Extract of fermented barley attenuates chronic alcohol induced liver damage by increasing antioxidative activities

Food Research International 43 (2010) 118–124

Contents lists available at ScienceDirect

Food Research International journal homepage: www.elsevier.com/locate/foodres

Extract of fermented barley attenuates chronic alcohol induced liver damage by increasing antioxidative activities Puspo E. Giriwono a, Takuya Hashimoto a, Yusuke Ohsaki a, Hitoshi Shirakawa a,*, Hideki Hokazono b, Michio Komai a a

Laboratory of Nutrition, Department of Science of Food Function and Health, Graduate School of Agricultural Science, Tohoku University, 1-1 Tsutsumidori-Amamiyamachi, Aoba-ku, Sendai 981-8555, Japan Research Laboratory, Sanwa Shurui Co., Ltd., 2231-1 Yamamoto, Usa City, Oita 879-0495, Japan

b

a r t i c l e

i n f o

Article history: Received 20 April 2009 Accepted 7 September 2009

Keywords: Chronic alcohol Fermented barley Oxidative stress Polyphenol Liver damage

a b s t r a c t Chronic consumption of alcohol leads to liver disorders primarily as hepatosteatosis, and increase of oxidative stress. The abundance of these reactive oxygen species (ROS) is a result of ethanol (ethyl alcohol) oxidation by alcohol dehydrogenase and cytochrome p450 2E1 (CYP2E1). In order to address this problem with natural substance, the high polyphenol content of barley has been numerously cited to provide excellent antioxidative effect. In this study, we investigated the effect of fermented barley extract (FBE) in chronic ethanol fed female Wistar rats. We obtained significant decrease of plasma alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities in the FBE supplemented group. Further examinations revealed that FBE induces substantial improvement in hepatic gene expressions of key anti-oxidative genes, reinforced by its increase of enzymatic activities and subsequent suppression of oxidative stress. Thus we have demonstrated a novel approach for the use of barley as supplements to attenuate chronic alcohol consumption. Ó 2009 Elsevier Ltd. All rights reserved.

1. Introduction Ethanol is primarily metabolized, or oxidized in the hepatic microsome into acetaldehyde then further oxidized into acetic acid. This two step oxidizing process releases protons which would reduce NAD+ into energy potent NADH (Lieber, 2000). Prolonged consumption of ethanol also increases the production of reactive oxygen species (ROS), in particular through the activation of cytochrome p450 2E1 (CYP2E1) in the well known microsomal ethanol oxidation system (MEOS) (Choi & Ou, 2006; Lieber, 2000, 2003). Numerous mechanisms have been suggested as to how alcohol induces oxidative stress, including change in redox state; acetaldehyde production; mitochondrial damage; activation of MEOS; mobilization of iron; and decrease of antioxidant enzymes (Dey & Cederbaum, 2006). Abbreviations: ALT, alanine aminotransferase; AST, aspartate aminotransferase; CAT, catalase; CYP2E1, cytochrome P450 2E1; FBE, fermented barley extract; GPx, glutathione peroxidase; HDL-C, high density lipoprotein cholesterol; MEOS, microsomal ethanol oxidation system; TC, total cholesterols; TG, triglycerides; SOD, superoxide dismutase. * Corresponding author. Address: Laboratory of Nutrition, Graduate School of Agricultural Sciences, Tohoku University, 1-1 Tsutsumidori-Amamiyamachi, Aoba-ku, Sendai 981-8555, Japan. Tel.: +81 22 717 8812; fax: +81 22 717 8813. E-mail address: [email protected] (H. Shirakawa). 0963-9969/$ - see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.foodres.2009.09.008

Natural antioxidants in the form of polyphenols are found in abundant plant sources, fruits, vegetables and whole grains. Barley, a cereal that is utilized in mass volumes mainly in brewing industries, has been found to contain antioxidative compounds in the form of bioactive compounds such as b-glucans, tocols, and phenolic compounds, e.g., benzoic and cinnamic acid derivatives, proanthocyanidins, quinones, flavonols, chalcones, flavones, flavanones, and amino phenolic compounds (Bonoli, Verardo, Marconi, & Caboni, 2004). The highest concentration of antioxidant among cereals may be found in whole meal barley flour (1.09 mmol/ 100 g equivalent to vitamin C, FRAP assay) as reported by Halvorsen et al. (2002). Furthermore fermentation process in barley assists in increasing the amount of polyphenols (Ye, Morimura, Han, Shigematsu, & Kida, 2004; Yoshimoto et al., 2004). Phenolic compounds demonstrate varying degrees of tolerance to the fermentation processes in brewery industries and are able to partially withstand these processes; thus may be found in the residual byproducts of fermentation (Yoshimoto et al., 2004). With the rich content of antioxidative polyphenols in barley and its fermented derivative, it is surprising that attenuation of ethanol induced oxidative stress has not been reported previously. Thus in this paper we conducted the potential use of barley’s antioxidative nature to suppress increased liver injury due to chronic ethanol feeding in rat.

