Extreme Intraspecific Mitochondrial DNA Sequence Divergence inGalaxias maculatus(Osteichthys: Galaxiidae), One of the World's Most Widespread Freshwater Fish

Molecular Phylogenetics and Evolution Vol. 11, No. 1, February, pp. 1–12, 1999 Article ID mpev.1998.0554, available online at http://www.idealibrary.com on

Extreme Intraspecific Mitochondrial DNA Sequence Divergence in Galaxias maculatus (Osteichthys: Galaxiidae), One of the World’s Most Widespread Freshwater Fish Jonathan M. Waters*,† and Christopher P. Burridge* *Department of Zoology, University of Tasmania, GPO Box 252-05, Hobart, Tasmania 7001, Australia; and †Department of Zoology, University of Otago, PO Box 56, New Zealand Received June 19, 1997; revised March 6, 1998

return to rivers the migrating whitebait of this species constitute an important freshwater fishery. Biogeographers have variously explained the Gondwanan distribution of the galaxiids (in general) in terms of either dispersal or vicariance. The widespread G. maculatus is a microcosm of this controversy. McDowall (1970, 1978) hypothesized that the galaxiids achieved their current distribution by means of oceanic dispersal. He argued that Australia, with 20 species, is the origin of the group; other areas were sequentially colonized with the aid of the west wind drift. Thus New Zealand (16 species), South America (4 species), and South Africa (1 species) represent a ‘‘chain of dispersal.’’ This theory is in keeping with the Darwinian ‘‘center of origin’’ concept. In contrast, vicariance theorists (Rosen, 1974, 1978; Croizat et al., 1974; Craw, 1979) supported an ancient Gondwanan origin in place of the dispersal hypothesis. Rosen (1974, 1978) disputed McDowall’s claim that the similarity of isolated populations of G. maculatus reflects recent dispersal. Instead, he argued that slow rate of morphological evolution in this species has prevented significant differentiation throughout 70 million years of isolation. Craw (1979) pointed to the similarity of fossil galaxiids and extant species as evidence of such phenotypic stability. Croizat et al. (1974) considered dispersal theories to be generally inapplicable in historical biogeography and rejected the Darwinian center of origin theory. Vicariance theorists apparently view vicariance and dispersal as incompatible alternatives. McDowall (1990) maintained that dispersal has played a major role in galaxiid biogeography but conceded that the fragmentation of Gondwanaland may also have influenced galaxiid distribution. The taxonomic status of freshwater fish populations is often a complex issue. As noted by McDowall (1972), geographically and genetically isolated populations are not necessarily reproductively isolated. Taxonomic decisions are further complicated by the sympatric occurrence of distinct but closely related genetic types (e.g., Watts et al., 1995; Allibone et al., 1996). With its wide

Biogeographic controversies surrounding the widespread freshwater fish, Galaxias maculatus, were addressed with DNA sequence data. Mitochondrial cytochrome b and 16S rRNA sequences were obtained from representatives of six populations of this species. Substantial levels of cytochrome b (maximum 14.6%) and 16S rRNA sequence divergence (maximum 6.0%) were detected between western Pacific (Tasmania–New Zealand) and South American (Chile–Falkland Islands) haplotypes. A considerable level of divergence was also detected between Tasmanian and New Zealand haplotypes (maximum 5.1%) and within and among Chilean and Falkland Island G. maculatus (maximum 3.8%). The phylogenetic structure of haplotypes conflicts with the accepted pattern of continental fragmentation. Molecular clock calibrations suggest that haplotype divergences postdate the fragmentation of Gondwana. These findings point to marine dispersal rather than ancient vicariance as an explanation for the wide distribution. The phylogenetic structure of South American haplotypes was not consistent with their geographic distribution. We consider factors such as population divergence, population size, dispersal, secondary contact, and philopatry as potential causes of the high level of mtDNA nucleotide diversity in this species. r 1999 Academic Press

INTRODUCTION Galaxias maculatus is one of the world’s most widespread freshwater fishes. The range of this species includes Australia, New Zealand, South America, and also Lord Howe Island, the Chatham Islands, and the Falkland Islands (Fig. 1). Although considered a freshwater species, G. maculatus is more correctly termed ‘‘diadromous’’ or ‘‘catadromous’’ as it breeds in estuaries and has a juvenile ‘‘whitebait’’ stage that may stay at sea for over 6 months (McDowall et al., 1994). In fact, juveniles have been collected as far as 700 km from continental land (McDowall et al., 1975). During their 1

1055-7903/99 $30.00 Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

2

WATERS AND BURRIDGE

FIG. 1. Range and collection sites of Galaxias maculatus: The range of the species is indicated by thickened and dotted coastline, while the collection sites for this study are identified numerically: 1, Sandy Bay Rivulet (Tasmania; 42°538S, 147°208W); 2, Waimakariri River (New Zealand; 43°258S, 172°398E); 3, Laguna Saval (Chile; 39°508S, 73°118W); 4, Lago Rinihue (Chile; 39°488S, 72°228W); 5, Shallow Harbour (West Falkland; 51°468S, 60°318W); 6, Saunders Island (Falkland Islands; 51°228S, 60°058W).

but disjunct distribution, and sympatric ‘‘diadromous’’ and ‘‘landlocked’’ types, G. maculatus typifies the problems inherent in the taxonomy of freshwater species. As many as 18 described species (e.g., G. alpinus, G. attenuatus, G. parrishi, and G. usitatus) were synonymized as G. maculatus by McDowall (1967, 1971, 1972). He regarded different diadromous populations as nearly indistinguishable. While McDowall (1972) did recognize that morphologically distinct landlocked populations occur throughout much of the range of G. maculatus, he interpreted their morphological differences as being a consequence of ecological rather than genetic variation. McDowall regarded only a few lacustrine populations from New Zealand’s North Island (G. gracilis) as worthy of separate specific status. Barker and Lambert (1988) detected no significant allozyme differentiation among populations of G. maculatus from the Bay of Plenty in New Zealand. Similarly,

Berra et al. (1996) reported very little allozyme divergence among G. maculatus populations from Western Australia, New South Wales, New Zealand, and Chile. Berra et al. (1996) concluded that trans-Pacific gene flow is ongoing. In contrast, Pavuk (1994) found significant allozyme differentiation among western Australian, eastern Australian, and New Zealand populations of G. maculatus. Given the controversies surrounding the biogeography (and taxonomy) of G. maculatus, the aim of this study was to examine the mitochondrial DNA variation across the range of this species. The mitochondrial genome evolves quickly and without recombination. Rate heterogeneity among the different types of genes makes mtDNA useful for reconstructing both recent and more ancient evolutionary events (Avise, 1994). Molecular clocks were used to discriminate between alternative biogeographic hypotheses.

