- Email: [email protected]
Extraction of Superior-Quality Plasmid DNA by a Combination of Modified Alkaline Lysis and Silica Matrix
109
NOTES & TIPS
To date, we have used our modified assay to monitor changes in glutathione resulting from pharmacologic intervention of the HIV disease with N-acetylcysteine (6). We have also used this assay to investigate the redox changes in T cell subsets that occur in the course of HIV infection (manuscript in preparation). In these studies, T cells from uninfected individuals were sorted using fluorescence-activated cell sorting (FACS) to obtain pure populations of the various T cell subsets. The amount of glutathione present in the various purified populations of cells was then determined with our modified assay. A representative chromatogram from these analyses is shown in Fig. 3. We anticipate that the simplicity and general utility of this assay will lead to its wide use. Acknowledgment. These studies were supported by NIH Grant CA42509 to Leonard A. Herzenberg. FIG. 3. Representative chromatogram obtained from the analysis of the glutathione present within FACS sorted cells. Approximately 1 3 10 6 purified naı¨ve CD4 human T cells (CD4 1, CD45 1, CD62L 1) were FACS sorted, washed free of serum, and resuspended in 100 ml of 5% sulfosalicylic acid plus 50 mM DTT. The samples were then analyzed with our modified mBrB assay. The peak at 6.5 min. is the glutathione– bimane peak.
termination were smaller than the symbol designating the mean value of the determination. Results and Discussion We found that with our assay conditions, TCEP completely reduced the GSSG that was present within the samples to GSH. Furthermore, the presence of TCEP did not interfere with the labeling of GSH by mBrB nor with the detection of the glutathione– bimane product. This was true for samples consisting of either purified glutathione or acidified extracts of whole blood. As evidence for this, when samples possessing the same molar equivalents of glutathione in either the GSH or GSSG forms were assayed, the resultant fluorescent glutathione– bimane peaks were the same size (Table 1). Also, when GSSG standards with concentrations ranging between 6.125 and 800 mM in glutathione were assayed, a linear relationship was obtained between the concentration of glutathione in the sample and the size of glutathione– bimane peak measured (Fig. 1). This linear response was obtained regardless of the sample type, since the addition of defined amounts of GSSG to the acidified extracts of whole blood led to increases in the glutathione– bimane peak that were of the same area as that obtained when that amount of GSSG was assayed by itself (Table 1). Finally, we observed that the glutathione– bimane peaks could be unambiguously attributed and that they were well separated from other fluorescent entities that were generated (Fig. 2).
REFERENCES 1. Baeyens, W., VanderWeken, G., and DeMoerloose, P. (1987) Chromatographia 23, 717–721. 2. Fenton, S. S., and Fahey, R. C. (1986) Anal. Biochem. 154, 34 – 42. 3. Han, J. C., and Han, G. Y. (1994) Anal. Biochem. 220, 5–10. 4. Anderson, A., Isaksson, A., Brattstrom, L., and Hultberg, B. (1993) Clin. Chem. 39, 1590 –7. 5. Svardal, A. M., Mansoor, M. A., and Ueland, P. M. (1990) Anal. Biochem. 184, 338 – 46. 6. Herzenberg, L. A., De Rosa, S. C., Dubs, J. G., Roederer, M., Anderson, M. T., Ela, S. W., and Deresinski, S. C. (1997) Proc. Natl. Acad. Sci. USA 94, 1967–1972.
Extraction of Superior-Quality Plasmid DNA by a Combination of Modified Alkaline Lysis and Silica Matrix Ramakrishna Lakshmi, Vijaya Baskar, and Udaykumar Ranga 1 Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific Research, Jakkur, P.O. Box 6436, Bangalore 560 064, India Received December 31, 1998
Preparation of plasmid DNA from bacterial hosts on a smaller scale (mpDNA)2 is a basic requirement in molecular biology laboratories. Alkaline lysis of the bacterial cells is 1 To whom correspondence should be addressed. Fax: (80) 8462766. E-mail: [email protected]. 2 Abbreviations used: mpDNA, miniprep DNA; RE, restriction enzymes; TSM, Triton/silica method.
Analytical Biochemistry 271, 109 –112 (1999) Article ID abio.1999.4125 0003-2697/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.