P.E. Giriwono et al. / Food Research International 43 (2010) 118–124

2. Materials and methods 2.1. Materials Reagent kits to assay for total cholesterol (TC), triglycerides (TG), high density lipoprotein-cholesterol (HDL-C), alanine aminotransferase (ALT), and aspartate aminotransferase (AST) were purchased from Wako Pure Chemical Co. (Osaka, Japan). Kits for assaying glutathione peroxidase (GPx), catalase (CAT) and superoxide dismutase (SOD) activities were purchased from Cayman (Ann Arbor, MI). 2.2. Fermented barley extract (FBE) FBE was prepared as follows. Barley is fermented with Koji (Aspergillus kawauchi) then ethanol fermented according to the method of conventional Japanese brewing. The lees of this fermentation mixture was defatted and then screw-pressed to separate the liquid phase from the fermented barley fibers. The extracted liquid was filtered using a ceramic filter (porosity, 0.2 lm) to remove solubilized fibers. The filtrate was then used as the test sample (FBE) and stored at 4 °C. Analysis of FBE indicates composition of proteins (17.9%), carbohydrate (25.1%), lipids (0.1%), and minerals (2.2%). 2.3. Experimental diet The original Lieber-DeCarli liquid diet (Fisher et al., 2002; Lieber & DeCarli, 1989) was modified to accommodate the incorporation of FBE such that equivalent protein and carbohydrate consumptions were maintained. Each liter of this diet contains the following ingredients (referred to as ‘‘base” in Table 1) (g): Na-saccharin, 0.287; dl-methionine, 0.3; cellulose, 1.1; vitamin mixture, 2.4; mineral mixture, 8.3; xanthan gum, 2.5; and soy protein isolate, 26.0. This was the common base used for all the diets in this study, and it was combined with varying amounts of sucrose, FBE, and distilled water, as shown in Table 1, during the preparation process. The diets were prepared daily and provided to the rats in plastic bottles with glass nozzles that were designed to minimize spillage. 2.4. FBE antioxidative activity Antioxidative activity of FBE was measured using a chemiluminescent reagent kit available from Atto Corp. (Tokyo, Japan). In essence, antioxidative activities of samples were determined through its ROS scavenging effect in chemiluminescent superoxide reaction

Table 1 Formulation of experimental diets. Treatment formula (g/L) No. Alc. (negative control 0% alcohol) Base Sucrose Soy protein isolate (SPI) Corn oil Ethanol FBE Distilled water

Con. (positive control 5% alcohol)

FB.a (5% alcohol + 4% FBE)

40.88 124.40 46.50

40.88 32.70 46.50

40.88 21.22 38.31

53.00 0.00 0.00 759.71

53.00 50.00 0.00 723.41

53.00 50.00 45.78 748.80

a FBE yields 17.9 g/100 mL protein, 25.1 g/100 mL carbohydrate, 0.1 g/mL lipids; hence, in order to maintain proportional protein content, SPI was reduced to 38.31 g/L in the FBE supplemented group (FB.). Sucrose concentration was also adjusted to maintain isocaloric treatment between the groups, each providing 1150 kcal/L.

119

initiated by xanthine oxidase. (+)-Catechin was used as a positive control. The percent inhibition by sample exposure was determined by comparison with the provided dilution buffer control group. The obtained data were used to determine the concentration of the sample required to scavenge 50% of the free radicals (IC50). The percent inhibition was plotted against the concentration and the IC50 was obtained from the fitted linear curve. A lower IC50 denotes a more potent antioxidant. 2.5. General procedure (animals) Female Wistar rats, aged 7 weeks and weighing 120–130 g, were purchased from SLC Japan (Shizuoka, Japan). Each rat was housed individually under a constant temperature of 23 ± 1 °C in a 12 h light:dark (08:00–20:00 light) cycle. The overall duration of the feeding period was 25 days, followed by 14 h of fasting prior to dissection. The protocols used in all the experiments were approved by the Animal Research-Animal Care Committee at the Graduate School of Agricultural Sciences, Tohoku University. 2.6. Blood and liver biochemical markers assay In order to determine the final plasma ALT and AST activities and lipid content, blood was obtained from the rats while they were under light diethyl ether anesthesia by exsanguination via the abdominal aorta. The blood was collected in Na2EDTA prepared tubes then centrifuged at 1870g for 15 min at 4 °C. The plasma was then divided into aliquots and stored at 30 °C. Plasma ALT and AST activities and the levels of plasma triglyceride (TG), total cholesterol (TC), and high density lipoprotein-cholesterol (HDL-C) were determined by enzymatic colorimetric methods that were performed using appropriate kits (Wako Pure Chemical Co., Osaka, Japan) according to the manufacturer’s instructions. The concentration of low density lipoprotein-cholesterol (LDL-C) was calculated according to the formula: LDL-C = (TC HDL-C) (TG/5) as reported by Friedewald, Levy, and Fredrickson (1972). The livers were excised, blotted, weighed, promptly frozen in liquid nitrogen, and stored at 70 °C until further analysis. Liver lipids were extracted according to Folch’s method (Folch, Lees, & Stanley, 1956) and that of Yuan et al. (2007). Subsequently, the TG and TC levels in the separated phases were assayed using commercial kits purchased from Wako Pure Chemical Co. 2.7. RNA preparation and quantitative RT-PCR Total RNA was isolated from the excised livers that were previously stored in RNAlater (Ambion Japan, Tokyo, Japan). RNA was extracted by tissue disruption in a guanidine isothiocyanate-based reagent (Isogen, Nippon Gene, Toyama, Japan) with a bead-type homogenizer Micro Smash MS-100 (Tomy Seiko Co. Ltd., Tokyo, Japan) according to the manufacturer’s instructions. The integrity of the isolated RNA was examined by agarose gel electrophoresis, and its concentration was determined based on the absorbance values at 260 nm. cDNA was synthesized from 5 lg of total RNA that was denatured with oligo-dT/random primers, 10 mM dNTP (GE Healthcare Biosciences, Tokyo, Japan) at 65 °C. The denatured RNA was incubated in 50 mM Tris–HCl buffer (pH 8.3), 0.1 mM DTT, 50 units of Superscript III reverse transcriptase (Invitrogen, Carlsbad, CA), and 20 units of the RNase inhibitor RNaseOUT (Invitrogen). The cDNA synthesis protocol was as follows: 25 °C for 5 min, followed by 50 °C for 60 min, and finally at 70 °C for 15 min using a TaKaRa PCR Thermal cycler MP (TaKaRa Biomedicals, Shiga, Japan). Aliquots of the synthesized cDNA were used as the template for quantitative RT-PCR that was performed with ABI PRISM 7300 (Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions. For measuring the levels of

