PR and PL promoters, the clts857 gene and two strong transcription terminators [23], and the plasmid pBV220/rmhTNF- containing the rmhTNF- cDNA were constructed in-house. Anti-TNF- monoclonal antibody was a kindly gift from Department of Immunology of The Fourth Military Medical University in China. Construction of RGD4C-rmhTNF expression vector The DNA coding for RGD4C peptide (CDCRGDC FC) was obtained by oligonucleotide synthesis according to the following sequences: sense strand, 5⬘GAATTCATGTGCGATTGCCGTGGTGATTGCT TTTGCG3⬘ (EcoRI restriction site was underlined) and antisense strand, 5⬘ GGATCCGCAAAAGCAATCAC CA CGGCAATCGCACTAG 3⬘ (BamHI restriction site was underlined). The plasmid pBV220/rmhTNF- was used as template DNA. PCR was performed using following primers: upstream, 5⬘-GGATCC CGC AAA CGT AAG CCT GTA GCC CAT GTT GTA (BamHI restriction site was underlined) and downstream, 5⬘-C TGC AGT CAG AAG GCA ATG ATC CCA AAG TA (PstI restriction site was underlined). After denaturation of DNA for 5 min at 95 °C, ampliWcation was performed
61
for 30 cycles through a regime of 1 min at 94 °C; 1 min at 55 °C, and 1 min at 72 °C. The products (229 bp) were digested with BamHI and PstI and recovered using an agarose gel. The plasmid pBV220 was digested with EcoRI and PstI and puriWed using an agarose gel. RGD4C oligonucleotide fragments (annealed) were ligated with the PCR products (rmhTNF-) and the pBV220 vector. The resulting plasmid was named pBV-RGD4C-rmhTNF. The construct was conWrmed by DNA sequencing. E. coli DH5 cells were transformed with the plasmid pBV-RGD4C-rmhTNF. Expression of RGD-rmhTNF A single transformed DH5 colony was used to inoculate 10 ml Luria–Bertani (LB) medium supplemented with ampicillin (100 g/ml) grown with 200 rpm shaking overnight at 37 °C. Three milliliters of culture was transferred to 300 ml fresh LB medium in a 500 ml shake Xask. The culture was grown with 200 rpm shaking at 30 °C until the OD600 reached 0.5 and induced by changing temperature from 30 to 42 °C. After incubation at 42 °C for 4 h, 1 ml of culture was collected, analyzed by electrophoresis on a 12% polyacrylamide/sodium dodecyl sulfate gel, and stained by Coomassie blue R-250. RGD4C-rmhTNF bioassay L929 mouse Wbroblast cells were used as indicators for measuring RGD4C-rmhTNF activity. The fractions collected from each puriWcation stage or diVerent concentrations of TNF- (2.5 £ 108 U/ml), rmhTNF- (2.5 £ 108 U/ ml) and puriWed RGD4C-rmhTNF (2.5 £ 108 U/ml) were added to 96-well Xat-bottomed tissue culture plates containing L929 cells (1 £ 105/well) treated with actinomycin D (10 g/ml). After 17 h incubation at 37 °C in 5% CO2balanced air, surviving cells were estimated by adding 20 l (5 mg/ml ) of MTT (3-[4,5-dimethylthiazol-2-yl]-2,5diphenyl-tetrazoliummide, Sigma) to each well, removing the culture supernatants after 4 h, and adding 100 l of 33% N,N-dimethylformamide, 200 g/L SDS, pH 4.7 to each well and reading the optical density of the solution at 570–595 nm. A standard curve was prepared by adding known concentrations of TNF- to the L929 cells as described by Monica Moro et al. [24]. The experimental groups were set up in triplicate. PuriWcation of RGD-rmhTNF Three-thousand milliliters of LB medium was added to 10 500 ml shake Xasks (300 ml per Xask). The shake Xasks were inoculated to a starting OD600 of 0.1 from an overnight culture grown in LB supplemented with ampicillin (100 g/ml). Cultures were grown with 200 rpm shaking at 30 °C and then induced at the OD600 of 0.5 for 4 h at 42 °C.
62
H. Wang et al. / Protein Expression and PuriWcation 45 (2006) 60–65
Cells were harvested by centrifugation at 10,000 rpm for 15 min and stored at ¡20 °C. Cell paste (30 g) was resuspended in 300 ml of lysis buVer (20 mM Tris–HCl, 150 mM NaCl, 1 mM EDTA, and 1 mM PMSF, pH 8.5) and lysed with lysozyme (24 mg). The lysate was centrifuged at 10,000 rpm for 15 min at 4 °C. Ammonium sulfate was added to the supernatant to 45% saturation and kept for 50 min at 4 °C. The supernatant was obtained by centrifugation at 10,000 rpm for 20 min at 4 °C, following by increasing the ammonium sulfate concentration to 65% of saturation. This solution was kept at 4 °C for 50 min. The pellets collected by centrifugation as described above were dissolved in buVer A (20 mM Tris–HCl, 1 mM EDTA, pH 8.5) and dialyzed against buVer A thoroughly. The resulting solution was named S1. Then S1 was applied to QSepharose fast Xow column equilibrated with buVer A at Xow rate 5 ml/min and eluted with a linear gradient of NaCl from 0 to 1 M in buVer A. Fractions with RGD4CrmhTNF activity were pooled, dialyzed against buVer B (20 mM phosphate buVer, pH 7.5) and put on a SPSepharose fast Xow column equilibrated with buVer B at Xow rate 5 ml/min. The column was eluted with a linear gradient of NaCl from 0 to 1 M in buVer B. The active fraction was used as puriWed RGD4C-rmhTNF. Western blot Proteins were transferred to nitrocellulose membranes after SDS–PAGE using a Bio-Rad Trans-Blot Semi-Dry electrophoretic cell [25]. Western blot analyses were carried out using an anti-TNF- monoclonal antibody, followed by a phosphatase-labeled mouse anti-human IgG. Western Blue Stabilized Substrate (Promega) for alkaline phosphatase was used for detection. N-terminus amino acid sequencing N-terminus amino acid sequencing was Wnished by Shanghai GeneCore Biotechnologies.