110
NOTES & TIPS
FIG. 1. Comparison of the restriction enzyme patterns of mpDNA prepared by three different methods. 5 ml of mpDNA was incubated with 1.0 or 10 units (as shown at the top of the lanes) of the indicated enzyme at 37°C for 1 h. Following the incubation, the samples were resolved on a 1% agarose gel and stained with ethidium bromide. The following restriction patterns were expected after successful enzyme digestion: BamHI, 1695 and 3532 kb; KpnI, linearization; PstI, 1687, 1705, and 1834 bp. M, 1 kb ladder (GibcoBRL).
one of the most commonly used methods employed for this purpose (1). This method is simple and rapid; however, a few limitations are associated with this extraction procedure. Importantly, the quality of DNA extracted is often inadequate for subsequent molecular manipulations. Superior-quality mpDNA could be prepared using a number of commercial kits (Geneclean II, BIO 101; ion-exchange resins, Qiagen, etc.). However, the standard alkaline lysis protocol continues to be popular because the costs of the kits are unaffordable for routine use. Several reports employed silica (2–6) and its derivatives (7, 8) as principal matrices for preferential isolation of nucleic acids. The primary objective of these protocols was to purify DNA fragments from agarose gel. The potential of silica, however, has not been exploited for developing a similar inexpensive strategy for routine preparation of good-quality mpDNA. Here we present a simple and reproducible protocol for extracting mpDNA from bacterial cultures on a smaller scale for routine use in the laboratory. This protocol blends the simplicity of the alkaline lysis method with an important modification and the preferential binding of the silica matrix for nucleic acids. Cell pellets harvested from 1.5 ml of bacterial cultures grown overnight were lysed using alkaline lysis method as per the standard protocol (1). The samples were centrifuged at 10,000 rpm for 10 min and the supernatants were transferred to fresh vials. To each vial 450 ml of 5 M NaCl was added and mixed well. This was followed by the addition of 15 ml of silica suspension (6 g/50 ml). Silica (No. S 5631, Sigma) suspension was prepared as described previously with minor modifications (4). Following the addition of silica, the samples were agitated gently for 10 min and centrifuged at 10,000 rpm and the supernatants were decanted. Silica pellets were washed three times, each time with 250 ml of the wash solution
(60% ethanol, 10 mM Tris, pH 8.0, 100 mM NaCl, and 1 mM EDTA). Plasmid DNA bound to the silica matrix was eluted with 50 ml of autoclaved distilled water. Although mpDNA free of bacterial proteins or other impurities could be recovered by this method, the DNA was completely resistant to restriction (see below). We reasoned that SDS being negatively charged could bind the silica particles and coelute with the mpDNA. To test for this possibility, we replaced SDS with nonionic detergents such as Triton X-100 in solution 2. Plasmid DNA obtained with 1% Triton X-100 (No. 22686, Amersham) or IGEPAL CA-630 (No. I 3021, Sigma) was readily restricted with different restriction endonucleases (RE), whereas that of 1% SDS was not. Nonionic detergents lacking negative charge probably do not interact with the silica particles and are removed during the wash step. We tested different concentrations of Triton X-100 and found that Triton X-100 at 3% concentration or above completely lysed the bacterial cells. Based on these results we used 4% Triton X-100 in solution 2 of the optimized Triton/silica method (TSM). In addition, only trace levels of bacterial RNA were copurified with the mpDNA prepared by the TSM, obviating the need for RNase treatment. The presence of this RNA did not interfere with restriction of the mpDNA using several RE. IGEPAL CA-630 also appeared to function equally efficient. Binding of DNA to silica requires the presence of high salt concentration. We used NaCl rather than NaI (Geneclean II, BIO 101), guanidium thiocyanate (4), or sodium perchlorate (3) to facilitate DNA binding to silica. We tested varying concentrations of NaCl ranging from 1 to 4 M and found that 2 M and above allowed maximal binding. Importantly, use of NaCl instead of the chaotropic salts to promote DNA binding to silica offers the advantage that NaCl is inexpensive and the solution is
NOTES & TIPS