120

P.E. Giriwono et al. / Food Research International 43 (2010) 118–124

Table 2 Sequences of primers used for PCR amplification in the quantitative RT-PCR assay. Genea

Forward primer

Reverse primer

Eef1a1 Cat Sod1 Gpx1

GATGGCCCCAAATTCTTGAAG AGCCTCCTCAGCCTGCACT GGCCGTACTATGGTGGTCCA TGACCGACCCCAAGTACATCA

GGACCATGTCAACAATTGCAG GGCTTGTGCCCTGCTTCA TCCACCTTTGCCCAAGTCAT AAATGTCGTTGCGGGACAC

a Eef1a1, Eukaryotic elongation factor 1a1; Cat, Catalase; Sod1, Cytosolic superoxide dismutase 1 and Gpx1, Glutathione peroxidase 1.

transcription, the mRNA levels were first normalized to the mRNA level of eukaryotic elongation factor 1a-1 (Eef1a1) and then compared with the mRNA levels of the controls in order to determine relative expression (Ohsaki et al., 2006). The sequences of primers used for each gene expression assay are shown in Table 2. 2.8. Antioxidative enzymes analyses The frozen livers were weighed and homogenized in chilled buffers according to the specific enzyme to be assayed. The homogenate was then centrifuged at 1500g for 5 min at 4 °C, and the total SOD activities were assayed, according to the instructions provided in the SOD assay kit from Cayman (Ann Arbor, MI). For assaying catalase (CAT) and glutathione peroxidase (GPx) activities, the liver homogenates were further centrifuged at 15,000g for 15 min at 4 °C in the corresponding buffers. The supernatant was assayed according to the manufacturer’s instructions (Cayman, Ann Arbor, MI). For all the enzyme assays, absorbance was measured using a Spectra Microplate Autoreader (680RX, Bio-Rad, Hercules, CA).

least significant difference (LSD) test was used to evaluate the differences between groups. SPSS version 11.0 (SPSS Inc., Chicago, IL) was used for all data computation. Statistical significance was set at p < 0.05 or lower. 2.12. Ethical guidelines The experiments we conducted did not involve human subjects/ patients. All protocols involving animal experiments were conducted according to the guidelines for ethical treatment of animals in scientific research approved by the Animal Research-Animal Care Committee at the Graduate School of Agricultural Sciences, Tohoku University No. 05-08B. 3. Results 3.1. Food intake and growth Food intake of individual rat was measured daily during exchange of fresh feed, while the body weight of each rat was obtained every 3 days. Significant lower body weight gain was apparent starting from the ninth day of feeding in both ethanol fed groups (Fig. 1A). It was also observed in the mean daily food in-

2.9. Hepatic lipid peroxides assay (TBARS) The level of lipid peroxidation in the liver was measured based on the colorimetric reaction of thiobarbituric acid (TBA) with malondialdehyde (MDA), a product of lipid peroxidation, which was performed according to the procedures reported by Ohkawa, Ohishi, and Yagi (1979). In general, 0.2 g of liver was homogenized in 2 mL of 1.15% KCl. Next, 0.2 mL of this homogenate was added 0.2 mL of 8.1% SDS, 1.5 mL of 20% acetic acid (pH 3.5), and 1.5 mL of 0.8% 2-thiobarbituric acid (TBA) (upper aqueous phase). The volume of this mixture was then made up to 4 mL with distilled water, followed by heating at 95 °C for 60 min, with a glass ball used as the condenser. Next, the tubes were cooled under running tap water, and a 1.0 mL distilled water and 5.0 mL n-butanol:pyridine (v/v, 15:1) were added. The tubes were then shaken vigorously for 2 min. After centrifugation at 1870g for 10 min, the absorbance of the upper organic phase was measured at 532 nm. 1,1,3,3-Tetramethoxypropane (TMP, Wako Pure Chemicals, Osaka, Japan) was used as the standard. 2.10. Serum 8-hydroxy-2-deoxyguanosine (8-OHdG) assay The serum level of 8-OHdG were determined by first separating serum from exsanguinated blood that was allowed to coagulate at room temperature for at least 2 h and then centrifuged at 1870g. Aliquots of serum were then stored at 30 °C until their use in the assays. The concentration of 8-OHdG was determined by EIA with a commercially available kit purchased from JaICA (Japan Institute for the Control of Aging, Shizuoka, Japan); the assay was performed according to the manufacturer’s instructions. 2.11. Statistical analysis Values are represented as the mean value with standard errors. One-way analysis of variance (ANOVA), followed by the Fisher