3

MITOCHONDRIAL DNA PHYLOGEOGRAPHY OF Galaxias maculatus

MATERIALS AND METHODS Samples of G. maculatus were obtained from six locations, representing the trans-Pacific range of the species (Fig. 1). Specimens were collected with hand nets or an electrofishing apparatus and placed in 70% ethanol. Total DNA was extracted using the method outlined in Waters and Cambray (1997). A 424-bp section of the adjacent mitochondrial tRNA (glutamine) and cytochrome b genes was amplified with the oligonucleotide primers L14724 (58 CGAAGCTTGATGAAAAACCATCGTTG 38; Pa¨a¨bo, 1990) and H15149 (58 CCCTCAGAATGATATTTGTCCTCA 38; Kocher et al., 1989). In addition, an approximately 550-bp fragment of the mitochondrial 16S rRNA gene was amplified from all specimens using the universal primers 16Sar (58 CGCCTGTTTATCAAAAACAT 38) and 16Sbr (58 CCGGTCTGAACTCAGATCACGT 38) from Palumbi et al. (1991). Double-stranded PCR amplifications and DNA sequencing were carried out as in Waters and Cambray (1997). Alignments of the 16S rRNA sequences were performed with CLUSTAL W (Thompson et al., 1994). Pairwise sequence divergences were calculated using the maximum-likelihood model of nucleotide sequence evolution that was implemented in the DNADIST program of PHYLIP version 3.57c (Felsenstein, 1995). Phylogenetic analyses were conducted with the inclusion of sequences (GenBank Accession Nos. AF022092 and AF022100) from diadromous Tasmanian Galaxias truttaceus as outgroups. Phylogenetic trees were constructed with neighbor-joining (PHYLIP) and maximum-parsimony (PAUP 3.1; Swofford, 1993) algorithms. The most parsimonious cladogram was recovered with the exhaustive search option. Phylogenetic confidence was estimated by bootstrapping (Felsenstein, 1985) with 1000 replicate data sets. In the phylogenetic analyses, all nucleotide sites and substitution classes were weighted equally; alternative weighting schemes were also trialed. Tests for clock-like behavior of cytochrome b and 16S rRNA were performed with the programs DNAML and DNAMLK

(PHYLIP). The DNAMLK program operates under the constraints of a molecular clock hypothesis while the DNAML algorithm does not assume a molecular clock. If the log likelihood produced by the former program is significantly larger than that produced by the latter, the molecular clock may be rejected (Felsenstein, 1995). RESULTS Cytochrome b A substantial level of intraspecific cytochrome b diversity was detected between nine G. maculatus haplotypes (Appendix 1). Pairwise divergences ranged from 0.3% (a single substitution) between West Falkland haplotype 1 and Laguna Saval haplotype 1 (Chile) sequences to 14.6% (54 observed substitutions) between those from Tasmania and Saunders Island (Table 1). Parsimony and neighbor-joining analyses recovered an identical tree topology (Fig. 2a); alternative weighting schemes recovered the same topology with only minor differences in bootstrap confidence. Two highly distinct clades, representing the western Pacific and South America, were well supported by bootstrapping. Western Pacific (Tasmania–New Zealand) haplotypes differed from South American (Chile–Falklands) haplotypes by a mean of 13.5% sequence divergence. The Tasmanian haplotype differed from the seven South American sequences by a mean of 14.1% (range 13.2–14.6%). The New Zealand haplotype differed from the South American haplotypes by a mean of 12.8% (range 12.3–13.7%) and differed from the Tasmanian haplotype by 5.1% (Table 1). A considerable amount of nucleotide diversity was detected within the South American region. The three Chilean haplotypes differed by a mean of 3.3% (range 2.5–3.8%) while four Falkland Island haplotypes differed by a mean of 2.2% (range 0.8–3.3%). A similar magnitude of sequence divergence was detected between Chilean and Falkland haplotypes (mean 2.4%; range 0.3–3.6%). Divergences among pairs of haplo-

TABLE 1 Number of Nucleotide Substitutions and Percentage Sequence Divergence (Maximum Likelihood, in parentheses) between Galaxias maculatus Cytochrome b (below Diagonal) and 16S rRNA (above, Diagonal) Sequences Haplotype

Tasmania

New Zealand

Chile (Sav)

Chile (Rin)

W. Falkland

Saunders Island

Tasmania New Zealand Chile (Saval 1) Chile (Rinihue) West Falkland 1 Saunders Island 1

— 20 (5.1) 53 (14.3) 53 (14.3) 51 (13.9) 54 (14.6)

22 (4.4) — 49 (13.1) 51 (13.7) 47 (12.7) 48 (12.9)

27 (5.4) 27 (5.4) — 15 (3.8) 1 (0.3) 14 (3.6)

23 (4.6) 24 (4.8) 6 (1.2) — 14 (3.6) 7 (1.8)

28 (5.6) 30 (6.0) 3 (0.6) 7 (1.4) — 13 (3.3)

23 (4.6) 24 (4.8) 6 (1.2) 0 (0.0) 7 (1.4) —

4

WATERS AND BURRIDGE

15,098–15,100, Appendix 1) is replaced by an isoleucine residue in the Tasmanian and New Zealand haplotypes, and valine is replaced by leucine in Lago Rinihue and Laguna Saval haplotype 2 (positions 15, 140–15, 142, Appendix 1). Of the observed pairwise substitutions, 83% were transitions (TIs) while 17% were transversions (TVs), representing an observed TI bias of approximately 5:1. 16S rRNA A considerable level of 16S rRNA diversity was detected between G. maculatus samples (Appendix 2). Variation was detected at 39 (7.5%) of the nucleotide sites. Pairwise divergences ranged from 0.0% (identical sequences) from Lago Rinihue and Saunders Island to 6.0% (30 observed substitutions) between the New Zealand and the West Falkland sequences (Table 1). Parsimony and neighbor-joining analyses recovered a single tree topology (Fig. 2b), which was in turn identical to that recovered from cytochrome b analysis (Fig. 2a). Again, the sequences were grouped into two distinct and well-supported clades, representing the western Pacific and South America. Western Pacific (Tasmania–New Zealand) haplotypes differed from South American (Chile–Falklands) haplotypes by a mean of 5.2% (range 4.6–6.0%) sequence divergence (Table 1). Within South America, two clades received strong bootstrap support, each containing haplotypes from Chile and the Falkland Islands (Fig. 2b). A single deletion event was inferred in the Tasmanian sequence. Of the observed pairwise substitutions, 65% were TIs while 35% were TVs, representing an observed TI bias of approximately 2:1. FIG. 2. Neighbor-joining phenograms of the relationships between Galaxias maculatus haplotypes. The numbers at each node represent bootstrap proportions based on 1000 replications for both the neighbor-joining (above branch) and the maximum-parsimony (below branch) analyses. The three trees represent the analysis of the cytochrome b (a), 16S rRNA (b), and combined cytochrome b and 16S rRNA (c) sequences. The trees produced by parsimony analysis were identical in topology to the corresponding neighbor-joining trees.

types within sites ranged from 0.8% (between Saunders Island haplotypes) to 3.6% (between Laguna Saval haplotypes). While Chilean and Falkland haplotypes exhibited strong phylogenetic structure, this structure was not concordant with geographic distribution. In fact, representatives of divergent mtDNA clades were present in both regions (Fig. 2a). In total, 69 (17%) of the nucleotide sites varied, 63 of which represented third codon positions, while 5 variations and 1 variation were observed at first and second positions, respectively. Three variations in the amino acid sequence of G. maculatus cytochrome b are inferred from the sequences. Specifically, a methionine residue (nucleotide positions 15,032–15,034, Appendix 1) is replaced by a threonine residue in the Saunders Island haplotype, a valine residue (nucleotide positions