stable at room temperature. Moreover, when compared in parallel, NaCl coeluted the least quantity of bacterial RNA than NaI or guanidium thiocyanate. RE vary in efficiency to tolerate the level of impurities present in the mpDNA preparations. We used restriction analysis as a direct measure of purity of mpDNA isolated by TSM. We digested mpDNA with more than 10 RE at two different concentrations of the enzyme. Plasmid DNA isolated by standard alkaline lysis and 1% SDS/silica was also included for a comparison. Results obtained with three RE are shown (Fig. 1). All the enzymes efficiently digested mpDNA isolated by TSM at both the enzyme concentrations. Plasmid DNA extracted by SDS/silica, on the other hand, was not digested by any of the RE used. It is surprising that mpDNA isolated by SDS/silica was resistant to REdigestion because SDS and silica derivatives are the common constituents of some protocols reported previously (8, 10). Both of these reports used diatomaceous earth, which is of biological origin, in their protocols. It is possible that the DNA binding properties of this matrix is different from that of silica that we used. We also have additional evidence to show that it is possibly the residual SDS coeluting with the mpDNA that inhibited RE digestion. Reducing SDS concentration in solution 2 from 1 to 0.4% did not inhibit subsequent enzyme restriction. It is possible that because the concentration of SDS was a limiting factor here, probably all the SDS was precipitated by potassium acetate, leaving no residual SDS in solution to bind silica. Restriction of the mpDNA isolated by the standard alkaline lysis method varied depending on the enzyme used. While BamHI digested this preparation at both the enzyme concentrations, PstI restricted it only at higher concentration. KpnI, on the other hand, failed to restrict the mpDNA at either concentration. KpnI, however, digested the same mpDNA preparation following an additional phenol–chloroform extraction, indicating that it is possibly the presence of bacterial protein impurities that inhibited this enzyme. The purity of mpDNA prepared by TSM was compared further with that of standard alkaline lysis method. Plasmid DNA preparations were incubated with serial 10-fold dilutions of two RE (Fig. 2). Plasmid DNA prepared by alkaline lysis was restricted with HindIII and EcoRI at 10 and 1.0 units. Reducing the enzyme concentration further resulted in the failure of restriction. Plasmid DNA prepared by TSM, on the other hand, was restricted at much lower enzyme concentrations, up to 0.1 and 0.01 unit with EcoRI and HindIII, respectively. Plasmid DNA isolated by TSM is also amenable for manipulations using other enzymes such as Klenow, T4-ligase, Sequenase, and Taq DNA polymerase (not shown). The TSM also lends itself for scaleup. Although the results presented here were obtained with one strain of the bacterial host (DH5a) and one plasmid vector, pBC12/PL/SEAP (9), we obtained identical results with a few more bacterial hosts (DH-1, DH10b,
111
FIG. 2. Comparison of the purity of the mpDNA isolated using the Triton/silica method with that of alkaline lysis. 5 ml of the mpDNA was incubated with varying concentrations of HindIII (top) or EcoRI (bottom) for 1 h at 37°C. The concentration of the enzyme (units/ reaction) is shown at the top of the lanes. The following restriction patterns were expected after successful enzyme digestion: HindIII, linearization; EcoRI, 801 and 4425 bp. M, 1 kb.
XA3DII, and XL1-Blue) and a variety of plasmids that varied in size (3–13 kb). Here we report a simple and reproducible protocol for small-scale isolation of mpDNA from bacterial hosts. Silica matrix used is inexpensive and a 100-g quantity is sufficient to prepare approximately 56,000 individual minipreps. All the reagents used in this protocol are inexpensive and stable at room temperature. Elimination of organic extraction, RNase digestion, and alcohol precipitation, combined together, not only renders this protocol very rapid, but also highly economical. Using TSM, it is possible to prepare minipreps in half the time required for the standard alkaline lysis method. An added advantage of TSM is that only two sets of plastic vials are required per sample as opposed to four or more for standard alkaline lysis. Using this protocol it is possible to prepare superior-quality mpDNA in the labora-
112
NOTES & TIPS
tory on a routine basis without the need for a commercial kit or expensive/unstable/hazardous reagents. We believe that the Triton/silica protocol presented here is the simplest, quickest and the most economical of the several protocols reported previously to prepare good-quality mpDNA from bacterial cultures. Acknowledgments. We thank Professor CNR Rao, F.R.S., President, JNCASR for the financial support. R.L. is a recipient of the CSIR fellowship of the Government of India. The vector pBC12/PL/ SEAP is a kind gift from Dr. B. R. Cullen.