Fig. 1. Growth and food intake were reduced with alcohol consumption. (A) Decrease in body weight gain was observed from day 9 onward in both alcoholadministered groups (Con. and FB.). (B) Average daily food intake was also decreased in both the alcohol-administered groups. All values are mean ± SE of each group; n = 6; p < 0.05 against all other groups; different letters denote significant differences.

121

P.E. Giriwono et al. / Food Research International 43 (2010) 118–124

take that ethanol fed groups consumed substantially lower liquid diet (Fig. 1B), thus partly explaining the lower body weight gain. However, no differences occurred between both ethanol treated groups (Con. and FB.) and mean daily calorie was found to be similar. This observation demonstrates the distinct effect of chronic alcohol consumption on growth due to reduced food intake and is a commonly observed phenomenon (Lieber & DeCarli, 1989; Sancho-Tello, Sanchis, & Guerri, 1988).

3.2. Plasma ALT and AST activities Primary indicators of liver injury that may be detected efficiently is the high concentrations of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities, enzymes abundant in the liver, present in the plasma. While the ratios may vary in different circumstances, liver damage due to chronic ethanol have been indicated by the ratio of AST to ALT of above two (Kojima et al., 2005; Leontowicz et al., 2003). In our study, liver injury was sustained by individual rats due to the chronic ethanol treatment as indicated by the high concentrations of the hepatic enzymes in the plasma. However, it was also apparent that the supplementation of FBE in the FB. group was effective in suppressing the injuries by decreasing the level of plasma ALT and AST activities (Fig. 2). In comparison to the plasma ALT and AST levels of Con., FBE supplementation was effective in decreasing up to 52.9% and 35%, respectively. Nevertheless, this suppression activity does not appear to be dose dependent as experiments incorporating higher concentrations of FBE supplementation did not yield higher reduction effect (data not shown).

Table 3 Alcohol induced elevated lipids concentrations in livers of rat and reduced TG in plasma.a No. Alc.

Con.

FB.

Liver: (mg/g) Total lipid Triglyceride Total cholesterol

46.1 ± 3.5* 41.0 ± 4.0* 1.0 ± 0.2*

64.0 ± 7.7 56.6 ± 10.2 3.2 ± 1.4

67.1 ± 5.3 54.0 ± 1.0 2.9 ± 0.6

Plasma: (mmol/L) Triglyceride Total cholesterol HDL cholesterol LDL cholesterol VLDL cholesterol

0.48 ± 0.04* 1.01 ± 0.07 0.18 ± 0.01 0.60 ± 0.06 0.23 ± 0.02

0.35 ± 0.03 0.73 ± 0.06* 0.21 ± 0.07 0.36 ± 0.03 0.16 ± 0.01

0.38 ± 0.03 1.21 ± 0.05 0.36 ± 0.08 0.67 ± 0.11 0.18 ± 0.02

a Values presented are mean ± SE (n = 5). Significant difference against all other groups: * p < 0.05.

3.3. Plasma and liver lipids Chronic ethanol consumption has been closely associated with liver steatosis and its subsequent injury caused by increased hepatic lipid concentrations. Thus we further investigated whether the attenuation of FBE was due to improvement of liver steatosis as induced by ethanol. The results we obtained showed clear indication of steatosis forming in livers of Con. group as indicated by increased TG and TC concentrations (Table 3) compared to No. Alc. Furthermore, the supplementation of FBE did not appear to improve the condition of this steatosis as similar levels of TG and TC were also detected in the livers of FB. group. Additionally, the lipids profile of plasma, with the exception of TG and TC also showed similar levels between groups with no differences observed in the ethanol fed groups; revealing a different method of attenuation by FBE supplementation. 3.4. Increased gene expressions and activities of hepatic antioxidative enzymes As it became apparent that the attenuation activity of FBE involved a different mechanism to hepatosteatosis improvement, we evaluated the hepatic genetic expressions of mRNA that are involved in the defense against oxidative stress. The abundance of ROS generated by chronic oxidation of ethanol depletes the reduced GSH pool of the liver including the inhibition of mRNA expressions. Immediately it was clear that chronic ethanol consumption inhibited the hepatic expressions of Gpx1 and Cat in the Con. group, on the contrary FBE supplementation induced improved expressions of these anti-oxidative genes, comparably against No. Alc. group and substantially contrary to Con. group (Fig. 3A). Subsequently, the determination of its corresponding enzymatic activities in the liver also exhibited improved antioxidative activities in FBE supplemented group as shown by significantly higher hepatic GPx and CAT enzymatic activities (Fig. 3B and D). This result evidently enforced the positive effect of FBE supplementation on oxidative defense of the liver to the extent of mRNA signaling. This entails a suppression of oxidative stress in the liver as indicated by the results we obtained on determining the levels of lipid peroxidation and oxidized deoxyguanosine (8-OHdG) (Fig. 3E and F). The results all indicated increased antioxidative defense in the livers of FBE supplemented group attributing to the suppression of liver injury caused by excessive ROS in chronic ethanol consumption.