Combined mtDNA Genes The separate analysis of the mitochondrial gene sequences produced completely congruent trees, reflecting their complete linkage associated with haploid maternal inheritance. Analysis of the combined sequence data (921 bp) reinforced this congruence with an identical tree topology and very high bootstrap values for all nodes (Fig. 2c). Combined analysis of the data recovered a most parsimonious tree 221 steps long. This length was identical to the sum of the shortest tree lengths recovered by separate analysis of the cytochrome b and 16S rRNA data sets (127 and 94 steps, respectively). Thus the combined analysis forced no additional steps on the shortest tree length, indicating 100% congruence of the two data sets. Molecular Clock Tests for clock-like evolution of the 16S rRNA and cytochrome b sequences, performed with the omission of G. trattuceus, indicated that the molecular-clock hypothesis could not be rejected for either gene. In each case the log likelihood of the DNAML tree was not significantly larger than that of the equivalent DNAML tree. Specifically, comparison of DNAML and DNAMLK

MITOCHONDRIAL DNA PHYLOGEOGRAPHY OF Galaxias maculatus

log likelihoods for cytochrome b yielded ␹2 ⫽ 3.7 (4 degrees of freedom) and P ⬎ 0.10, and the same comparison for 16S rRNA yielded ␹2 ⫽ 9.1 (4 degrees of freedom) and P ⬎ 0.10. Thus the use of molecular clock calibrations to estimate haplotype divergence times appears to be statistically valid. DISCUSSION The results indicate a number of key points. First, substantial divergence (maximum 14.6%) was detected among haplotypes in G. maculatus for both cytochrome b and 16S rRNA sequences. This was particularly evident from comparisons between western Pacific (Tasmania–New Zealand) and South American (Chile– Falklands) haplotypes. In addition, considerable genetic divergence was observed among haplotypes within both of these geographical regions. Finally, phylogenetic relationships of divergent haplotypes in Chile and the Falkland Islands were not concordant with their geographic distribution. Mitochondrial or Paralogous Genes? Nuclear integrations of mitochondrial genes, while rare, are documented and have the potential to confound phylogeographic studies (Zhang and Hewitt, 1996). Nonetheless, we are confident that the G. maculatus sequences represent authentic mitochondrial genes rather than nuclear paralogues. There are several lines of evidence (albeit circumstantial) that support this contention. First and foremost, the cytochrome b and 16S rRNA gene trees are completely congruent (Fig. 2), presumably reflecting their complete linkage. Such congruence would be unlikely if paralogous copies of either gene were sequenced (Doyle, 1992). Second, mtDNA evolves considerably more rapidly than nuclear DNA (Brown et al., 1982). Thus the finding that both gene sequences exhibit clock-like behavior argues against the presence of any such paralogues. It is well established that eukaryote mtDNA and nuclear DNA exhibit different amino acid coding properties and that nuclear insertions show less marked transition and codon-position biases than mitochondrial genes (Zhang and Hewitt, 1996). However, the translated cytochrome b amino acid sequences all exhibit a high level of identity with one another and with other published fish mitochondrial cytochrome b sequences. Such amino acid conservation would be unlikely if any of the sequences represented nuclear paralogues. Furthermore, the vast majority of substitutions observed in G. maculatus cytochrome b involve transitions at third positions, as would be expected for mtDNA. Finally, mtDNA is characterized by a higher GC content than nuclear DNA. Given the likelihood that nuclear paralogues would exhibit relatively low GC contents, the lack of major variation in GC content

5

(data not shown) indicates that the sequences are probably all mitochondrial. Intraspecific Diversity Estimates of sequence divergence between the western Pacific and the South American G. maculatus cytochrome b averaged 13.5% (range 12.8–14.6%). These intraspecific divergences are high in comparison with those detected between some quite morphologically distinct galaxiid species (Waters, unpublished data). They even approach the intergeneric divergence between Mallotus and Osmerus (about 15%; Taylor and Dodson, 1994). The lower 16S rRNA sequence divergences between western Pacific and South American G. maculatus (mean 5.2%; range 4.6–6.0%) reflect constraints on 16S rRNA (Xiong and Kocher, 1993). Regardless, these levels of intraspecific divergence exceed some interspecific 16S rRNA divergences within the Galaxiidae (Waters, unpublished data). Cytochrome b and 16S rRNA sequence divergences seldom exceed a few percent within fish species. Aside from the Galaxiidae, the 3% divergence reported in Gasterosteus aculeatus (Orti et al., 1994) is the highest intraspecific value published for fish cytochrome b. Higher divergence estimates (up to 8.7%) have been reported in mtDNA RFLP studies of isolated fish populations (Bermingham and Avise, 1986; Ovenden et al., 1988), but it should be noted that these RFLP analyses sampled the entire mitochondrial genome, including regions much more variable than cytochrome b and 16S rRNA. Until the present study, the 13.8% cytochrome b divergence found between isolates of Galaxias zebratus was apparently the highest value yet reported in any organism for this gene (Waters and Cambray, 1997). The presence of substantial mtDNA sequence variation within Chilean and Falkland samples is consistent with the findings of a recent study of mtDNA variation in G. maculatus from New Zealand (Dijkstra, personal communication). Specifically, partial sequences from the control region indicate the presence of a number of highly divergent mitochondrial lineages in New Zealand. While the divergent lineages show strong cladistic structure, this structure is not correlated with geographic distribution (Dijkstra, unpublished data). In contrast, the same study indicates that Tasmanian and New Zealand populations are highly divergent. The unusually high levels of mtDNA diversity within G. maculatus may be interpreted in a number of ways. The very large divergence (up to 14.6%) between western Pacific and South American haplotypes may simply reflect ancient population divergence coupled with morphological stability. Large mtDNA divergences have similarly been detected in morphologically ‘‘conserved’’ taxa such as horseshoe crabs (Avise et al., 1994) and turtles (Walker et al., 1997). An alternative explanation for the high divergence is that gene flow may be facilitated by male dispersal, while female G. macula-

6

WATERS AND BURRIDGE

tus may be strongly philopatric (faithful to their river of origin). Such a scenario would lead to the divergence of maternally inherited mtDNA, without any associated divergence in nuclear DNA or morphology (see references in Avise, 1994). However, there is no evidence for such gender-biased dispersal in this species. While divergences between western Pacific and South American haplotypes are unusually high, the large divergences (maximum 3.8%) between geographically proximal haplotypes (within and among Chile and the Falkland Islands) are even more unexpected and may require a more complex explanation. One possibility is that the high levels of intraspecific diversity could be explained by unusually rapid rates of mtDNA evolution, but this is unlikely given the lack of mtDNA divergence between populations of other galaxiid species that have probably been isolated since the last ice age (Waters and Cambray, 1997). In fact, molecular clock calibrations of phylogenetic separations within the Galaxiidae seem to be concordant with known geological events (Waters and White, 1997). Species with large evolutionary effective population sizes are thought to harbor higher levels of genetic diversity than species with historically low or unstable population sizes (Avise, 1994). For instance, shallow divergences within sardine (Sardinops) populations probably reflect the unstable or ephemeral population sizes associated with these fish (Bowen and Grant, 1997). High levels of mtDNA diversity may, therefore, indicate that G. maculatus is an ancient lineage that has historically maintained very large population sizes, preventing lineage extinction and allowing the gradual accumulation of mtDNA diversity. A final possibility is that current phylogenetic (but not geographic) structuring of divergent lineages reflects historical population divergence that has been eroded with subsequent gene flow. Genetic interchange may have occurred between landlocked and diadromous populations. Indeed, there is a possible zone of overlap between landlocked and diadromous populations in the Chilean Rio Calle Calle (McDowall, 1976). Alternatively, changes in climatic or oceanographic conditions may have resulted in increased dispersal and mixing of isolated populations. Bernatchez (1997) reported evidence of such secondary contact between distinct glacial races of rainbow smelt (Osmerus mordax). However, these latter hypotheses (large populations/secondary contact) are not mutually exclusive. For instance, high levels of mtDNA diversity may reflect a combination of the effects of large and stable population sizes, the loss of diadromy, historical vicariance, and sporadic dispersal. Population Differentiation Pavuk (1994) detected significant allozyme differentiation between western Australian and several western Pacific populations of G. maculatus. She concluded