490 nm was determined with an enzyme-linked immunosorbent assay (ELISA) reader. The data are representative of one of three experiments. Statistical analysis The data were analyzed by GraphPad Prism 3.0 software. Results were expressed as means § (SD) standard deviations and the diVerences were considered signiWcant at p < 0.05.
Results and discussion Expression of RGD4C-rmhTNF The expression of RGD4C-rmhTNF was identiWed by SDS–PAGE. The result showed that RGD4CrmhTNF protein (17.9 kDa) was expressed in E. coli (Fig. 1). RGD4C-rmhTNF protein was partially soluble and the expression level of the protein was about 13%. PuriWcation of RGD4C-rmhTNF protein Due to RGD4C-rmhTNF is partially soluble, we Wrst puriWed the protein by step-wise ammonia sulfate precipitation. Some of bacterial proteins were removed after two-step ammonia sulfate precipitation. Then RGD4CrmhTNF was puriWed by Q-Sepharose fast Xow column (Fig. 2, lane 4). The fraction with a high activity (2.5 £ 108 U/mg) was eluted at about 0.07–0.09 M NaCl and further puriWed by SP-Sepharose fast Xow column (Fig. 2, lane 5). The Wnal RGD4C-rmhTNF was eluted at about 0.7–0.8 M NaCl and the speciWc activity of the protein could reach 2.7 £ 108 U/mg. This puriWcation procedure resulted in Wnal puriWed yields of 3.9 mg puriWed RGD4C-rmhTNF per gram of cell paste (Table 1).
Binding to v3 integrin assay A 96-well plate was coated with 100 ng/well of v3 integrin overnight at 4 °C. The wells were washed three times with phosphate-buVered saline containing 0.2% Tween 20, which was repeated after each incubation step. Then the wells were blocked with 1% bovine serum albumin at 37 °C for 1 h. Various dilutions of rmhTNF- or puriWed RGD4C-rmhTNF were added to the wells and incubated for 2 h. One hundred microliters of antiTNF- antibody at 1:5000 was incubated in each well for 2 h and this was followed by incubation with 100 l of HRP-conjugated goat anti-mouse IgG. HRP activity was measured against o-phenylenediamine (Sigma) dissolved at 0.4 mg/ml in 0.05 M citrate-phosphate buVer, pH 5.0 containing H2O2 (0.00133%). Absorbance at
Fig. 1. Analysis of RGD4C-rmhTNF expression. RGD4C-rmhTNF was examined by 12% SDS–PAGE and the gel was stained with Coomassie brilliant blue R-250. lane 1, protein molecular weight markers. Lane 2, total cell lysate before induction; and lane 3, total cell lysate after induction.
H. Wang et al. / Protein Expression and PuriWcation 45 (2006) 60–65
Fig. 2. PuriWcation of RGD4C-rmhTNF. Lane 1, protein molecular weight markers; lane 2, crude extract; lane 3, S1; lane 4, active fraction after Q-Sepharose FF column; and lane 5, RGD4C-rmhTNF after SP-Sepharose FF column.
63
Fig. 3. Western blot analysis of RGD4C-rmhTNF. Lane 1, protein molecular weight markers; lane 2, the puriWed RGD4C-rmhTNF protein (under reducing conditions); and lanes 3 and 4, the puriWed RGD4C-rmhTNF protein (under non-reducing conditions).
We coupled the cyclic peptide RGD4C motif to the Nterminus of rmhTNF- for one reason: to avoid RGD4C peptide interference with the bioactivity of rmhTNF-. Some experiments showed that nine N-terminal amino acids of TNF- could be removed without losing cytotoxic activity in vitro [26]. The addition of amino acids to TNF at the N-terminal position decreased a side eVect of TNF- (enhancement of metastasis) without diminishing its anticancer activity [27]. The biological activity of RGD4C-rmhTNF that we puriWed could reach 2.7 £ 108 U/mg. This suggests that CDCRGDCFC coupled to the N-terminus of rmhTNF- do not interfere with rmhTNF- folding and binding to TNF receptors. Under non-reducing condition, the puriWed RGD4CrmhTNF protein could form homodimer and homotrimer. Western blot analysis conWrmed that monomer, homotrimer or homodimer of RGD4C-rmhTNF could be recognized by a speciWc monoclonal antibody against the human TNF- (Fig. 3). These oligomers may be linked by inter-molecular disulWde bonds. It is easy to form oligomers for RGD4C-rmhTNF because RGD4C contains 4 cysteines. Our study showed that the oligomers did not aVect the bioactivity of RGD4C-rmhTNF in vitro.
Fig. 4. Dose-dependent increase of the binding of puriWed RGD4CrmhTNF to v3 integrin. A 96-well plate was coated with v3 integrin and incubated with puriWed RGD4C-rmhTNF (0.01, 0.04, 0.16, 0.64, 2.5, and 10 g/ml) or rmhTNF- (0.01, 0.04, 0.16, 0.64, 2.5, and 10 g/ml) for 17 h. The binding abilities were detected by anti-TNF- monoclonal antibody. The X-axis represents the Wnal concentration of puriWed RGD4C-rmhTNF or rmhTNF- in the wells, the Y-axis is the observed OD at 490 nm.
the sequences that we designed. The purity of the Wnal RGD4C-rmhTNF was 95% (data not shown). To evaluate the binding ability of puriWed RGD4CrmhTNF to v3 integrin, Binding of puriWed RGD4CrmhTNF or rmhTNF- (control) to v3 integrin was detected by anti-TNF- monoclonal antibody. A dosedependent increase of the binding of puriWed RGD4CrmhTNF to v3 integrin was observed in the ELISA (Fig. 4). Although rmhTNF- seemed to bind to v3 integrin at low level, the binding ability of puriWed
Characterization of RGD4C-rmhTNF The N-terminal analysis of RGD4C-rmhTNF showed the sequences of amino acid as followed: MCDCRGDCFCGSRKR (RGD4C sequence was underlined). It conformed that the sequences of N-terminal of puriWed RGD4C-rmhTNF were consistent with Table 1 Summary of puriWcation of RGD4C-rmhTNF (30 g of wet cell paste) Total protein (mg) Crude extract S1 Q-Sepharose FF Sp-Sepharose FF a b c
2190 912 320 118
SpeciWc activity (U/mg)a 7
2.28 £ 10 2.19 £ 107 2.50 £ 108 2.70 £ 108
PuriWcation foldb
Yield (%)c
1.00 0.96 10.96 11.84
100.00 41.64 14.61 5.3
SpeciWc activity: cytolytic activity of RGD4C-rmhTNF (U/ml)/protein content (mg/ml). PuriWcation fold: speciWc cytolytic activity of each active fraction/speciWc cytolytic activity of rude extract. Total protein of each step/total protein of rude extract.