Fig. 2. FBE supplementation substantially decreased hepatic injury biochemical markers. Both plasma (A) ALT and (B) AST activities were effectively suppressed by FBE supplementation. All values represented as mean ± SE; n = 6; different letters represent significant differences at p < 0.05.

4. Discussion Supplementation of FBE at 4% in FB. group apparently did not affect major physiological changes as similar weight gain and daily

122

P.E. Giriwono et al. / Food Research International 43 (2010) 118–124

Fig. 3. FBE stimulates increased expression of antioxidative response genes and an increase in the activities of their corresponding enzymatic activities. (A) Quantitative RTPCR assay indicated that alcohol reduced the expression of these genes in the Con. and FB. groups relative to No. Alc. group. However, it is apparent that FBE supplementation results in overexpressions these anti-oxidative gene. Subsequently, the hepatic activities of (B) GPx, (C) SOD, and (D) CAT after FBE supplementation were improved as compared to their activities in the Con. group. Oxidative stress was observed to be substantially decreased, based on the level of (E) hepatic lipid peroxidation and (F) serum 8-OHdG concentration. All values are represented as mean ± SE; n = 6; different letters represent significant differences at p < 0.05.

consumption of the experimental liquid diet fared similarly to that of Con. group, thus indicating that macronutrient requirements of both ethanol fed groups were equally fulfilled. Nevertheless, the distinct effect of ethanol consumption was observed clearly in the significantly lower body weight gain of both ethanol fed groups compared to No. Alc. group from day 9 onward. We have formulated isocaloric diet between groups and maintained at 1150 kcal/L. However, it was apparent that both ethanol fed groups showed considerable decrease in mean daily intake when compared to No.Alc, leading to a lower energy intake but not difference among ethanol fed groups (Con. and FB.). This noticeable decrease in energy and the subsequent lower body weight gain has been addressed extensively in chronic ethanol models. Insufficient nutritional intake may be dismissed as the cause of subsequent liver damage that occurs even under pair fed conditions (Chen et al., 2004; Lieber & DeCarli, 1989; Sancho-Tello et al., 1988). Other than reduction in energy intake, the exact mechanism responsible for this weight gain suppression remains unclear (Leo & Lieber, 1983) and was suggested as a result of reduced levels of hepatic arachidonate which may be reversed by incorporating arachidonic acid in the diet (Lieber & DeCarli, 1989).

In the present study, liver injury caused by chronic ethanol feeding in rat was determined from elevated ALT and AST activities present in the plasma as a clear marker of liver necrosis (Goldberg & Watts, 1965; Leo & Lieber, 1983; Pari & Karthikesan, 2007). Furthermore, as the ratio of plasma AST to ALT activities was above two it is regarded as a distinct indication of chronic ethanol induced liver injury (Kojima et al., 2005; Leontowicz et al., 2003). The significant suppression of liver injury observed in the FBE supplemented group may be presumed as the potential effect of barley’s antioxidative nature of its phenolic compounds, and not linked to lipid improvements of either plasma or liver. Some studies have also reported no improvement lipid concentrations after barley supplementation (Frank, Kamal-Eldin, Razdan, Lundh, & Vessby, 2003; Jus´kiewicz et al., 2002; Zdunczyk et al., 2006). The results we obtained pertaining to increased lipid peroxidation and DNA oxidative damage, as marked by increased MDA levels and 8-OHdG, conform to similar data reported in different studies of ethanol administration in rats (Kasdallah-Grissa et al., 2006). Several oxidative stress promoting mechanisms by ethanol have been suggested (Bailey, Patel, Young, Asayama, & Cunningham, 2001; Lieber, 2000) including the generation of ROS by MEOS,