REFERENCES 1. Sambrook, J., Fritsch, E. F., and Manitis, T. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 2. Vogelstein, B., and Gillespie, D. (1979) Proc. Natl. Acad. Sci. USA 76, 615– 619. 3. Marko, M. A., Chipperfield, R., and Birnboim, H. C. (1982) Anal. Biochem. 121, 382–387. 4. Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Dillen, P. M. E. W., and van der Noordaa, J. (1990) J. Clin. Microbiol. 28, 495–503. 5. Boyle, J. S., and Lew, A. M. (1995) Trends Microbiol. 11, 8. 6. Thomson, J. M., and Compton, M. M. (1998) BioTechniques 24, 942. 7. Heyd, M. L., and Diehl, J. D., Jr. (1996) BioTechniques 20, 394 –398. 8. Carter, M. J., and Milton, I. D. (1993) Nucleic Acids Res. 21, 1044. 9. Cullen, B. R., and Malim, M. H. (1992) Methods Enzymol. 216, 362–368. 10. Hansen, N. J. V., Krinstensen, P., Lykke, J., Mortensen, K. K., and Clark, B. F. C. (1995) Biochem. Mol. Biol. Int. 35, 461– 465.
pUCP-Nco and pUCP-Nde: Escherichia–Pseudomonas Shuttle Vectors for Recombinant Protein Expression in Pseudomonas Ciara´n N. Cronin* ,† ,1 and William S. McIntire* ,† ,‡ *Molecular Biology Division, Department of Veterans Affairs Medical Center, San Francisco, California 94121; and †Department of Biochemistry and Biophysics and ‡Department of Anesthesia, University of California, San Francisco, California 94143 Received March 23, 1999
Although a great variety of plasmids and host genotypes have been developed for recombinant protein pro1 To whom correspondence should be addressed at Veterans Affairs Medical Center (151-S), 4150 Clement St., San Francisco, CA 94121. Fax: (415) 750-6959. E-mail: [email protected].
Analytical Biochemistry 272, 112–115 (1999) Article ID abio.1999.4160 0003-2697/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.
duction in Escherichia coli, few systems exist for similar purposes in other gram-negative bacteria. In the case of the nonenteric bacterium Pseudomonas aeruginosa, two notable systems, utilizing the pUCP/P. aeruginosa PAO1-LAC (1–3) and the pEB 14/P. aeruginosa ADD1976 (4, 5) combinations, have been developed that provide (a) a multiple cloning site in the expression vector for insertion of the gene of interest, and (b) inducible transcript synthesis and, therefore, regulated protein production. However, one feature that the above systems lack, but is common among E. coli expression systems, is the presence of a NcoI (C/CATGG) or NdeI (CA/TATG) restriction enzyme cloning site downstream of the promoter driving synthesis of the recombinant transcripts. Such sites are designed to encompass the translational start codon (ATG) of the gene to be expressed, and allow for the direct cloning into the expression vector without the introduction of extraneous 59 nucleotide sequences that might otherwise compromise protein production. For protein expression studies in Pseudomonas, the availability of such vectors would also facilitate the direct transfer of genes cloned previously into the NcoI and NdeI sites of E. coli expression plasmids. The present report describes the development of two such vectors, pUCP-Nco and pUCP-Nde (nucleotide sequences deposited in GenBank under Accession Nos. AF125994 and AF125995, respectively), by modification of the pUCP19 plasmid (1). Plasmids pUCP-Nco and pUCP-Nde were constructed as follows (E. coli strain DH5aF9IQ [Life Technologies, Inc.] was used for all routine cloning experiments): pUCP19 ([1]; ATCC 87110) was digested with NdeI/StuI, the NdeI terminus rendered “blunt-ended” by treatment with Klenow enzyme, and the vector was recircularized to generate pUCP19DNdeI–StuI. This manipulation served to remove the unique NdeI site and to reduce the size of the vector. Subsequently, the ATG translational start codon of the lacZa gene was placed within the context of a NcoI or NdeI restriction site by using oligonucleotide-directed mutagenesis according to the procedures of Deng and Nickoloff (6) as described previously (7). In conjunction with the selection primer oTransAfl3/Spe 1 (59-pCAGGAAAGAACTAGTGAGCAAAAG-39), the mutagenic primers opUCP-Nco (59-pGGCGTAATCATGGCCATGGCTGTTCCTGTGTG39) and opUCP-Nde (59-pGGCGTAATCATGGTCATATGTGTTTCCTGTGTG-39) were used, respectively, to introduce either the NcoI or NdeI site. The desired alterations surrounding the translational start codon of the lacZa gene were confirmed by restriction enzyme digestion and by DNA sequence analyses. The resulting plasmids were designated pUCP-Nco and pUCPNde, as appropriate, and were used to transform P. aeruginosa PAO1-LAC cells ([2]; ATCC 47085). Electroporation competent P. aeruginosa PAO1-LAC cells were prepared in a manner similar to that outlined in the manual accompanying the E. coli pulser
NOTES & TIPS
To date, we have used our modified assay to monitor changes in glutathione resulting from pharmacologic intervention of the HIV disease with N-acetylcysteine (6). We have also used this assay to investigate the redox changes in T cell subsets that occur in the course of HIV infection (manuscript in preparation). In these studies, T cells from uninfected individuals were sorted using fluorescence-activated cell sorting (FACS) to obtain pure populations of the various T cell subsets. The amount of glutathione present in the various purified populations of cells was then determined with our modified assay. A representative chromatogram from these analyses is shown in Fig. 3. We anticipate that the simplicity and general utility of this assay will lead to its wide use. Acknowledgment. These studies were supported by NIH Grant CA42509 to Leonard A. Herzenberg. FIG. 3. Representative chromatogram obtained from the analysis of the glutathione present within FACS sorted cells. Approximately 1 3 10 6 purified naı¨ve CD4 human T cells (CD4 1, CD45 1, CD62L 1) were FACS sorted, washed free of serum, and resuspended in 100 ml of 5% sulfosalicylic acid plus 50 mM DTT. The samples were then analyzed with our modified mBrB assay. The peak at 6.5 min. is the glutathione– bimane peak.