64
H. Wang et al. / Protein Expression and PuriWcation 45 (2006) 60–65
References
Fig. 5. Comparing the bioactivity between puriWed RGD4C-rmhTNF and rmhTNF-. L929 cells were incubated with TNF- (7.8, 3.9, 1.95, 0.98, 0.49, 0.25, 0.12, and 0.06 ng/ml), rmhTNF- (7.03, 3.52, 1.76, 0.88, 0.44, 0.22, 0.11, and 0.055 ng/ml) and the puriWed RGD4C-rmhTNF (4.48, 2.24, 1.12, 0.56, 0.28, 0.14, 0.07, and 0.0035 ng/ml), respectively. The bioactivities were determined as described under Materials and methods.
RGD4C-rmhTNF to v3 integrin was stronger than that of rmhTNF- (p < 0.01). We speculate that binding of rmhTNF- to v3 integrin is non-speciWc. This result proved that RGD4C sequence in the puriWed protein could bind to v3 integrin. We compared the bioactivity between rmhTNF- and puriWed RGD4C-rmhTNF. The viability of L929 cells was reduced by 50% after incubating with 0.18 ng/ml of the puriWed RGD4C-rmhTNF or 0.41 ng/ml of rmhTNF- for 17 h (Fig. 5). This demonstrated that the bioactivity of puriWed RGD4C-rmhTNF was not lower than rmhTNF-. In this study, RGD4C-rmhTNF was constructed and expressed in E. coli. The expression vector we used was the pBV220 that is a temperature sensitive expression vector. The vector is cost saving because expression of recombinant protein in this vector can be induced only by changing temperature. We developed a strategy for puriWcation of RGD4C-rmhTNF. This puriWcation procedure resulted in Wnal puriWed yields of 3.9 mg puriWed RGD4C-rmhTNF per gram of cell paste. The bioactivity of puriWed RGD4C-rmhTNF was similar to rmhTNF-. Moreover, the protein could bind to v3 integrin. These results showed that this puriWcation protocol is simple and eVective. It could be easily ampliWed at a larger scale. The investigation of antitumor activity of RGD4CrmhTNF in vivo is under way.
Acknowledgments This work has been supported by program for Changjiang scholars and innovative Research Team in university (PCSIRT) in China.
[1] E.A. Carswell, L.J. Old, R.L. Kasswl, S. Green, N. Fiore, B. Williamson, An endotoxin-induced serum factor causes necrosis tumor, Proc. Natl. Acad. Sci. USA 72 (1975) 3666–3670. [2] J.R. Gamble, J.M. Harlan, S.J. KlebandoV, M.A. Vadas, Stimulation of the adherence of neutrophils to umbilical vein endothelium by human recombinant tumor necrosis factor, Proc. Natl. Acad. Sci. USA 82 (1985) 8667–8671. [3] B. Neumann, T. Machleidt, A. Lifka, K. PfeVer, D. Vestweber, T.W. Mak, B. Holzmann, M. Kronke, Crucial role of 55-kilodalton TNF receptor in TNF-induced adhesion molecule expression and leukocyte organ inWltration, J. Immunol. 156 (1996) 1587–1593. [4] M. Blick, S.A. Sheriwin, M. Rosenblum, J. Gutterman, Phase I study of recombinant tumor necrosis factor in cancer patients, Cancer Res. 47 (1987) 2986–2989. [5] P.J. Creaven, J.E. Plager, S. Dupere, R.P. Huben, H. Takita, A. Mittelman, A. Proefrock, Phase I clinical trial of recombinant human tumor necrosis factor, Cancer Chemother. Pharmacol. 2019 (87) 137-144. [6] T. Moritz, N. Niederle, J. Baumann, D. May, E. Kurschel, R. Osieka, J. Kempeni, E. Schlick, C.G. Schmidt, Phase I study of recombinant human tumor necrosis factor alpha in advanced malignant disease, Cancer Immunol. Immunother. 29 (1989) 144–149. [7] W.L. Furman, D. Strother, K. McClain, B. Bell, B. Leventhal, C.B. Pratt, Phase I clinical trial of recombinant human tumor necrosis factor in children with refractory solid tumors: a pediatric oncology group study, J. Clin. Oncol. 11 (1993) 2205–2210. [8] S.A. Rosenberg, Gene therapy for cancer, J. Am. Med. Assoc. 268 (1992) 2416–2419. [9] J. Folkman, Angiogenesis in cancer, vascular, rheumatoid and other disease, Nat. Med. 1 (1995) 27–31. [10] J.A. Varner, P.C. Brooks, D.A. Cheresh, Review: the integrin avb3: angiogenesis and apoptosis, Cell Adhes. Commun. 3 (1995) 367–374. [11] P.C. Brooks, R.A.F. Clark, D.A. Cheresh, Requirement of vascular integrin avb3 for angiogenesis, Science (Washington, DC) 264 (1994) 569–571. [12] P.C. Brooks, S. Stromblad, R. Klemke, D. Visscher, F. Sarkar, D. Cheresh, Antiintegrin avb3 blocks human breast cancer growth and angiogenesis in human skin, J. Clin. Invest. 96 (1995) 1815–1822. [13] B.P. Eliceiri, D.A. Cheresh, The role of integrins during angiogenesis: insights into potential mechanisms of action and clinical development, J. Clin. Invest. 103 (1999) 1227–1230. [14] S.M. Albelda, S.A. Mette, D.E. Elder, R. Steward, L. Danjanovich, M. Herlyn, C.A. Buck, Integrin distribution in malignant melanoma: association of the b3 subunit with tumor progression, Cancer Res. 50 (1990) 6757–6764. [15] E. Petitclerc, S. Stromblad, T.L. von Schalsck, F. Mitjans, J. Piulats, A.M.P. Montgomery, D.A. Cheresh, P.A. Brooks, Integrin avb3promotes M21 melanoma growth in human skin by regulating tumor cell survival, Cancer Res. 59 (1999) 2724–2730. [16] C. Gladson, D.A. Cheresh, Glioblastoma expression of vitronectin and avb3 integrin, J. Clin. Invest. 88 (1991) 1924–1932. [17] W. Arap, R. Pasqualini, E. Ruoslahti, Cancer treatment by targeted drug delivery to tumor vasculature in a mouse model, Science Washington, DC 279 (1998) 377–380. [18] T.-Y. Lee, H.-C. Wu, Y.-L. Tseng, C.-T. Lin, A Novel Peptide SpeciWcally Binding to Nasopharyngeal Carcinoma For Targeted Drug Delivery, Cancer Res. 64 (2004) 8002–8008. [19] A. Sacchi, A. Gasparri, F. Curnis, M. Bellone, A. Corti, Crucial Role for Interferon {gamma} in the Synergism between Tumor Vasculature-Targeted Tumor Necrosis Factor {alpha} (NGRTNF) and Doxorubicin, Cancer Res. 64 (2004) 7150–7155. [20] P. Holig, M. Bach, T. Volkel, T. Nahde, S. HoVmann, R. Muller, R.E. Kontermann, Novel RGD lipopeptides for the targeting of liposomes to integrin-expressing endothelial and melanoma cells, Protein Eng. 17 (2004) 433–444.