P.E. Giriwono et al. / Food Research International 43 (2010) 118–124

specifically the activation of CYP2E1, induced by high ethanol dose or chronic exposure (Kasdallah-Grissa et al., 2006; Navasumrit, Ward, Dodd, & O’Connor, 2000; Nordmann, 1994). This abundance of ROS is capable of propagating lipid peroxidation and its detrimental effect on the antioxidative system (Nordmann, 1994). The subsequent byproducts of lipid peroxidation in turn have been shown to promote collagen production (Tsukamoto, Rippe, Niemelä, & Lin, 1995). It has also been suggested that these products are initiators of inflammatory response and fibrosis, thus having an important role in alcoholic liver disease (Ingelman-Sunderberg et al., 1993). We demonstrated here the attenuation effect of FBE in chronic ethanol induced liver injury as shown by substantial reduction of plasma ALT and AST activities, indicating liver protection from ethanol toxicity. The high polyphenol content of FBE was determined to be 850 mg/100 mL in our extract and approximately 125.8 mg of it was consumed daily by each rat in the FBE supplemented liquid ethanol diet. Of this high polyphenol content, it was determined that FBE exhibited antioxidative activity of IC50 at 100.37 mg/mL compared to 13.56 mg/mL for (+)-catechin. It was apparent that this daily consumption amount was observed to yield significant effect in decreasing oxidative stress as indicated by improved MDA and 8-OHdG levels. Our results are in agreement with other dietary supplementation of polyphenols from other plants in ethanol induced experiments (Kasdallah-Grissa et al., 2006; Kaviarasan, Viswanathan, & Anuradha, 2007) and also from barley and other grains in other investigations (Zdun´czyk et al., 2006). Barley polyphenol, and grain in general, provides a myriad of antioxidative mechanism which may be partially explained by the fact that it acts as electron donors reducing the oxidized intermediates of lipid peroxidation processes (Yen & Chen, 1995; Zhao et al., 2008); its ability to scavenge superoxide anion (Zhao et al., 2008), a common action among other form of polyphenols (Kasdallah-Grissa et al., 2006; Leiro, Alvarez, Garcia, & Orallo, 2002), thus reducing a-tocopheroxyl radical and regenerating vitamin E reserves in livers of rat (Kasdallah-Grissa et al., 2006; Zdunczyk et al., 2006); the ability to chelate ferrous ions (Yen & Chen, 1995), as chronic ethanol consumption has been observed to increase iron mobilization (Choi & Ou, 2006; Dey & Cederbaum, 2006). Furthermore, barley also contributes to provide additional trace elements Zn, Se, Cu and Mn known to be essential components in antioxidative enzymes (Zdun´czyk et al., 2006). This is further reinforced by the fermentation method of FBE as Koji fermentation of barley has been reported to enhance the concentrations of polyphenol in residues of Japanese liquor brewing (Yoshimoto et al., 2004) along with the additional ethanol fermentation S-adenosylmethionine (SAMe), a potent antioxidant in chronic ethanol cases (Lieber et al., 1990; Mato et al., 1999), may be found in its lees (Hokazono et al., 2005). These antioxidative properties of phenolic compounds were evident in suppressing hepatic oxidative stress (Kaviarasan et al., 2007; Lieber et al., 1990; Mato et al., 1999; Saravanan, Rajasankar, & Nalini, 2007). As demonstrated, supplementation with FBE was observed to increase the mRNA expressions of Gpx1, and Cat, resulting in increased activities of these enzymes when compared to Con. (Fig. 3). This may be explained by the fact that polyphenols may increase transcription via the binding of various nuclear factors to antioxidant response element (ARE). It has been discussed and reported by Moskaug, Carlsen, Myhrstad, and Blomhoff (2005) that polyphenols are able to modulate the transcription of several anti-oxidative genes via activation of Nrf2 and more specifically the transcription of c-glutamylcysteine synthetase (cGCSh), thus increasing the cellular glutathione reserve. The considerable increase in GPx activity and maintained CAT activity observed in this study may be attributed to this fact and observed in numerous other studies, in which diets rich in polyphenols increased the anti-

123

oxidative capabilities of serum GPx and SOD (Arteel, Marsano, Mendez, Bentley, & McClain, 2003; Chen et al., 2004). On the contrary, hepatic SOD activity was observed to have very little increase over its No.Alc and Con. groups. One possible explanation may be due to the fact that 25 days of ethanol feeding with or without FBE supplementation may not affect clear and substantial change in its enzymatic activity, which has been reported previously (Samuhasaneeto, Thong-Ngam, Kulaputana, Suyasunanont, & Klaikeaw, 2009). Another possibility is that even though SOD is the first form of enzymatic defense against oxidative stress, it would appear that in our model GPx and CAT are more responsive. This may be due to the fact that GPx and CAT react with H2O2, and that GPx is more active in its removal because of its dual location in the mitochondria and cytosol (Bailey et al., 2001; Diplock, 1991). Nevertheless, the results clearly indicate that the action of FBE was by its antioxidative effect in either modulating transcription of antioxidative genes, maintaining enzymatic activities or a more direct effect in reducing ROS. Ultimately, ALD in rat may be suppressed by inhibition of lipid peroxidation, a major indicator of oxidative stress (Ohkawa et al., 1979). This action was further reinforced by the suppression of oxidized DNA products, as determined from serum 8-OHdG levels another effective indicator for measuring oxidative stress (Forlenza & Miller, 2006; Navasumrit, Ward, Dodd, & O’Connor, 2000).