termination were smaller than the symbol designating the mean value of the determination. Results and Discussion We found that with our assay conditions, TCEP completely reduced the GSSG that was present within the samples to GSH. Furthermore, the presence of TCEP did not interfere with the labeling of GSH by mBrB nor with the detection of the glutathione– bimane product. This was true for samples consisting of either purified glutathione or acidified extracts of whole blood. As evidence for this, when samples possessing the same molar equivalents of glutathione in either the GSH or GSSG forms were assayed, the resultant fluorescent glutathione– bimane peaks were the same size (Table 1). Also, when GSSG standards with concentrations ranging between 6.125 and 800 mM in glutathione were assayed, a linear relationship was obtained between the concentration of glutathione in the sample and the size of glutathione– bimane peak measured (Fig. 1). This linear response was obtained regardless of the sample type, since the addition of defined amounts of GSSG to the acidified extracts of whole blood led to increases in the glutathione– bimane peak that were of the same area as that obtained when that amount of GSSG was assayed by itself (Table 1). Finally, we observed that the glutathione– bimane peaks could be unambiguously attributed and that they were well separated from other fluorescent entities that were generated (Fig. 2).
REFERENCES 1. Baeyens, W., VanderWeken, G., and DeMoerloose, P. (1987) Chromatographia 23, 717–721. 2. Fenton, S. S., and Fahey, R. C. (1986) Anal. Biochem. 154, 34 – 42. 3. Han, J. C., and Han, G. Y. (1994) Anal. Biochem. 220, 5–10. 4. Anderson, A., Isaksson, A., Brattstrom, L., and Hultberg, B. (1993) Clin. Chem. 39, 1590 –7. 5. Svardal, A. M., Mansoor, M. A., and Ueland, P. M. (1990) Anal. Biochem. 184, 338 – 46. 6. Herzenberg, L. A., De Rosa, S. C., Dubs, J. G., Roederer, M., Anderson, M. T., Ela, S. W., and Deresinski, S. C. (1997) Proc. Natl. Acad. Sci. USA 94, 1967–1972.
Extraction of Superior-Quality Plasmid DNA by a Combination of Modified Alkaline Lysis and Silica Matrix Ramakrishna Lakshmi, Vijaya Baskar, and Udaykumar Ranga 1 Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific Research, Jakkur, P.O. Box 6436, Bangalore 560 064, India Received December 31, 1998
Preparation of plasmid DNA from bacterial hosts on a smaller scale (mpDNA)2 is a basic requirement in molecular biology laboratories. Alkaline lysis of the bacterial cells is 1 To whom correspondence should be addressed. Fax: (80) 8462766. E-mail: [email protected]. 2 Abbreviations used: mpDNA, miniprep DNA; RE, restriction enzymes; TSM, Triton/silica method.
Analytical Biochemistry 271, 109 –112 (1999) Article ID abio.1999.4125 0003-2697/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.