H. Wang et al. / Protein Expression and PuriWcation 45 (2006) 60–65 [21] E. Koivunen, B. Wang, E. Ruoslahti, Phage Libraries Displaying Cyclic Peptides with DiVerent Ring Sizes: Ligand SpeciWcities of the RGD-Directed Integrins, Biotechnology 13 (1995) 265–270. [22] Y.Q. Zhang, N. Zhao, B. Li, L. Liu, Z.L. Wang, B.E. Zhu, Z.L. Yan, C.Z. Su, Preparation of a novel recombinant human tumor necrosis factor- by gene engineering technology, Chin. J. Cell Mol. Immunol. 18 (2002) 402–405. [23] Z.Q. Zhang, L. Yao, Y.D. Hou, Construction and application of a high level expression vector containing PR PL promoter, Chin. J. Virol. 6 (1990) 111–116. [24] M. Moro, M. Pelagi, G. Fulci, Tumor cell targeting with antibody– avidin complexes and biotinylated tumor necrosis factor , Cancer Res. 57 (1997) 1922–1928.
65
[25] H. Towbin, T. Staehelin, J. Gordon, Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications, Proc. Natl. Acad. Sci. USA 76 (1979) 4350–4354. [26] A.A. Creasey, L.V. Doyle, M.T. Reynolds, T. Jung, L.S. Lin, C.R. Vitt, Biological eVects of recombinant human tumor necrosis factor and its novel muteins on tumor and normal cell lines, Cancer Res. 47 (1987) 145–149. [27] K. Miyata, M. Kato, H. Shikama, K. Nishimura, N. Sakae, K. Kawagoe, T. Nishikawa, K. Kuroda, K. Yamaguchi, Y. Aoyama, Y. Mitsuishi, N.A. Yamada, YIGSR-containing novel mutein without the detrimental eVect of human TNF-alpha of enhancing experimental pulmonary metastasis, Clin. Exp. Metastasis 10 (1992) 267–272.
Expression, puriWcation, and characterization of a neovasculature targeted rmhTNF- in Escherichia coli 夽 Hui Wang, Zhen Yan, Jihong Shi, Wei Han ¤, Yingqi Zhang ¤ Biotechnology Center of The Fourth Military Medical University, 17 Changle West Road, 710032 Xi’an, PR China State Key Laboratory of Cancer Biology, 17 Changle West Road, 710032 Xi’an, PR China Received 30 March 2005, and in revised form 8 May 2005 Available online 21 June 2005
Abstract The tumor vasculature is a suitable target for cancer treatment. RGD-4C (CDCRGDCFC) peptide can bind to human v integrins, which are known to be selectively expressed in human tumor blood vessels. Some studies showed that coupling anticancer drugs or peptides to the RGD peptides yielded compounds with increased eYcacy against tumors and lowered toxicity to normal tissues in mice. TNF- mutant (rmhTNF-) that we previously constructed has been proved to have stronger antitumor eVect compared with TNF-. To increase antitumor eVect and lower toxicity of rmhTNF-, we coupled RGD4C to the N-terminal of rmhTNF- (termed RGD4C-rmhTNF) and expressed RGD4C-rmhTNF in Escherichia coli. Here, we describe the expression, puriWcation, and characterization of RGD4C-rmhTNF. 2005 Elsevier Inc. All rights reserved.
Tumor necrosis factor- (TNF-)1 plays multiple roles as a mediator of inXammation and the immune response [1]. TNF- has synergistic antitumor eVects, including direct cytotoxicity against tumor cells, indirect activation of antitumor eVector immune cells in the blood, including macrophages, cytotoxic lymphocytes, and neutrophils [2,3]. Clinical applications of TNF- have been attempted as novel antineoplastic agents to tumors [4,5]. However, clinical applications of TNF- for cancer therapy are still limited because TNF- has been found to have toxic side eVects [6,7], such as a fever
夽 This work has been supported by program for Changjiang Scholars and Innovative Research Team in University (PCSIRT) in China. * Corresponding authors. Fax: +86 2983247213. E-mail addresses: [email protected] (W. Han), zhangyqh@ fmmu.edu.cn (Y. Zhang). 1 Abbreviations used: TNF-, tumor necrosis factor-; PMSF, phenylmethylsulfonyl Xuoride; LB, Luria–Bertani; ELISA, enzyme-linked immunosorbent assay.