References Arteel, G., Marsano, L., Mendez, C., Bentley, F., & McClain, C. J. (2003). Advances in alcoholic liver disease. Best Practice and Research in Clinical Gastroenterology, 17, 625–647. Bailey, S. M., Patel, V. B., Young, T. A., Asayama, K., & Cunningham, C. C. (2001). Chronic ethanol consumption alters the glutathione/glutathione peroxidase-1 system and protein oxidation status in rat liver. Alcoholism, Clinical and Experimental Research, 25, 726–733. Bonoli, M., Verardo, V., Marconi, E., & Caboni, M. F. (2004). Antioxidant phenols in barley (Hordeum vulgare L.) flour: Comparative spectrophotometric study among extraction methods of free and bound phenolic compounds. Journal of Agricultural and Food Chemistry, 52, 5195–5200. Chen, C. Y., Milbury, P. E., Kwak, H. K., Collins, F. W., Samuel, P., & Blumberg, J. B. (2004). Avenanthramides and phenolic acids from oats are bioavailable and act synergistically with vitamin C to enhance hamster and human LDL resistance to oxidation. Journal of Nutrition, 134, 1459–1466. Choi, J., & Ou, J. (2006). Mechanisms of liver injury. III. Oxidative stress in the pathogenesis of hepatitis C virus.. American Journal of Physiology. Gastrointestinal and Liver Physiology, 290, G847–G851. Dey, A., & Cederbaum, A. I. (2006). Alcohol and oxidative liver injury. Hepatology (Baltimore, Md.), 43, S63–S74. Diplock, A. T. (1991). Antioxidant nutrients and disease prevention: An overview. The American Journal of Clinical Nutrition, 53, 189S–193S. Fisher, H., Halladay, A., Ramasubramaniam, N., Petrucci, J. C., Dagounis, D., Sekowski, A., et al. (2002). Liver fat and plasma ethanol are sharply lower in rats fed ethanol in conjunction with high carbohydrate compared with high fat diets. Journal of Nutrition, 132, 2732–2736. Folch, J., Lees, M., & Stanley, G. H. (1956). A simple method for the isolation and purification of total lipids from animal tissues. The Journal of Biological Chemistry, 226, 497–509. Forlenza, M. J., & Miller, G. E. (2006). Increased serum levels of 8-hydroxy-2deoxyguanosine in clinical depression. Psychosomatic Medicine, 68, 1–7. Frank, J., Kamal-Eldin, A., Razdan, A., Lundh, T., & Vessby, B. (2003). The dietary hydroxycinnamate caffeic acid and its conjugate chlorogenic acid increase vitamin E and cholesterol concentration in Sprague-Dawley rats. Journal of Agricultural and Food Chemistry, 51, 2526–2531. Friedewald, T., Levy, R., & Fredrickson, D. S. (1972). Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clinical Chemistry, 18, 499–502. Goldberg, D. M., & Watts, C. (1965). Serum enzyme changes as evidence of liver reaction to oral alcohol. Gastroenterology, 49, 256–261. Halvorsen, B. L., Holte, K., Myhrstad, M. C. W., Barikmo, I., Hvattum, E., Remberg, S. F., et al. (2002). Systematic screening of total antioxidants in dietary plants. Journal of Nutrition, 132, 461–471. Hokazono, H., Nekogaki, K., Kajiwara, Y., Takashita, H., Okazaki, N., & Omori, T. (2005). Production of c-aminobutyric acid and S-adenosylmethionine in barleyshochu making. Journal of the Brewing Society of Japan, 100, 877–881. Ingelman-Sunderberg, M., Johanson, I., Yin, H., Terelius, Y., Eliasson, E., Clot, P., et al. (1993). Ethanol-inducible cytochrome P450IIE1: Genetic polymorphism, regulation and possible role in the etiology of alcohol-induced liver disease. Alcohol, 10, 447–452.

124

P.E. Giriwono et al. / Food Research International 43 (2010) 118–124

Jus´kiewicz, J., Zdun´czyk, Z., Wroblewska, M., Oszmianski, J., & Hernandez, T. (2002). The response of rats to feeding with diets containing grapefruit flavonoid extract. Food Research International, 35, 201–205. Kasdallah-Grissa, A., Mornagui, B., Aouani, E., Hammami, M., El May, M., Gharbi, N., et al. (2006). Resveratrol, a red wine polyphenol, attenuates ethanol-induced oxidative stress in rat liver. Life Sciences, 80, 1033–1039. Kaviarasan, S., Viswanathan, P., & Anuradha, C. V. (2007). Fenugreek seed (Trigonella foenum graecum) polyphenols inhibit ethanol-induced collagen and lipid accumulation in rat liver. Cell Biology and Toxicology, 23, 373–383. Kojima, H., Sakurai, S., Uemura, M., Takekawa, T., Morimoto, H., Tamagawa, Y., et al. (2005). Difference and similarity between non-alcoholic steatohepatitis and alcoholic liver disease. Alcoholism, Clinical and Experiment Research, 29, 259S–263S. Leiro, J., Alvarez, E., Garcia, D., & Orallo, F. (2002). Resveratrol modulates rat macrophage functions. International Immunopharmacology, 2, 767– 774. Leo, M. A., & Lieber, C. S. (1983). Hepatic fibrosis after long term administration of ethanol and moderate vitamin A supplementation in the rat. Hepatology, 3, 1–11. Leontowicz, M., Gorinstein, S., Leontowicz, H., Krzeminski, R., Lojek, A., Katrich, E., et al. (2003). Apple and pear peel and pulp and their influence on plasma lipids and antioxidant potentials in rats fed cholesterol-containing diets. Journal of Agricultural and Food Chemistry, 51, 5780–5785. Lieber, C. S. (2000). Alcohol and the Liver: Metabolism of alcohol and its role in hepatic and extrahepatic diseases. The Mount Sinai Journal of Medicine, New York, 67, 84–94. Lieber, C. S. (2003). Relationships between nutrition, alcohol use and liver disease. Alcohol Research and Health: The Journal of the National Institute on Alcohol Abuse and Alcoholism, 27, 220–231. Lieber, C. S., Casini, A., DeCarli, L. M., Kim, C. I., Lowe, N., Sasaki, R., et al. (1990). Sadenosyl-L-methionine attenuates alcohol-induced liver injury in the Baboon. Hepatology, 11, 165–172. Lieber, C. S., & DeCarli, L. M. (1989). Liquid diet technique of alcohol administration: 1989 Update. Alcohol and Alcoholism (Oxford, Oxfordshire), 24, 197–211. Mato, J. M., Cámara, J., Fernández de Paz, J., Caballería, L., Coll, S., Caballero, A., et al. (1999). S-adenosylmethionine in alcoholic liver cirrhosis: A randomized, placebo-controlled, double-blind, multicenter clinical trial. Journal of Hepatology, 30, 1081–1089. Moskaug, J., Carlsen, H., Myhrstad, M. C. W., & Blomhoff, R. (2005). Polyphenols and glutathione synthesis regulation. The American Journal of Clinical Nutrition, 81(Suppl.), 277S–283S. Navasumrit, P., Ward, T. H., Dodd, N. J., & O’Connor, P. J. (2000). Ethanol-induced free radicals and hepatic DNA strand breaks are prevented in vivo by antioxidants: Effects of acute and chronic ethanol exposure. Carcinogenesis, 21, 93–99.