110
NOTES & TIPS
FIG. 1. Comparison of the restriction enzyme patterns of mpDNA prepared by three different methods. 5 ml of mpDNA was incubated with 1.0 or 10 units (as shown at the top of the lanes) of the indicated enzyme at 37°C for 1 h. Following the incubation, the samples were resolved on a 1% agarose gel and stained with ethidium bromide. The following restriction patterns were expected after successful enzyme digestion: BamHI, 1695 and 3532 kb; KpnI, linearization; PstI, 1687, 1705, and 1834 bp. M, 1 kb ladder (GibcoBRL).
one of the most commonly used methods employed for this purpose (1). This method is simple and rapid; however, a few limitations are associated with this extraction procedure. Importantly, the quality of DNA extracted is often inadequate for subsequent molecular manipulations. Superior-quality mpDNA could be prepared using a number of commercial kits (Geneclean II, BIO 101; ion-exchange resins, Qiagen, etc.). However, the standard alkaline lysis protocol continues to be popular because the costs of the kits are unaffordable for routine use. Several reports employed silica (2–6) and its derivatives (7, 8) as principal matrices for preferential isolation of nucleic acids. The primary objective of these protocols was to purify DNA fragments from agarose gel. The potential of silica, however, has not been exploited for developing a similar inexpensive strategy for routine preparation of good-quality mpDNA. Here we present a simple and reproducible protocol for extracting mpDNA from bacterial cultures on a smaller scale for routine use in the laboratory. This protocol blends the simplicity of the alkaline lysis method with an important modification and the preferential binding of the silica matrix for nucleic acids. Cell pellets harvested from 1.5 ml of bacterial cultures grown overnight were lysed using alkaline lysis method as per the standard protocol (1). The samples were centrifuged at 10,000 rpm for 10 min and the supernatants were transferred to fresh vials. To each vial 450 ml of 5 M NaCl was added and mixed well. This was followed by the addition of 15 ml of silica suspension (6 g/50 ml). Silica (No. S 5631, Sigma) suspension was prepared as described previously with minor modifications (4). Following the addition of silica, the samples were agitated gently for 10 min and centrifuged at 10,000 rpm and the supernatants were decanted. Silica pellets were washed three times, each time with 250 ml of the wash solution
(60% ethanol, 10 mM Tris, pH 8.0, 100 mM NaCl, and 1 mM EDTA). Plasmid DNA bound to the silica matrix was eluted with 50 ml of autoclaved distilled water. Although mpDNA free of bacterial proteins or other impurities could be recovered by this method, the DNA was completely resistant to restriction (see below). We reasoned that SDS being negatively charged could bind the silica particles and coelute with the mpDNA. To test for this possibility, we replaced SDS with nonionic detergents such as Triton X-100 in solution 2. Plasmid DNA obtained with 1% Triton X-100 (No. 22686, Amersham) or IGEPAL CA-630 (No. I 3021, Sigma) was readily restricted with different restriction endonucleases (RE), whereas that of 1% SDS was not. Nonionic detergents lacking negative charge probably do not interact with the silica particles and are removed during the wash step. We tested different concentrations of Triton X-100 and found that Triton X-100 at 3% concentration or above completely lysed the bacterial cells. Based on these results we used 4% Triton X-100 in solution 2 of the optimized Triton/silica method (TSM). In addition, only trace levels of bacterial RNA were copurified with the mpDNA prepared by the TSM, obviating the need for RNase treatment. The presence of this RNA did not interfere with restriction of the mpDNA using several RE. IGEPAL CA-630 also appeared to function equally efficient. Binding of DNA to silica requires the presence of high salt concentration. We used NaCl rather than NaI (Geneclean II, BIO 101), guanidium thiocyanate (4), or sodium perchlorate (3) to facilitate DNA binding to silica. We tested varying concentrations of NaCl ranging from 1 to 4 M and found that 2 M and above allowed maximal binding. Importantly, use of NaCl instead of the chaotropic salts to promote DNA binding to silica offers the advantage that NaCl is inexpensive and the solution is
NOTES & TIPS