that the western Australian gene pool is isolated from that of eastern Australian and New Zealand populations. In contrast, Berra et al. (1996) reported no significant population differentiation across the entire range of G. maculatus. The low genetic distance reported between populations from eastern and western Australia conflicts with the findings of Pavuk (1994). However, the allele frequencies reported in Berra et al. (1996) showed significant deviation from Hardy– Weinberg expectations. This may indicate the action of selection on allozyme loci, assortative mating, Wahlund effects, or the possible presence of null alleles. The findings of Dijkstra (see above) lend support to the conclusion of Pavuk (1994) but conflict with the findings of Berra et al. (1996). Similarly, the high divergences we report between Tasmanian and New Zealand haplotypes, and between western Pacific and South American haplotypes, lend tentative support to the suggestion of population differentiation. However, the sample sizes of the current study are insufficient for any strong conclusions on population structuring across the range of G. maculatus. Biogeography and Molecular Clock Calibrations Australia and New Zealand separated about 80 million years ago (mya) and have been separated by at least 1200 km since 60 mya (Cooper and Milliner, 1993). Australia began to break away from Antarctica around 53–55 mya. However, the distance between southern Australia and Antarctica remained very small for much of the subsequent period. In biogeographical terms, Australia and South America remained virtually connected by Antarctica until less than 40 mya (see Veevers et al., 1991). Ocean temperatures were relatively warm until 30 mya when the opening of the strait between Australia and Antarctica was great enough to allow an unimpeded circumpolar current to develop (Veevers, 1991). In the current study, estimated timings of haplotype separations (Table 2) are based on the molecular clock TABLE 2 Estimated Divergence Times for Evolutionary Separations Within Galaxias maculatus Phylogenetic separation

Cyt. b mtDNA Cyt. b divergence divergence 0.8–2.8%/my

mtDNA 0.5–0.9%/my

West Pacific– East Pacific 12.3–14.6% 8.2–9.2% 4.4–18.3 mya 9.1–18.4 mya Tasmania– New Zealand 5.1% 4.7% 1.8–6.4 mya 5.3–9.4 mya Note. Two molecular clock calibrations are used: (a) 0.8–2.8% divergence per million years for fish mtDNA protein coding genes (Orti et al., 1994; Taylor and Dodson, 1994; McKay et al., 1996). (b) 0.5–0.9% mtDNA divergence per million years (Salmonid; Martin and Palumbi, 1993). Cytochrome b estimates are based on 402 bp of sequence; overall mtDNA estimates are based on 921 bp of sequence (combined cytochrome b and 16S rRNA).

MITOCHONDRIAL DNA PHYLOGEOGRAPHY OF Galaxias maculatus

calibrations of other workers (Martin and Palumbi, 1993; Orti et al., 1994; McKay et al., 1996; see Table 2). Clock calibrations suggest that western Pacific and South American G. maculatus haplotypes may have diverged 4.4–18.4 mya. This estimated divergence time postdates the currently accepted timing of the South America–Australia vicariance by at least 10 million years. Thus, it seems that oceanic dispersal is the most likely explanation for the wide distribution of G. maculatus. Nevertheless, the dispersal powers of this species may be more limited than has been suggested by Berra et al. (1996) and others. Similarly, the level of genetic divergence between the Tasmanian and the New Zealand haplotypes points to a considerable period (1.8–9.4 million years; Table 2) since their separation. However, the estimated divergence time again postdates continental separation, pointing to dispersal rather than vicariance. The finding that the phylogenetic structure of haplotypes conflicts with the accepted pattern of continental fragmentation provides further evidence against vicariance. Marine dispersal is becoming increasingly accepted as a major factor in the origin of New Zealand’s biota. For example, mtDNA sequences indicate that the transTasman distribution of the galaxiid genus Neochanna is probably due to marine dispersal during the Pliocene (Waters and White, 1997). There is further evidence for

7

dispersal across the Tasman Sea in the presence of several diadromous fish species on both continents, including a new record of the Australian long-finned eel (Anguilla reinhardtii) in New Zealand (Jellyman et al., 1996). Conclusions and Directions for Future Research The findings of the current study raise a number of intriguing questions regarding the present and historical population biology of G. maculatus. While dispersal has clearly played an important role in the biogeography of G. maculatus, the presence of highly divergent haplotypes within and among locations indicates that the evolution of this species may be far more complex than originally thought. More specifically, the findings indicate the need for a large and comprehensive study of the genetic make-up of G. maculatus populations. While localized studies have yielded valuable information regarding the population genetics of a few selected populations (Barker and Lambert, 1988; Pavuk, 1994; Dijkstra personal communication), no study has adequately addressed the stock structure of the species as a whole or the genetic significance of landlocking. Large samples should be acquired from across the range of the species and analyzed with both mitochondrial and nuclear genetic markers.

8

WATERS AND BURRIDGE

APPENDIX 1 Partial Sequences of the Mitochondrial Cytochrome b Gene (402 bp) of Galaxias maculatus A . . . . . . . .

Met T G . . . . . . . . . . . . . . . .

Ala C C . . . . . . . . . . . . . . . .

A . . . . . . . .

Asn A T . . . . . . . . . . . . . . . .

C . . . . . . . .

Leu T A . . . . . . . . . . . . . . . .

C . . . . . . . .

Arg G A . . . . . . . . . . . . . . . .

A . . . . . . . .

Lys A G . . . . . . . . . . . . . . . .

A . . . . . . . .

Thr C C . . . . . . . . . . . . . . . .

C . . . . . . . .

His A C . . . . . . . . . . . . . . . .

C . . . . . . . .

Pro C C . . . T . T . T . T . T . T . T

C . . . . . . . .

Leu T A . . . . . G . . . G . . . . . .

C . . . . . . . .

Leu T A . . . . . . . . . . . . . . . .

A . . . . . . . .

Lys A A . . . . . . . . . . . . . . . .

A . . . . . . . .

Ile T . . . . . . . .

C . . . . . . . .

G . . . . . . . .

Ala C . . . . . . . .

C . . . . . . . .

A . . . . . . . .

Asn A C 45 . . . T . T . T . T . T . T . T

Tasmania New Zealand Lago Rinihue Laguna Saval 1 Laguna Saval 2 West Falkland 1 West Falkland 2 Saunders Island 1 Saunders Island 2

G . . . . . . . .

Gly G C . . . . . . . . . . . . . . . .

G . . . . . . . .

Ala C G . . . . . . . . . . . . . . . .

C . . . . . . . .

Leu T T . . . . . . . . . . . . . . . .

G . . . . . . . .

Val T . . . . . . . .

T C . . . . . . .

G . . . . . . . .