1046-5928/$ - see front matter 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.pep.2005.05.009
and decreased blood pressure the same as an endotoxinlike shock, before therapeutic doses could be reached [8]. The progressive growth and metastasis of malignant neoplasms depend on new blood vessel formation. The reduction of tumor growth by attacking the vascular supply of the tumor oVers a primary target for therapeutic intervention. Endothelial cells are believed to play a central role in tumor growth because they act as the primary building blocks of the tumor microvasculature [9]. Integrin v3 has been found to play a very signiWcant role in the process of angiogenesis. Integrin v3 is minimally expressed on resting or normal blood vessels, but is signiWcantly up-regulated on vascular cells within human tumors or in response to certain growth factors in vitro [10–13]. Integrin v3 is also expressed on certain invasive tumors including metastatic melanoma [14] and late-stage glioblastoma [15,16]. Several tumor-homing peptides have been found [17], such as NGR, RGD, RGD-4C, and GSL. Coupling anticancer drugs or peptides to the RGD or NGR peptides
H. Wang et al. / Protein Expression and PuriWcation 45 (2006) 60–65
yield compounds with increased eYcacy against tumors [17–20] and lowered toxicity to normal tissues in mice [17,18]. RGD-4C (CDCRGDCFC) can bind selectively to v3 and v5 integrins and home to several tumor types (including carcinoma, sarcoma, and melanoma) in a highly selective manner [21]. TNF- mutant (rmhTNF-) that we previously constructed has been proved to have stronger antitumor eVect compared with TNF- [22]. To improve antitumor eVect and reduce toxicity of rmhTNF-, we fused RGD4C to the N-terminal of rmhTNF- (termed RGD4CrmhTNF) and express this fusion protein in Escherichia coli. We have developed a strategy for puriWcation of RGD4C-rmhTNF. RGD4C-rmhTNF was precipitated by step-wise ammonia sulfate and then the protein was puriWed by two-step ion exchange chromatography. The Wnal purity of RGD4C-rmhTNF was 95%. The speciWc cytotoxicity of the protein was 2.7 £ 108 U/mg. In addition, RGD4C-rmhTNF could bind to v3 integrin. These results showed that the process for puriWcation of RGD4C-rmhTNF was eVective.
Materials and methods Chemicals and enzymes The restriction endonucleases and T4 DNA ligase were purchased from Takara Dalian, China. Phenylmethylsulfonyl Xuoride (PMSF) and -mercaptoethanol were purchased from Sigma. The plasmid pBV220 containing the PR and PL promoters, the clts857 gene and two strong transcription terminators [23], and the plasmid pBV220/rmhTNF- containing the rmhTNF- cDNA were constructed in-house. Anti-TNF- monoclonal antibody was a kindly gift from Department of Immunology of The Fourth Military Medical University in China. Construction of RGD4C-rmhTNF expression vector The DNA coding for RGD4C peptide (CDCRGDC FC) was obtained by oligonucleotide synthesis according to the following sequences: sense strand, 5⬘GAATTCATGTGCGATTGCCGTGGTGATTGCT TTTGCG3⬘ (EcoRI restriction site was underlined) and antisense strand, 5⬘ GGATCCGCAAAAGCAATCAC CA CGGCAATCGCACTAG 3⬘ (BamHI restriction site was underlined). The plasmid pBV220/rmhTNF- was used as template DNA. PCR was performed using following primers: upstream, 5⬘-GGATCC CGC AAA CGT AAG CCT GTA GCC CAT GTT GTA (BamHI restriction site was underlined) and downstream, 5⬘-C TGC AGT CAG AAG GCA ATG ATC CCA AAG TA (PstI restriction site was underlined). After denaturation of DNA for 5 min at 95 °C, ampliWcation was performed
61
for 30 cycles through a regime of 1 min at 94 °C; 1 min at 55 °C, and 1 min at 72 °C. The products (229 bp) were digested with BamHI and PstI and recovered using an agarose gel. The plasmid pBV220 was digested with EcoRI and PstI and puriWed using an agarose gel. RGD4C oligonucleotide fragments (annealed) were ligated with the PCR products (rmhTNF-) and the pBV220 vector. The resulting plasmid was named pBV-RGD4C-rmhTNF. The construct was conWrmed by DNA sequencing. E. coli DH5 cells were transformed with the plasmid pBV-RGD4C-rmhTNF. Expression of RGD-rmhTNF A single transformed DH5 colony was used to inoculate 10 ml Luria–Bertani (LB) medium supplemented with ampicillin (100 g/ml) grown with 200 rpm shaking overnight at 37 °C. Three milliliters of culture was transferred to 300 ml fresh LB medium in a 500 ml shake Xask. The culture was grown with 200 rpm shaking at 30 °C until the OD600 reached 0.5 and induced by changing temperature from 30 to 42 °C. After incubation at 42 °C for 4 h, 1 ml of culture was collected, analyzed by electrophoresis on a 12% polyacrylamide/sodium dodecyl sulfate gel, and stained by Coomassie blue R-250. RGD4C-rmhTNF bioassay L929 mouse Wbroblast cells were used as indicators for measuring RGD4C-rmhTNF activity. The fractions collected from each puriWcation stage or diVerent concentrations of TNF- (2.5 £ 108 U/ml), rmhTNF- (2.5 £ 108 U/ ml) and puriWed RGD4C-rmhTNF (2.5 £ 108 U/ml) were added to 96-well Xat-bottomed tissue culture plates containing L929 cells (1 £ 105/well) treated with actinomycin D (10 g/ml). After 17 h incubation at 37 °C in 5% CO2balanced air, surviving cells were estimated by adding 20 l (5 mg/ml ) of MTT (3-[4,5-dimethylthiazol-2-yl]-2,5diphenyl-tetrazoliummide, Sigma) to each well, removing the culture supernatants after 4 h, and adding 100 l of 33% N,N-dimethylformamide, 200 g/L SDS, pH 4.7 to each well and reading the optical density of the solution at 570–595 nm. A standard curve was prepared by adding known concentrations of TNF- to the L929 cells as described by Monica Moro et al. [24]. The experimental groups were set up in triplicate. PuriWcation of RGD-rmhTNF Three-thousand milliliters of LB medium was added to 10 500 ml shake Xasks (300 ml per Xask). The shake Xasks were inoculated to a starting OD600 of 0.1 from an overnight culture grown in LB supplemented with ampicillin (100 g/ml). Cultures were grown with 200 rpm shaking at 30 °C and then induced at the OD600 of 0.5 for 4 h at 42 °C.