stable at room temperature. Moreover, when compared in parallel, NaCl coeluted the least quantity of bacterial RNA than NaI or guanidium thiocyanate. RE vary in efficiency to tolerate the level of impurities present in the mpDNA preparations. We used restriction analysis as a direct measure of purity of mpDNA isolated by TSM. We digested mpDNA with more than 10 RE at two different concentrations of the enzyme. Plasmid DNA isolated by standard alkaline lysis and 1% SDS/silica was also included for a comparison. Results obtained with three RE are shown (Fig. 1). All the enzymes efficiently digested mpDNA isolated by TSM at both the enzyme concentrations. Plasmid DNA extracted by SDS/silica, on the other hand, was not digested by any of the RE used. It is surprising that mpDNA isolated by SDS/silica was resistant to REdigestion because SDS and silica derivatives are the common constituents of some protocols reported previously (8, 10). Both of these reports used diatomaceous earth, which is of biological origin, in their protocols. It is possible that the DNA binding properties of this matrix is different from that of silica that we used. We also have additional evidence to show that it is possibly the residual SDS coeluting with the mpDNA that inhibited RE digestion. Reducing SDS concentration in solution 2 from 1 to 0.4% did not inhibit subsequent enzyme restriction. It is possible that because the concentration of SDS was a limiting factor here, probably all the SDS was precipitated by potassium acetate, leaving no residual SDS in solution to bind silica. Restriction of the mpDNA isolated by the standard alkaline lysis method varied depending on the enzyme used. While BamHI digested this preparation at both the enzyme concentrations, PstI restricted it only at higher concentration. KpnI, on the other hand, failed to restrict the mpDNA at either concentration. KpnI, however, digested the same mpDNA preparation following an additional phenol–chloroform extraction, indicating that it is possibly the presence of bacterial protein impurities that inhibited this enzyme. The purity of mpDNA prepared by TSM was compared further with that of standard alkaline lysis method. Plasmid DNA preparations were incubated with serial 10-fold dilutions of two RE (Fig. 2). Plasmid DNA prepared by alkaline lysis was restricted with HindIII and EcoRI at 10 and 1.0 units. Reducing the enzyme concentration further resulted in the failure of restriction. Plasmid DNA prepared by TSM, on the other hand, was restricted at much lower enzyme concentrations, up to 0.1 and 0.01 unit with EcoRI and HindIII, respectively. Plasmid DNA isolated by TSM is also amenable for manipulations using other enzymes such as Klenow, T4-ligase, Sequenase, and Taq DNA polymerase (not shown). The TSM also lends itself for scaleup. Although the results presented here were obtained with one strain of the bacterial host (DH5a) and one plasmid vector, pBC12/PL/SEAP (9), we obtained identical results with a few more bacterial hosts (DH-1, DH10b,
111
FIG. 2. Comparison of the purity of the mpDNA isolated using the Triton/silica method with that of alkaline lysis. 5 ml of the mpDNA was incubated with varying concentrations of HindIII (top) or EcoRI (bottom) for 1 h at 37°C. The concentration of the enzyme (units/ reaction) is shown at the top of the lanes. The following restriction patterns were expected after successful enzyme digestion: HindIII, linearization; EcoRI, 801 and 4425 bp. M, 1 kb.
XA3DII, and XL1-Blue) and a variety of plasmids that varied in size (3–13 kb). Here we report a simple and reproducible protocol for small-scale isolation of mpDNA from bacterial hosts. Silica matrix used is inexpensive and a 100-g quantity is sufficient to prepare approximately 56,000 individual minipreps. All the reagents used in this protocol are inexpensive and stable at room temperature. Elimination of organic extraction, RNase digestion, and alcohol precipitation, combined together, not only renders this protocol very rapid, but also highly economical. Using TSM, it is possible to prepare minipreps in half the time required for the standard alkaline lysis method. An added advantage of TSM is that only two sets of plastic vials are required per sample as opposed to four or more for standard alkaline lysis. Using this protocol it is possible to prepare superior-quality mpDNA in the labora-
112
NOTES & TIPS
tory on a routine basis without the need for a commercial kit or expensive/unstable/hazardous reagents. We believe that the Triton/silica protocol presented here is the simplest, quickest and the most economical of the several protocols reported previously to prepare good-quality mpDNA from bacterial cultures. Acknowledgments. We thank Professor CNR Rao, F.R.S., President, JNCASR for the financial support. R.L. is a recipient of the CSIR fellowship of the Government of India. The vector pBC12/PL/ SEAP is a kind gift from Dr. B. R. Cullen.