Asp A C . . . . . . . . . . . . . . . .

C . . . . . . . .

Leu T G . . . . . . . . . . . . . . . .

C . . . . . . . .

Pro C A . G . G . G . . . G . G . G . G

G . . . . . . . .

Ala C . . . . . . . .

C . . . . . . . .

C . . . . . . . .

Pro C C . . . T . T . T . T . T . T . T

T . . . . . . . .

Ser C A . . . . . G . . . . . G . . . .

A . . . . . . . .

Asn A C . . . . . . . . . . . . . . . .

A . . . . . . . .

Ile T . . . . . . . .

C . . . . . . . .

T . . . . . . . .

Ser C . . . . . . . .

A . . . . . . . .

G . . . . . . . .

Val T . . . . . . . .

C . . . . . . . .

T . . . . . . . .

Trp G A 90 . . . G . . . . . . . . . . . .

Tasmania New Zealand Lago Rinihue Laguna Saval 1 Laguna Saval 2 West Falkland 1 West Falkland 2 Saunders Island 1 Saunders Island 2

T . . . . . . . .

Trp G . . . . . . . .

A . . . . . . . .

A . . . . . . . .

Asn A C . . . . . . . . . . . . . . . .

T . . . . . . . .

Phe T C . . . . . . . . . . . . . . . .

G . . . . . . . .

Gly G . . . . . . . .

A . . . . . . . .

T . . . . . . . .

Ser C . . . . . . . .

T . C C C C C C C

C . . . . . . . .

Leu T C . . . A . G . A . G . G . A . A

C . . . . . . . .

Leu T T . . . C . C . . . C . C . C . C

G . . . . . . . .

Gly G C . . . . . . . . . . . . . . . .

C . . . . . . . .

Leu T T . . . . . . . . . . . . . . . .

T . . . . . . . .

Cys G C . . . . . . . . . . . . . . . .

T . . . . . . . .

Leu T G . . . . . . . . . . . . . . . .

G . . . . . . . .

Ala C T . . . C . C . C . C . C . C . C

A . . . . . . . .

Ser G . . . . . . . .

C T T T T T T T T

C . . . . . . . .

Gln A G . . . . . . . . . . . . . A . .

A . . . . . . . .

Ile T . . . . . . . .

Tasmania New Zealand Lago Rinihue Laguna Saval 1 Laguna Saval 2 West Falkland 1 West Falkland 2 Saunders Island 1 Saunders Island 2

C . . . . . . . .

Leu T T . . . . . . . . . . . . . . . .

A . . . . . . . .

Thr C G . A . A . . . A . . . . . A . A

G . . . . . . . .

Gly G A . . . G . . . G . . . . . G . G

C . . . . . . . .

Leu T T . C . G . G . G . G . G . G . G

T . . . . . . . .

Phe T T . . . C . C . C . C . C . C . C

C . . . . . . . .

Leu T T . . . . . . . . . . . . . . . .

G . . . . . . . .

Ala C . . . . . . . .

T . . . . . . . .

A . . . . . . . .

Met T A . G . . . G . G . G . G . G . G

C . . . . . . . .

His A C . . . . . . . . . . . . . . . .

T . . . . . . . .

Tyr A T . . . C . C . C . C . C . C . C

A . . . . . . . .

Thr C T . . . C . C . C . C . C . C . C

T . . . . . . . .

Ser C . . . . . . . .

T . . . . . . . .

G . . . . . . . .

Asp A T . . . C . C . C . C . C . C . C

A . . . . . . . .

Ile T . . . . . . . .

C . T T T T T T T

T . . . . . . . .

Ser C T 180 . . . C . C . C . C . C . C . C

Tasmania New Zealand Lago Rinihue Laguna Saval 1 Laguna Saval 2 West Falkland 1 West Falkland 2 Saunders Island 1 Saunders Island 2

A . . . . . . . .

Thr C T . . . C . C . C . C . C . C . C

G . . . . . . . .

Ala C A . . . G . G . G . G . G . . . G

T . . . . . . . .

Phe T T . . . C . C . C . C . C . C . C

T . . . . . . . .

Ser C . . . . . . . .

T . . . . . . . .

Ser C A . . . . . G . . . G . G . . . .

G . . . . . . . .

Val T C . . . T . T . T . T . T . T . T

Thr C A . . . C . C . C . C . C . C . C

C . . . . . . . .

His A C . . . . . . . . . . . . . . . .

A . . . . . . . .

Ile T . . . . . . . .

T . . . . . . . .

Cys G T . C . . . . . . . . . . . . . .

C . . . . . . . .

Arg G A . G . G . G . G . G . G . G . G

G . . . . . . . .

Asp A T . . . C . C . C . C . C . C . C

G . . . . . . . .

Val T . . . . . . . .

A . . . . . . . .

Ser G . . . . . . . .

C . . . . . . . .

T . . . . . . . .

Tyr A C 225 . . . . . . . . . . . . . . . .

G . . . . . . . . 14,750

Tasmania New Zealand Lago Rinihue Laguna Saval 1 Laguna Saval 2 West Falkland 1 West Falkland 2 Saunders Island 1 Saunders Island 2

14,800 C 135 . . . . . . . .

14,850 14,900

T . . C . C C . .

A . . . . . . . .

C . . . . . . . .

A . C C C C C C C

14,950

9

MITOCHONDRIAL DNA PHYLOGEOGRAPHY OF Galaxias maculatus

APPENDIX 1—Continued

G . . . . . . . .

Gly G C . . . . . . . . . . . . . . . .

T . . . . . . . .

Trp G A . G . G . G . G . G . G . G . G

T . . . . . . . .

Leu T G . . . . . . . . . . . . . . . .

A . . . . . . . .

Ile T . . . . . . . .

C . . . . . . . .

C . . . . . . . .

Arg G G . . . . . T . . . T . . . . . .

A . . . . . . . .

Asn A C . . . . . . . . . . . . . . . .

A . . . . . . . .

Met T G . . . . . . . . . . . . . . . .

C . . . . . . . .

His A C . . . . . . . . . . . . . . . .

G . . . . . . . .

Ala C T . C . C . C . C . C . C . C . C

A . . . . . . . .

Asn A C . . . . . . . . . . . . . . . .

G . . . . . . . .

Gly G A . . . G . G . G . G . G . G . G

G . . . . . . . .

Aln C A . . . . . . . . . . . . . . . .

T . . . . . . . .

Ser C T . . . . . . . . . . . . . . . .

T . . . . . . . .

Phe T C . T . T . T . T . T . T . T . T

T . . . . . . . .

Phe T T 270 . C . C . C . C . C . C . C . C

Tasmania New Zealand Lago Rinihue Laguna Saval 1 Laguna Saval 2 West Falkland 1 West Falkland 2 Saunders Island 1 Saunders Island 2

T . . . . . . . .

Phe T C . . . . . . . . . . . . . . . .

A . . . . . . . .

Ile T . . . . . . . .

C T . . . . . . .

T . . . . . . . .

Cys G T . . . . . . . . . . . . . . . .

A . . . . . . . .

Ile T . . . . . . . .

T . . . . . . . .

T . . . . . . . .

Tyr A T . . . . . . . . . . . . . . . .

Met* A T G . . . . . A . . . . . . . . . . . A . C A . . A

C . . . . . . . .

His A C . . . . . . . . . . . . . . . .