Nordmann, R. (1994). Alcohol and antioxidant systems. Alcohol and Alcoholism (Oxford, Oxfordshire), 29, 513–522. Ohkawa, H., Ohishi, N., & Yagi, K. (1979). Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Analytical Biochemistry, 95, 351–358. Ohsaki, Y., Shirakawa, H., Hiwatashi, K., Furukawa, Y., Mizutani, T., & Komai, M. (2006). Vitamin K suppresses lipopolysaccharide-induced inflammation in the rat. Bioscience, Biotechnology and Biochemistry, 70, 926–932. Pari, L., & Karthikesan, K. (2007). Protective role of caffeic acid against alcoholinduced biochemical changes in rats. Fundamental and Clinical Pharmacology, 21, 355–361. Samuhasaneeto, S., Thong-Ngam, D., Kulaputana, O., Suyasunanont, D., & Klaikeaw, N. (2009). Curcumin decreased oxidative stress, inhibited NF-jB activation, and improved liver pathology in ethanol-induced liver injury in rats. Journal of Biomedicine and Biotechnology (Article ID 981963). Sancho-Tello, M., Sanchis, R., & Guerri, C. (1988). Effect of short and long-term ethanol feeding on the extent of metabolic tolerance in female rats. Alcohol and Alcoholism (Oxford, Oxfordshire), 23, 435–526. Saravanan, N., Rajasankar, S., & Nalini, N. (2007). Antioxidant effect of 2-hydroxy-4methoxy benzoic acid on ethanol-induced hepatotoxicity in rats. The Journal Pharmacy and Pharmacology, 59, 445–453. Tsukamoto, H., Rippe, R., Niemelä, O., & Lin, M. (1995). Roles of oxidative stress in activation of Kupffer and Ito cells in liver fibrogenesis. Journal of Gastroenterology and Hepatology, 10, S50–S53. Ye, X. J., Morimura, S., Han, L. S., Shigematsu, T., & Kida, K. (2004). In vitro evaluation of physiological activity of vinegar produced from barley-, sweet potato-, and rice-shochu post distillation slurry. Bioscience, Biotechnology and Biochemistry, 68, 551–556. Yen, G. C., & Chen, H. Y. (1995). Antioxidant activity of various tea extracts in relation to their antimutagenicity. Journal of Agricultural and Food Chemistry, 43, 27–32. Yoshimoto, M., Kurata-Azuma, R., Fujii, M., Hou, D. X., Ikeda, K., Yoshidome, T., et al. (2004). Phenolic composition and radical scavenging activity of sweetpotatoderived Shochu distillery by-products treated with koji. Bioscience, Biotechnology and Biochemistry, 68, 2477–2483. Yuan, H., Wong, L. S., Bhattacharya, M., Ma, C., Zafarani, M., Yao, M., et al. (2007). The effects of second-hand smoke on biological processes important in atherogenesis. BMC Cardiovascular Disorders, 7, 1. Zdun´czyk, Z., Flis, M., Zielin´ski, H., Wróblewska, M., Antoszkiewicz, Z., & Jus´kiewicz, J. (2006). In vitro antioxidant activities of barley, husked oat, naked oat, triticale, and buckwheat wastes and their influence on the growth and biomarkers of antioxidant status in rats. Journal of Agricultural and Food Chemistry, 54, 4168–4175. Zhao, H., Fan, W., Dong, J., Lu, J., Chen, J., Shan, L., et al. (2008). Evaluation of antioxidant activities and total phenolic contents of typical malting barley varieties. Food Chemistry, 107, 296–304.