62
H. Wang et al. / Protein Expression and PuriWcation 45 (2006) 60–65
Cells were harvested by centrifugation at 10,000 rpm for 15 min and stored at ¡20 °C. Cell paste (30 g) was resuspended in 300 ml of lysis buVer (20 mM Tris–HCl, 150 mM NaCl, 1 mM EDTA, and 1 mM PMSF, pH 8.5) and lysed with lysozyme (24 mg). The lysate was centrifuged at 10,000 rpm for 15 min at 4 °C. Ammonium sulfate was added to the supernatant to 45% saturation and kept for 50 min at 4 °C. The supernatant was obtained by centrifugation at 10,000 rpm for 20 min at 4 °C, following by increasing the ammonium sulfate concentration to 65% of saturation. This solution was kept at 4 °C for 50 min. The pellets collected by centrifugation as described above were dissolved in buVer A (20 mM Tris–HCl, 1 mM EDTA, pH 8.5) and dialyzed against buVer A thoroughly. The resulting solution was named S1. Then S1 was applied to QSepharose fast Xow column equilibrated with buVer A at Xow rate 5 ml/min and eluted with a linear gradient of NaCl from 0 to 1 M in buVer A. Fractions with RGD4CrmhTNF activity were pooled, dialyzed against buVer B (20 mM phosphate buVer, pH 7.5) and put on a SPSepharose fast Xow column equilibrated with buVer B at Xow rate 5 ml/min. The column was eluted with a linear gradient of NaCl from 0 to 1 M in buVer B. The active fraction was used as puriWed RGD4C-rmhTNF. Western blot Proteins were transferred to nitrocellulose membranes after SDS–PAGE using a Bio-Rad Trans-Blot Semi-Dry electrophoretic cell [25]. Western blot analyses were carried out using an anti-TNF- monoclonal antibody, followed by a phosphatase-labeled mouse anti-human IgG. Western Blue Stabilized Substrate (Promega) for alkaline phosphatase was used for detection. N-terminus amino acid sequencing N-terminus amino acid sequencing was Wnished by Shanghai GeneCore Biotechnologies.
490 nm was determined with an enzyme-linked immunosorbent assay (ELISA) reader. The data are representative of one of three experiments. Statistical analysis The data were analyzed by GraphPad Prism 3.0 software. Results were expressed as means § (SD) standard deviations and the diVerences were considered signiWcant at p < 0.05.
Results and discussion Expression of RGD4C-rmhTNF The expression of RGD4C-rmhTNF was identiWed by SDS–PAGE. The result showed that RGD4CrmhTNF protein (17.9 kDa) was expressed in E. coli (Fig. 1). RGD4C-rmhTNF protein was partially soluble and the expression level of the protein was about 13%. PuriWcation of RGD4C-rmhTNF protein Due to RGD4C-rmhTNF is partially soluble, we Wrst puriWed the protein by step-wise ammonia sulfate precipitation. Some of bacterial proteins were removed after two-step ammonia sulfate precipitation. Then RGD4CrmhTNF was puriWed by Q-Sepharose fast Xow column (Fig. 2, lane 4). The fraction with a high activity (2.5 £ 108 U/mg) was eluted at about 0.07–0.09 M NaCl and further puriWed by SP-Sepharose fast Xow column (Fig. 2, lane 5). The Wnal RGD4C-rmhTNF was eluted at about 0.7–0.8 M NaCl and the speciWc activity of the protein could reach 2.7 £ 108 U/mg. This puriWcation procedure resulted in Wnal puriWed yields of 3.9 mg puriWed RGD4C-rmhTNF per gram of cell paste (Table 1).
Binding to v3 integrin assay A 96-well plate was coated with 100 ng/well of v3 integrin overnight at 4 °C. The wells were washed three times with phosphate-buVered saline containing 0.2% Tween 20, which was repeated after each incubation step. Then the wells were blocked with 1% bovine serum albumin at 37 °C for 1 h. Various dilutions of rmhTNF- or puriWed RGD4C-rmhTNF were added to the wells and incubated for 2 h. One hundred microliters of antiTNF- antibody at 1:5000 was incubated in each well for 2 h and this was followed by incubation with 100 l of HRP-conjugated goat anti-mouse IgG. HRP activity was measured against o-phenylenediamine (Sigma) dissolved at 0.4 mg/ml in 0.05 M citrate-phosphate buVer, pH 5.0 containing H2O2 (0.00133%). Absorbance at
Fig. 1. Analysis of RGD4C-rmhTNF expression. RGD4C-rmhTNF was examined by 12% SDS–PAGE and the gel was stained with Coomassie brilliant blue R-250. lane 1, protein molecular weight markers. Lane 2, total cell lysate before induction; and lane 3, total cell lysate after induction.
H. Wang et al. / Protein Expression and PuriWcation 45 (2006) 60–65
Fig. 2. PuriWcation of RGD4C-rmhTNF. Lane 1, protein molecular weight markers; lane 2, crude extract; lane 3, S1; lane 4, active fraction after Q-Sepharose FF column; and lane 5, RGD4C-rmhTNF after SP-Sepharose FF column.
63
Fig. 3. Western blot analysis of RGD4C-rmhTNF. Lane 1, protein molecular weight markers; lane 2, the puriWed RGD4C-rmhTNF protein (under reducing conditions); and lanes 3 and 4, the puriWed RGD4C-rmhTNF protein (under non-reducing conditions).