A . . . . . . . .

Ile T . . . . . . . .

C . . . . . . . .

G . . . . . . . .

Gly G G . . . A . A . A . A . A . A . A

C . . . . . . . .

Arg G A . . . . . . . . . ? . . . . . .

G . . . . ? . ? .

Gly G T . . . G . G . G . G . G . G . G

T . C C C C C C C

Leu T G . . . . . . . . . . . . . . . .

T . . . . . . . .

Tyr A C . . . . . . . . . . . . . . . .

T . . . . . . . .

Tyr A T . . . C . C . C . C . C . C . C

G . . . . . . . .

Gly G C 315 . . . . . . . . . . . . . . . .

Tasmania New Zealand Lago Rinihue Laguna Saval 1 Laguna Saval 2 West Falkland 1 West Falkland 2 Saunders Island 1 Saunders Island 2

T . . . . . . . .

Ser C T . . . C . C . C . C . C . C . C

T . . . . . . . .

Tyr A T . . . . . . . . . . . . . . . .

C T . . . . . . .

Leu T G . . . C . C . C . C . C . C . C

T . . . . . . . .

Tyr A C . . . T . T . T . T . T . T . T

A . . . . . . . .

Lys A A . G . G . G . G . G . G . G . G

G . . . . . . . .

Glu A G . . . . . . . . . ? . . . . . .

A . . . . . . . .

Thr C C . . . . . . . . . . . . . . . .

T . . . . . . . .

Trp G A . . . . . . . . . . . . . . . .

A . . . G . . . .

Thr C C . . . . . . . . . . . . . . . .

A . . . . . . . .

Ile T . . . . . . . .

C T . . . . . . .

G . . . . . . . .

Gly G A . G . G . G . G . G . G . G . G

G . . . . . . . .

Val T A . G . . . G . C . G . G . G . G

A . G G G G G G G

Ile* T T . . . C . C . C . ? . C . C . C

C . . . . . . . .

Leu T C . . . A . A . A . A . A . A . A

C . . . . . . . .

Leu T C 360 . . . . . . . . . . . . . . . .

Tasmania New Zealand Lago Rinihue Laguna Saval 1 Laguna Saval 2 West Falkland 1 West Falkland 2 Saunders Island 1 Saunders Island 2

C . T . . . . T T

Leu T C . . . A . A . A . A . A . A . A

C . . . . . . . .

Leu T T . C . . . . . . . . . . . . . .

G . . . . . . . .

Val T . . . . . . . .

A . . . . . . . .

Met T G . . . A . . . . . . . . . A . A

A . . . . . . . .

Met T G . . . . . . . . . . . . . . . .

A . . . . . . . .

Thr C C . . . T . T . T . T . T . T . T

G . . . . . . . .

Ala C T . . . . . . . . . . . . . . . .

T . . . . . . . .

Phe T T . . . C . C . C . C . C . C . C

G . . . . . . . .

Val T . . . . . . . .

G . . . . . . . .

Gly G G . . . . . . . . . . . . . . . .

T . . . . . . . .

Tyr A C . . . . . . . . . . . . . . . .

G . C . C . ? . .

Val* T T . . . C . C . . . C . . . C . C

C . . . . . . . .

Leu T C . . . . . . . . . . . . . . . .

C . . . . . . . .

Pro C C . . . . . . . . . . . . . . . .

15,000

Tasmania New Zealand Lago Rinihue Laguna Saval 1 Laguna Saval 2 West Falkland 1 West Falkland 2 Saunders Island 1 Saunders Island 2

15,050 15,100

C A T T T T T T T

T . . . . . . . .

402

15,148

Note. Sequences are of the light (noncoding) strand recorded in the 58 to 38 direction, numbered relative to the corresponding positions within human mtDNA. Dots indicate nucleotide identity with the reference Tasmanian G. maculatus sequence. The amino acid coding equivalent is listed above each codon, with those residues that differ among individuals distinguished by asterisks. In such instances, the residue listed corresponds to that observed in the majority of individuals. These sequences are available from GenBank under Accession Nos. AF007024–AF007028 and AF0049465–AF0049467.

10

WATERS AND BURRIDGE

APPENDIX 2 Partial Sequences of the Mitochondrial 16S rRNA Gene (519 bp) of Galaxias maculatus Tasmania New Zealand Lago Rinihue Laguna Saval West Falkland Saunders Island

C . . . . .

C . . . . .

T G C C T G C C C T G T G A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

C T A T . . . . . . . . . . . . . . . . . . . .

G A A A A A

A . T T T T

G . . . . .

T T T A A . . . . . . . . . . . . . . . . . . . . . . . . .

C G G . . . . . . . . . . . . . . .

C C G C G G . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

T A T T T . . . . . . . . . . . . . . . . . . . . . . . . .

G . . . . .

A . . . . .

C . . . . .

C . . . . .

G . . . . .

T G . . . . . . . . . .

50

A . . . . .

T . . . . .

G . . . . .

A . . . . .

A . . . . .

T G G . . . . . . . . . . . . . . .

A A T . . . . . . . . . . . . . . .

T . . . . .

G . . . . .

A . . . . .

T C T C C 150 . . . . . . . . . . . . . . . . . . . . . . . . .

C C C T . . . . . . . . . . . . . . . . . . . .

A . . . . .

T G G . . . . . . . . . . . . . . .

A . . . . .

G . . . . .

C T 200 . . . . . . . . . .

G C . . . .

2550

2539

T . . . . .

C . . . . .

A . . . . .

A . . . . .

A . . . . .

G . . . . .

G . . . . .

T A G . . . . . . . . . . . . . . .

C G C A A . . . . . . . . . . . . . . . . . . . . . . . . .

Tasmania New Zealand Lago Rinihue Laguna Saval West Falkland Saunders Island

A . . . . .

A . . . . .

G . . . . .

A . . . . .

C G A . . . . . . . . . . . . . . .

G . . . . .

G . . . . .

G . . . . .

C T A A . . . . . . . . . . . . . . . . . . . .

Tasmania New Zealand Lago Rinihue Laguna Saval West Falkland Saunders Island

C . . . . .

C . . . . .

G . . . . .

T G C A G . . . . . . . . . . . . . . . . . . . . . . . . .

A . . . . .

A . . . . .

G . . . . .

Tasmania New Zealand Lago Rinihue Laguna Saval West Falkand Saunders Island

T T A G . . . . . . . . . . . . . . . . . . . .

Tasmania New Zealand Lago Rinihue Laguna Saval West Falkland Saunders Island

T A G . . . . . . . . A . . A . . .

T G G C A . . . . G . . . G . . . . G . . . . G . . . . G .

Tasmania New Zealand Lago Rinihue Laguna Saval West Falkland Saunders Island

G T . A A .

A . . . . .

C . A A A A

A . . . . .

Tasmania New Zealand Lago Rinihue Laguna Saval West Falkland Saunders Island

C . . . . .

A . T T T T

C T C T A A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

T C A C . . . . . . . . . . . . . . . . . . . .

T T G T C T T T T A A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

A . . . . .

T G A . . . . . . . . . . . . . . .

A . . . . .

G . . . A .

A . . . . .

C C C G — . . . . T . . . . T . . . . T . . . . T . . . . T

C 100 . . . . .

2600

Tasmania New Zealand Lago Rinihue Laguna Saval West Falkland Saunders Island

C T G T C T C C T T C T C C A A G . . . . . . . . . . . . . . . G . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

G . . . . .