REFERENCES 1. Sambrook, J., Fritsch, E. F., and Manitis, T. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 2. Vogelstein, B., and Gillespie, D. (1979) Proc. Natl. Acad. Sci. USA 76, 615– 619. 3. Marko, M. A., Chipperfield, R., and Birnboim, H. C. (1982) Anal. Biochem. 121, 382–387. 4. Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Dillen, P. M. E. W., and van der Noordaa, J. (1990) J. Clin. Microbiol. 28, 495–503. 5. Boyle, J. S., and Lew, A. M. (1995) Trends Microbiol. 11, 8. 6. Thomson, J. M., and Compton, M. M. (1998) BioTechniques 24, 942. 7. Heyd, M. L., and Diehl, J. D., Jr. (1996) BioTechniques 20, 394 –398. 8. Carter, M. J., and Milton, I. D. (1993) Nucleic Acids Res. 21, 1044. 9. Cullen, B. R., and Malim, M. H. (1992) Methods Enzymol. 216, 362–368. 10. Hansen, N. J. V., Krinstensen, P., Lykke, J., Mortensen, K. K., and Clark, B. F. C. (1995) Biochem. Mol. Biol. Int. 35, 461– 465.
pUCP-Nco and pUCP-Nde: Escherichia–Pseudomonas Shuttle Vectors for Recombinant Protein Expression in Pseudomonas Ciara´n N. Cronin* ,† ,1 and William S. McIntire* ,† ,‡ *Molecular Biology Division, Department of Veterans Affairs Medical Center, San Francisco, California 94121; and †Department of Biochemistry and Biophysics and ‡Department of Anesthesia, University of California, San Francisco, California 94143 Received March 23, 1999
Although a great variety of plasmids and host genotypes have been developed for recombinant protein pro1 To whom correspondence should be addressed at Veterans Affairs Medical Center (151-S), 4150 Clement St., San Francisco, CA 94121. Fax: (415) 750-6959. E-mail: [email protected].
Analytical Biochemistry 272, 112–115 (1999) Article ID abio.1999.4160 0003-2697/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.
duction in Escherichia coli, few systems exist for similar purposes in other gram-negative bacteria. In the case of the nonenteric bacterium Pseudomonas aeruginosa, two notable systems, utilizing the pUCP/P. aeruginosa PAO1-LAC (1–3) and the pEB 14/P. aeruginosa ADD1976 (4, 5) combinations, have been developed that provide (a) a multiple cloning site in the expression vector for insertion of the gene of interest, and (b) inducible transcript synthesis and, therefore, regulated protein production. However, one feature that the above systems lack, but is common among E. coli expression systems, is the presence of a NcoI (C/CATGG) or NdeI (CA/TATG) restriction enzyme cloning site downstream of the promoter driving synthesis of the recombinant transcripts. Such sites are designed to encompass the translational start codon (ATG) of the gene to be expressed, and allow for the direct cloning into the expression vector without the introduction of extraneous 59 nucleotide sequences that might otherwise compromise protein production. For protein expression studies in Pseudomonas, the availability of such vectors would also facilitate the direct transfer of genes cloned previously into the NcoI and NdeI sites of E. coli expression plasmids. The present report describes the development of two such vectors, pUCP-Nco and pUCP-Nde (nucleotide sequences deposited in GenBank under Accession Nos. AF125994 and AF125995, respectively), by modification of the pUCP19 plasmid (1). Plasmids pUCP-Nco and pUCP-Nde were constructed as follows (E. coli strain DH5aF9IQ [Life Technologies, Inc.] was used for all routine cloning experiments): pUCP19 ([1]; ATCC 87110) was digested with NdeI/StuI, the NdeI terminus rendered “blunt-ended” by treatment with Klenow enzyme, and the vector was recircularized to generate pUCP19DNdeI–StuI. This manipulation served to remove the unique NdeI site and to reduce the size of the vector. Subsequently, the ATG translational start codon of the lacZa gene was placed within the context of a NcoI or NdeI restriction site by using oligonucleotide-directed mutagenesis according to the procedures of Deng and Nickoloff (6) as described previously (7). In conjunction with the selection primer oTransAfl3/Spe 1 (59-pCAGGAAAGAACTAGTGAGCAAAAG-39), the mutagenic primers opUCP-Nco (59-pGGCGTAATCATGGCCATGGCTGTTCCTGTGTG39) and opUCP-Nde (59-pGGCGTAATCATGGTCATATGTGTTTCCTGTGTG-39) were used, respectively, to introduce either the NcoI or NdeI site. The desired alterations surrounding the translational start codon of the lacZa gene were confirmed by restriction enzyme digestion and by DNA sequence analyses. The resulting plasmids were designated pUCP-Nco and pUCPNde, as appropriate, and were used to transform P. aeruginosa PAO1-LAC cells ([2]; ATCC 47085). Electroporation competent P. aeruginosa PAO1-LAC cells were prepared in a manner similar to that outlined in the manual accompanying the E. coli pulser