We coupled the cyclic peptide RGD4C motif to the Nterminus of rmhTNF- for one reason: to avoid RGD4C peptide interference with the bioactivity of rmhTNF-. Some experiments showed that nine N-terminal amino acids of TNF- could be removed without losing cytotoxic activity in vitro [26]. The addition of amino acids to TNF at the N-terminal position decreased a side eVect of TNF- (enhancement of metastasis) without diminishing its anticancer activity [27]. The biological activity of RGD4C-rmhTNF that we puriWed could reach 2.7 £ 108 U/mg. This suggests that CDCRGDCFC coupled to the N-terminus of rmhTNF- do not interfere with rmhTNF- folding and binding to TNF receptors. Under non-reducing condition, the puriWed RGD4CrmhTNF protein could form homodimer and homotrimer. Western blot analysis conWrmed that monomer, homotrimer or homodimer of RGD4C-rmhTNF could be recognized by a speciWc monoclonal antibody against the human TNF- (Fig. 3). These oligomers may be linked by inter-molecular disulWde bonds. It is easy to form oligomers for RGD4C-rmhTNF because RGD4C contains 4 cysteines. Our study showed that the oligomers did not aVect the bioactivity of RGD4C-rmhTNF in vitro.
Fig. 4. Dose-dependent increase of the binding of puriWed RGD4CrmhTNF to v3 integrin. A 96-well plate was coated with v3 integrin and incubated with puriWed RGD4C-rmhTNF (0.01, 0.04, 0.16, 0.64, 2.5, and 10 g/ml) or rmhTNF- (0.01, 0.04, 0.16, 0.64, 2.5, and 10 g/ml) for 17 h. The binding abilities were detected by anti-TNF- monoclonal antibody. The X-axis represents the Wnal concentration of puriWed RGD4C-rmhTNF or rmhTNF- in the wells, the Y-axis is the observed OD at 490 nm.
the sequences that we designed. The purity of the Wnal RGD4C-rmhTNF was 95% (data not shown). To evaluate the binding ability of puriWed RGD4CrmhTNF to v3 integrin, Binding of puriWed RGD4CrmhTNF or rmhTNF- (control) to v3 integrin was detected by anti-TNF- monoclonal antibody. A dosedependent increase of the binding of puriWed RGD4CrmhTNF to v3 integrin was observed in the ELISA (Fig. 4). Although rmhTNF- seemed to bind to v3 integrin at low level, the binding ability of puriWed
Characterization of RGD4C-rmhTNF The N-terminal analysis of RGD4C-rmhTNF showed the sequences of amino acid as followed: MCDCRGDCFCGSRKR (RGD4C sequence was underlined). It conformed that the sequences of N-terminal of puriWed RGD4C-rmhTNF were consistent with Table 1 Summary of puriWcation of RGD4C-rmhTNF (30 g of wet cell paste) Total protein (mg) Crude extract S1 Q-Sepharose FF Sp-Sepharose FF a b c
2190 912 320 118
SpeciWc activity (U/mg)a 7
2.28 £ 10 2.19 £ 107 2.50 £ 108 2.70 £ 108
PuriWcation foldb
Yield (%)c
1.00 0.96 10.96 11.84
100.00 41.64 14.61 5.3
SpeciWc activity: cytolytic activity of RGD4C-rmhTNF (U/ml)/protein content (mg/ml). PuriWcation fold: speciWc cytolytic activity of each active fraction/speciWc cytolytic activity of rude extract. Total protein of each step/total protein of rude extract.
64
H. Wang et al. / Protein Expression and PuriWcation 45 (2006) 60–65
References
Fig. 5. Comparing the bioactivity between puriWed RGD4C-rmhTNF and rmhTNF-. L929 cells were incubated with TNF- (7.8, 3.9, 1.95, 0.98, 0.49, 0.25, 0.12, and 0.06 ng/ml), rmhTNF- (7.03, 3.52, 1.76, 0.88, 0.44, 0.22, 0.11, and 0.055 ng/ml) and the puriWed RGD4C-rmhTNF (4.48, 2.24, 1.12, 0.56, 0.28, 0.14, 0.07, and 0.0035 ng/ml), respectively. The bioactivities were determined as described under Materials and methods.
RGD4C-rmhTNF to v3 integrin was stronger than that of rmhTNF- (p < 0.01). We speculate that binding of rmhTNF- to v3 integrin is non-speciWc. This result proved that RGD4C sequence in the puriWed protein could bind to v3 integrin. We compared the bioactivity between rmhTNF- and puriWed RGD4C-rmhTNF. The viability of L929 cells was reduced by 50% after incubating with 0.18 ng/ml of the puriWed RGD4C-rmhTNF or 0.41 ng/ml of rmhTNF- for 17 h (Fig. 5). This demonstrated that the bioactivity of puriWed RGD4C-rmhTNF was not lower than rmhTNF-. In this study, RGD4C-rmhTNF was constructed and expressed in E. coli. The expression vector we used was the pBV220 that is a temperature sensitive expression vector. The vector is cost saving because expression of recombinant protein in this vector can be induced only by changing temperature. We developed a strategy for puriWcation of RGD4C-rmhTNF. This puriWcation procedure resulted in Wnal puriWed yields of 3.9 mg puriWed RGD4C-rmhTNF per gram of cell paste. The bioactivity of puriWed RGD4C-rmhTNF was similar to rmhTNF-. Moreover, the protein could bind to v3 integrin. These results showed that this puriWcation protocol is simple and eVective. It could be easily ampliWed at a larger scale. The investigation of antitumor activity of RGD4CrmhTNF in vivo is under way.
Acknowledgments This work has been supported by program for Changjiang scholars and innovative Research Team in university (PCSIRT) in China.