G . . . . .

A . . . . .

G . . . . .

A . . . . .

C C A . . . . . . . . . . . . . . .

T C A G . . . . . . . . . . . . . . . . . . . .

T G A . . . . . . . . . . . . . . .

2650

G . . . . .

C G G . . . . . . . . . . . . . . .

T . . . . .

T . C C C C

C . A A A A

C C T C A T A A . . . . . . . . . . C . . . . . . . C . . . . . . . C . . . . . . . C . . . . .

G . . . . .

A . . . . .

C G A . . . . . . . . . . . . . . .

G . . . . .

A . . . . .

A . . . . .

G . . . . .

A . . . . .

2700

A . . . . .

C G C T A G . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

G . . . . .

A . . . . .

A . . . . .

T G T T A A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

A . . . . .

C A A . . . . . G . . G . . G . . G

C C C C T T G . . . T . . C . . . . . C C . . . . . C C . . . . . C C . . . . . C C

T G C G G G A . . . A . . G . . . . . . G . . . . . . .G . . . . . . . . . . . . . G

G . . . . .

A . . . . .

A . . . . .

C T 250 . . . . . . . . . .

C C G C G G G G . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

G . . . . .

A . . . . .

A . . . . .

A . . . . .

2740

A . T T T T

C . A A A A

C T A T C T T G A . . . . . C . A . . . . . . C . . . . . . . . C . . . . . . . . C . . . . . . . . C . . .

T G T C T T C G . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

G . . . . .

G . . . . .

T T G G . . . . . . . . . . . . . . . . . . . .

G . . . . .

G . . . . .

C G A . . . . . . . . . . . . . . .

A 300 . . G G .

2810

C . . . . .

G . . . . .

C C C C C A T G T G G . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

A C C C C C

C . . . . .

G . . . . .

G . . . . .

A . . . . .

G A A A A A

G T T T T T

A . . . . .

A . . . . .

A C T T T T

T A C T C C T A G . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

A . . . . .

A . . . . .

T T C T G A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

C . . . . .

C . . . . .

A . . . . .

G A . . . .

G A A A A A

A . . . . .

G . . . . .

C T A . . . . . . . . G . . G . . .

A G A G . . G . . . G . . . G . . . G . . . G .

T T A C 350 . . . . . . . . . . . . . . . . . . . .

2860

A . . . . .

G . . . . .

C A A . . . . . . . . . . . . . . .

C A G . . . . . . . . . . . . . . .

A . . . . .

A G . G . .

T G A . . . C . . C . . C . . C . .

T C C G G . . . . . . . . . . . . . . . . . . . . . . . . .

C A T A G . . . G . . . . . . . . . . . . . . . . . . . . .

C C G A . . . . . . . . . . . . . . . . . . . .

T C A 400 . . . . . . . . . . . . . . . . . . .

2900

11

MITOCHONDRIAL DNA PHYLOGEOGRAPHY OF Galaxias maculatus

APPENDIX 2—Continued T . . . . .

A . . . . .

A . . . . .

C . . . . .

A . . . . .

G C G C A A T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

C . . . . .

C C C T C C . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Tasmania T A T C G A C G A G G G G G T T T A C G A C New Zealand . . . . . . . . . . . . . . . . . . . . . . Lago Rinihue . . . . . . . . . . . . . . . . . . . . . . Laguna Saval . . . . . . . . . . . . . . . . . . . . . . West Falkland . . . . . . . . . . . . . . . . . . . . . . Saunders Island . . . . . . . . . . . . . . . . . . . . . .

C . . . . .

T . . . . .

C G A . . . . . . . . . . . . . . .

T G T T G G A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

T C A G G A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

C . . . . .

A . . . . .

G . . . . .

A . . . . .

G . . . A .

T . . . . .

C . . . . .

C C 450 . G . . . . . . . .

A . . . . .

T C C T A A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

T G 500 . . . . . . . . . .

2950

Tasmania A C G G A C C C A G T T A C C C T A G G G A New Zealand . . . . . . . . . . . . . . . . . . . . . . Lago Rinihue . . . . . . . . . . . . . . . . . . . . . . Laguna Saval . . . . . . . . . . . . . . . . . . . . . . West Falkland . . . . . . . . . . . . . . . . . . . . . . Saunders Island . . . . . . . . . . . . . . . . . . . . . .

C . . . . .

3000

Tasmania G T G T A G C C G C T A T T A A New Zealand . . . C . . . . . . . . . . . . Lago Rinihue . . . C . . . . . . . . . . . . Laguna Saval . . . C . . . . . . . . . . . . West Falkland . . . C . . . . . . . . . . . . Saunders Island . . . C . . . . . . . . . . . .

G G G . . . . . . . . . . . . . . .

519

3032

Note. Sequences are of the light (noncoding) strand recorded in the 58 to 38 direction, with numbers below the sequences corresponding to the homologous positions within human mtDNA. Dots indicate nucleotide identity with the reference Tasmanian G. maculatus sequence. The only insertion is indicated by a dash. These sequences are available from GenBank under Accession Nos. AF007029 to AF007034.

ACKNOWLEDGMENTS We thank Lucette Dijkstra, Bob McDowall, and Conor Nolan for kindly providing specimens for this study. We are grateful to R. Arriagada for collecting Chilean material and to R. Maddocks and M. Marsh for collecting specimens from the Falklands. We are also grateful to Jeremy Austin, Alan Dumphy, Bronwyn Innes, Robert White, and Kit Williams for providing technical assistance. Bob McDowall, Graham Wallis, and two anonymous reviewers provided comments that improved the manuscript. Funding for this study was provided by a departmental funding allocation from the University of Tasmania and two Australian Postgraduate Awards.

REFERENCES Allibone, R. M., Crowl, T. A., Holmes, J. M., King, T. M., McDowall, R. M., Townsend, C. R., and Wallis, G. P. (1996). Isozyme analysis of Galaxias species (Teleostei: Galaxiidae) from the Taieri River, South Island, New Zealand: A species complex revealed. Biol. J. Linn. Soc. 57: 107–127. Avise, J. C. (1994). ‘‘Molecular Markers, Natural History and Evolution,’’ Chapman and Hall, New York. Avise, J. C., Nelsom, W. S., and Sugita, H. (1994). A speciational history of ‘‘living fossils’’: Molecular evolutionary patterns in horseshoe crabs. Evolution 48: 1986–2001. Barker, J. R., and Lambert, D. M. (1988). A genetic analysis of populations of Galaxias maculatus from the Bay of Plenty: Implications for natal river return. N. Z. J. Mar. Freshw. Res. 22: 321–326. Bermingham, E., and Avise, J. C. (1986). Molecular zoogeography of freshwater fishes in the southeastern United States. Genetics 113: 939–965. Bernatchez, L. (1997). Mitochondrial DNA analysis confirms the existence of two glacial races of rainbow smelt Osmerus mordax and their reproductive isolation in the St. Lawrence River estuary (Quebec, Canada). Mol. Ecol. 6: 73–83. Berra, T. M., Crowley, L. E. L. M., Ivantsoff,W., and Fuerst, P. A.

(1996). Galaxias maculatus: An explanation of its biogeography. Mar. Freshw. Res. 47: 845–849. Bowen, B. W., and Grant, W. S. (1997). Phylogeography of the sardines (Sardinops spp.): Assessing biogeographic models and population histories in temperate upwelling zones. Evolution 51: 1601–1610. Brown, W. M., Prager, E. M., Wang, A., and Wilson, A. C. (1982). Mitochondrial DNA sequences of primates: Tempo and mode of evolution. J. Mol. Evol. 18: 225–239. Cooper, R. A., and Milliner, P. R. (1993). The New Zealand biota: Historical background and new research. Trends. Ecol. Evol. 8: 429–433. Craw, R. C. (1979). Generalised tracks and dispersal in biogeography: A response to R. M. McDowall. Syst. Zool. 28: 99–107. Croizat, L., Nelson, G. J., and Rosen, D. E. (1974). Centers of origin and related concepts.Syst. Zool. 23: 265–287. Doyle, J. J. (1992). Gene trees and species trees: Molecular systematics as one-character taxonomy. Syst. Bot. 17: 144–163. Felsenstein, J. (1985). Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39: 783–791. Felsenstein, J. (1995). ‘‘PHYLIP (Phylogeny Inference Package), version 3.57c.’’ Department of Genetics, University of Washington, Seattle. Jellyman, D. J., Chisnall, B. L., Dijkstra, L. H., and Boubee, J. A. T. (1996). First record of the Australian long-finned eel, Anguilla reinhardtii, in New Zealand. Mar. Freshw. Res. 47: 1037–1040. Kocher, T. D., Thomas, W. K., Meyer, A., Edwards, S. V., Pa¨a¨bo, S., Villablanca, F. X., and Wilson, A. C. (1989). Dynamics of mitochondrial DNA evolution in animals: Amplification and sequencing with conserved primers. Proc. Natl. Acad. Sci. USA 86: 6196–6200. Martin, A. P., and Palumbi, S. R. (1993). Body size, metabolic rate, generation time, and the molecular clock. Proc. Natl. Acad. Sci. USA 90: 4087–4091. McDowall, R. M. (1967). Some points of confusion in galaxiid nomenclature. Copeia 1967: 841–843.

12

WATERS AND BURRIDGE

McDowall, R. M. (1970). The galaxiid fishes of New Zealand. Bull. Mus. Comp. Zool. Harv. 139: 341–432. McDowall, R. M. (1971). The galaxiid fishes of South America. Zool. J. Linn. Soc. 50: 33–73. McDowall, R. M. (1972). The species problem in freshwater fishes and the taxonomy of diadromous and lacustrine populations of Galaxias maculatus (Jenyns). J. R. Soc. N. Z. 2: 325–367. McDowall, R. M. (1976). The taxonomic status of the Galaxias populations in the Rio Calle Calle, Chile (Pisces: Galaxiidae). Stud. Neotrop. Faun. Env. 11: 173–177. McDowall, R. M. (1978). Generalised tracks and dispersal in biogeography. Syst. Zool. 27: 88–104. McDowall, R. M. (1990). ‘‘New Zealand Freshwater Fishes—A Natural History and Guide,’’ Heinemann, Auckland. McDowall, R. M., Mitchell, C. P., and Brothers, E. B. (1994). Age at migration from the sea of juvenile Galaxias in New Zealand (Pisces: Galaxiidae). Bull. Mar. Sci. 54: 385–402. McDowall, R. M., Robertson, D. A., and Saito, R. (1975). Occurrence of galaxiid larvae and juveniles in the sea. N. Z. J. Mar. Freshw. Res. 9: 1–11. McKay, S. J., Devlin, R. H., and Smith, M. J. (1996). Phylogeny of Pacific salmon and trout based on growth hormone type-2 and mitochondrial NADH dehydrogenase subunit 3 DNA sequences. Can. J. Fish. Ag. Sci. 53: 1165–1176. Orti, G., Bell, M. A., Reimchen, T. E., and Meyer, A. (1994). Global survey of mitochondrial DNA sequences in the threespine stickleback: Evidence for recent migrations. Evolution 48: 608–622. Ovenden, J. R., White, R. W. G., and Sanger, A. C. (1988). Evolutionary relationships of Gadopsis spp. inferred from restriction enzyme analysis of their mitochondrial DNA. J. Fish Biol. 32: 137–148. Pa¨a¨bo, S. (1990). ‘‘Amplifying Ancient DNA.’’ Academic Press, San Diego. Palumbi, S. R., Martin, A. P., Romano, S., McMillan, W. O., Stice, L., and Grabowski, G. (1991). ‘‘The Simple Fool’s Guide to PCR, Version 2.0.’’ Published and distributed by the authors, Honolulu, HI. Pavuk, N. C. (1994). ‘‘Population Genetics of Selected Whitebait Species: Galaxias maculatus (Jenyns) and Lovettia sealii (Johnston),’’ University of Tasmania, Australia (unpublished thesis). Rosen, D. E. (1974). Phylogeny and zoogeography of salmoniform

fishes and relationships of Lepidogalaxias salamandroides. Bull. Am. Mus. Nat. Hist. 153: 265–326. Rosen, D. E. (1978). Vicariant patterns and historical explanation in biogeography. Syst. Biol. 27: 159–188. Swofford, D. L. (1993). ‘‘PAUP 3.1.1; Phylogenetic Analysis Using Parsimony,’’ Illinois Natural History Survey, Champaign, IL. Taylor, E. B., and Dodson, J. J. (1994). A molecular analysis of relationships and biogeography within a species complex of Holarctic fish (genus Osmerus). Mol. Ecol. 3: 235–248. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994). Clustal W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrice choice. Nuc. Acids Res. 22: 4673–4680. Veevers, J. J. (1991). Phanerozoic Australia in the changing configuration of proto-Pangea through Gondwanaland and Pangea to the present dispersed continents. Aust. Syst. Bot. 4: 1–11. Veevers, J. J., Powell, C. M., and Roots, S. R. (1991). Review of seafloor spreading around Australia. I. Synthesis of the patterns of spreading. Aust. J. Earth Sci. 38: 373–389. Walker, D., Nelson, W. S., Buhlmann, K. A., and Avise, J. C. (1997). Mitochondrial DNA phylogeography and subspecies issues in the monotypic freshwater turtle Sernotherus odoratus. Copeia 1997: 16–21. Waters, J. M., and Cambray, J. A. (1997). Intraspecific phylogeography of the Cape galaxias from South Africa: Evidence from mitochondrial DNA sequences. J. Fish Biol. 50: 1329–1338. Waters, J. M., and White, R. W. G. (1997). Molecular phylogeny and biogeography of the Tasmanian and New Zealand mudfishes (Salmoniformes: Galaxiidae). Aust. J. Zool. 45: 39–48. Watts, R. J., Storey, A. W., Hebbert, D. R., and Edward, D. H. D. (1995). Genetic and morphological differences between populations of the western minnow, Galaxias occidentalis, from two river systems in south-western Australia. Mar. Freshw. Res. 46: 769–777. Xiong, B., and Kocher, T. D. (1993). Phylogeny of sibling species of Simulium venustrum and S. verecundum (Diptera: Simuliidae) based on sequences of the mitochondrial 16S rRNA gene. Mol. Phylogenet. Evol. 2: 293–303. Zhang, D.-X., and Hewitt, G. M. (1996). Nuclear integrations: Challenges for mitochondrial DNA markers. Trends Ecol. Evol. 11: 247–251.