[1] E.A. Carswell, L.J. Old, R.L. Kasswl, S. Green, N. Fiore, B. Williamson, An endotoxin-induced serum factor causes necrosis tumor, Proc. Natl. Acad. Sci. USA 72 (1975) 3666–3670. [2] J.R. Gamble, J.M. Harlan, S.J. KlebandoV, M.A. Vadas, Stimulation of the adherence of neutrophils to umbilical vein endothelium by human recombinant tumor necrosis factor, Proc. Natl. Acad. Sci. USA 82 (1985) 8667–8671. [3] B. Neumann, T. Machleidt, A. Lifka, K. PfeVer, D. Vestweber, T.W. Mak, B. Holzmann, M. Kronke, Crucial role of 55-kilodalton TNF receptor in TNF-induced adhesion molecule expression and leukocyte organ inWltration, J. Immunol. 156 (1996) 1587–1593. [4] M. Blick, S.A. Sheriwin, M. Rosenblum, J. Gutterman, Phase I study of recombinant tumor necrosis factor in cancer patients, Cancer Res. 47 (1987) 2986–2989. [5] P.J. Creaven, J.E. Plager, S. Dupere, R.P. Huben, H. Takita, A. Mittelman, A. Proefrock, Phase I clinical trial of recombinant human tumor necrosis factor, Cancer Chemother. Pharmacol. 2019 (87) 137-144. [6] T. Moritz, N. Niederle, J. Baumann, D. May, E. Kurschel, R. Osieka, J. Kempeni, E. Schlick, C.G. Schmidt, Phase I study of recombinant human tumor necrosis factor alpha in advanced malignant disease, Cancer Immunol. Immunother. 29 (1989) 144–149. [7] W.L. Furman, D. Strother, K. McClain, B. Bell, B. Leventhal, C.B. Pratt, Phase I clinical trial of recombinant human tumor necrosis factor in children with refractory solid tumors: a pediatric oncology group study, J. Clin. Oncol. 11 (1993) 2205–2210. [8] S.A. Rosenberg, Gene therapy for cancer, J. Am. Med. Assoc. 268 (1992) 2416–2419. [9] J. Folkman, Angiogenesis in cancer, vascular, rheumatoid and other disease, Nat. Med. 1 (1995) 27–31. [10] J.A. Varner, P.C. Brooks, D.A. Cheresh, Review: the integrin avb3: angiogenesis and apoptosis, Cell Adhes. Commun. 3 (1995) 367–374. [11] P.C. Brooks, R.A.F. Clark, D.A. Cheresh, Requirement of vascular integrin avb3 for angiogenesis, Science (Washington, DC) 264 (1994) 569–571. [12] P.C. Brooks, S. Stromblad, R. Klemke, D. Visscher, F. Sarkar, D. Cheresh, Antiintegrin avb3 blocks human breast cancer growth and angiogenesis in human skin, J. Clin. Invest. 96 (1995) 1815–1822. [13] B.P. Eliceiri, D.A. Cheresh, The role of integrins during angiogenesis: insights into potential mechanisms of action and clinical development, J. Clin. Invest. 103 (1999) 1227–1230. [14] S.M. Albelda, S.A. Mette, D.E. Elder, R. Steward, L. Danjanovich, M. Herlyn, C.A. Buck, Integrin distribution in malignant melanoma: association of the b3 subunit with tumor progression, Cancer Res. 50 (1990) 6757–6764. [15] E. Petitclerc, S. Stromblad, T.L. von Schalsck, F. Mitjans, J. Piulats, A.M.P. Montgomery, D.A. Cheresh, P.A. Brooks, Integrin avb3promotes M21 melanoma growth in human skin by regulating tumor cell survival, Cancer Res. 59 (1999) 2724–2730. [16] C. Gladson, D.A. Cheresh, Glioblastoma expression of vitronectin and avb3 integrin, J. Clin. Invest. 88 (1991) 1924–1932. [17] W. Arap, R. Pasqualini, E. Ruoslahti, Cancer treatment by targeted drug delivery to tumor vasculature in a mouse model, Science Washington, DC 279 (1998) 377–380. [18] T.-Y. Lee, H.-C. Wu, Y.-L. Tseng, C.-T. Lin, A Novel Peptide SpeciWcally Binding to Nasopharyngeal Carcinoma For Targeted Drug Delivery, Cancer Res. 64 (2004) 8002–8008. [19] A. Sacchi, A. Gasparri, F. Curnis, M. Bellone, A. Corti, Crucial Role for Interferon {gamma} in the Synergism between Tumor Vasculature-Targeted Tumor Necrosis Factor {alpha} (NGRTNF) and Doxorubicin, Cancer Res. 64 (2004) 7150–7155. [20] P. Holig, M. Bach, T. Volkel, T. Nahde, S. HoVmann, R. Muller, R.E. Kontermann, Novel RGD lipopeptides for the targeting of liposomes to integrin-expressing endothelial and melanoma cells, Protein Eng. 17 (2004) 433–444.
H. Wang et al. / Protein Expression and PuriWcation 45 (2006) 60–65 [21] E. Koivunen, B. Wang, E. Ruoslahti, Phage Libraries Displaying Cyclic Peptides with DiVerent Ring Sizes: Ligand SpeciWcities of the RGD-Directed Integrins, Biotechnology 13 (1995) 265–270. [22] Y.Q. Zhang, N. Zhao, B. Li, L. Liu, Z.L. Wang, B.E. Zhu, Z.L. Yan, C.Z. Su, Preparation of a novel recombinant human tumor necrosis factor- by gene engineering technology, Chin. J. Cell Mol. Immunol. 18 (2002) 402–405. [23] Z.Q. Zhang, L. Yao, Y.D. Hou, Construction and application of a high level expression vector containing PR PL promoter, Chin. J. Virol. 6 (1990) 111–116. [24] M. Moro, M. Pelagi, G. Fulci, Tumor cell targeting with antibody– avidin complexes and biotinylated tumor necrosis factor , Cancer Res. 57 (1997) 1922–1928.
65
[25] H. Towbin, T. Staehelin, J. Gordon, Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications, Proc. Natl. Acad. Sci. USA 76 (1979) 4350–4354. [26] A.A. Creasey, L.V. Doyle, M.T. Reynolds, T. Jung, L.S. Lin, C.R. Vitt, Biological eVects of recombinant human tumor necrosis factor and its novel muteins on tumor and normal cell lines, Cancer Res. 47 (1987) 145–149. [27] K. Miyata, M. Kato, H. Shikama, K. Nishimura, N. Sakae, K. Kawagoe, T. Nishikawa, K. Kuroda, K. Yamaguchi, Y. Aoyama, Y. Mitsuishi, N.A. Yamada, YIGSR-containing novel mutein without the detrimental eVect of human TNF-alpha of enhancing experimental pulmonary metastasis, Clin. Exp. Metastasis 10 (1992) 267–272.