Ezrin interacts with L-periaxin by the “head to head and tail to tail” mode and influences the location of L-periaxin in Schwann cell RSC96

Journal Pre-proof Ezrin interacts with L-periaxin by the “head to head and tail to tail” mode and influences the location of L-periaxin in Schwann cell RSC96

Tao Guo, Lei Zhang, Hong Xiao, Yan Yang, Yawei Shi PII:

S0304-4165(20)30010-6

DOI:

https://doi.org/10.1016/j.bbagen.2020.129520

Reference:

BBAGEN 129520

To appear in:

BBA - General Subjects

Received date:

15 June 2019

Revised date:

31 December 2019

Accepted date:

9 January 2020

Please cite this article as: T. Guo, L. Zhang, H. Xiao, et al., Ezrin interacts with Lperiaxin by the “head to head and tail to tail” mode and influences the location of Lperiaxin in Schwann cell RSC96, BBA - General Subjects(2020), https://doi.org/10.1016/ j.bbagen.2020.129520

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2020 Published by Elsevier.

Journal Pre-proof Ezrin interacts with L-periaxin by the "head to head and tail to tail" mode and influences the location of L-periaxin in Schwann cell RSC96

*

Tao Guo1#, Lei Zhang1,2#, Hong Xiao3, Yan Yang4, Yawei Shi1

1. Key Laboratory of Chemical Biology and Molecular Engineering, Ministry of Education, China； Institute of Biotechnology, Shanxi University, Taiyuan 030006, China; 2. Institute of Clinical Medicine and Department of Cardiology, Renmin hospital, Hubei University of

of

Medicine, Shiyan 442000, China;

ro

3. Department of Pathology, The First Affiliated Hospital, Shanxi Medical University, Taiyuan 030001,

-p

China;

4. Chemical and Biological Engineering College, Taiyuan University of Science and Technology,

re

Taiyuan 030006, China

These authors have contributed equally to this work.

*

Corresponding author: Yawei Shi, Institute of Biotechnology, Shanxi University, Taiyuan, Shanxi

lP

#

Tel: +86-0351-7018268

na

030006, China

Jo ur

Email address: [email protected]

Journal Pre-proof Abstract In the peripheral nervous system (PNS), Schwann cells (SCs) are required for the myelination of axons. Periaxin (PRX), one of the myelination proteins expressed in SCs, is critical for the normal development and maintenance of PNS. As a member of the ERM (ezrin-radxin-moesin) protein family, ezrin holds our attention since their link to the formation of the nodes of Ranvier. Furthermore, PRX and ezrin are co-expressed in cytoskeletal complexes with periplakin and desmoyokin in lens fiber cells. In the present study, we observed that L-periaxin and ezrin interacted in a "head to head and tail to tail" mode in SC RSC96 through NLS3 region of L-periaxin with F3 subdomain of ezrin interaction, and the

of

region of L-periaxin (residues 1368-1461) with ezrin (residues 475-557) interaction. A

ro

phosphorylation-mimicking mutation of ezrin resulted in L-periaxin accumulation on SC RSC96

-p

membrane. Ezrin could inhibit the self-association of L-periaxin, and ezrin overexpression in sciatic nerve injury rats could facilitate the repair of impaired myelin sheath. Therefore, the interaction

lP

participate in myelin sheath maintenance.

re

between L-periaxin and ezrin may adopt a close form to complete protein accumulation and to

Jo ur

na

Key words: Schwann cells, L-periaxin, Ezrin, interaction, myelination

Journal Pre-proof 1. Introduction In the peripheral nervous system (PNS), Schwann cells (SCs) are the main glial cells contributing to the formation of the myelin sheath that is in tight contact with axons and allows the rapid conduction of electrical impulses. The interaction between SCs and axons is critical to the biology and functionality of PNS. SCs play an important role in the development of PNS [1] and the regeneration of injured peripheral nerves [2]. The function of SCs is more complex in different phases because it includes many factors and is involved in intracellular signal pathways [3]. Periaxin (PRX) is an abundant protein of myelinating SCs that is expressed in PNS with

of

specificity, participating in the formation of myelin with other unique proteins, such as myelin protein

ro

zero, myelin basic protein, and peripheral myelin protein-22 kD [4, 5]. The mutation or loss of PRX

-p

causes myelin sheath damage and peripheral neuropathies, such as Charcot–Marie–Tooth disease 4F or Dejerine–Sottas disease [6, 7]. The prx gene encodes two isoforms: L-PRX with 1461 residues and

re

S-PRX with 147 residues. L-PRX contains a PSD-95/Discs Large/ZO-1 (PDZ) domain, a basic nuclear localization signal (NLS) region, a long repeat domain, and a C-terminal acidic domain (Fig. 1A) [8].

lP

Compared with the canonical PDZ domains, which normally fold into 6 β strands and 2 α helices，

na

the PRX PDZ domain displays 5 major β strands and 2 α helices in one monomer and exhibits a dimerization mode with extensive three-dimensional domain swapping in an intertwined manner [4].

Jo ur

Our previous study showed that L-PRX and S-PRX can interact with each other though their PDZ domains, and S-PRX may regulate the function of L-PRX in SCs [9]. The NLS region of L-PRX belongs to an unusual tripartite type that includes NLS1 (residues 118–139), NLS2 (residues 162–175), and NLS3 (residues 183–194) [10]. The NLS region can effectively regulate the location of L-PRX in the nuclear of embryonic SCs in vivo [11]. The self-association of L-PRX is attributed to the binding between the NLS region and the C-terminus domain [12]. NLS2 and NLS3 are involved in the interaction between L-PRX and dystrophin-related protein 2 (DRP2) to mediate the formation of Cajal bands in SCs [13]. However, the function of the repeat domain remains unclear. In addition to adjusting the self-association of L-PRX, forming and stabilizing Cajal bands are also mediated by the C-terminus domain [6]. The recent report showed that β4 integrin was identified as a binder for the L-PRX C-terminal domain. The PRX-β4 integrin is likely to be important in myelination [14]. Ezrin is a member of the ERM (ezrin-radxin-moesin) family of proteins, which function as membrane–cytoskeleton linkers [15]. Ezrin participates in many cellular processes, including cell

Journal Pre-proof survival, proliferation, adhesion, and migration under physiological conditions, and is involved in the regulation of cancer invasion and metastasis [16]. Ezrin consists of three domains: an N-terminal FERM [band Four-point-one (4.1) ERM] domain (~300 amino acids), a helical domain (~160 amino acids), and a C-terminal actin-binding domain (~100 amino acids, Fig. 1B) [17]. The N-terminal FERM domain comprises a cloverleaf-like structure with three subdomains (F1, F2, and F3) and plays a key role in interacting with plasma membrane-bound proteins, such as CD43, CD44, and CD95, and a set of adhesion molecules [18]. The FERM domain is the conserved structure among all members of the ERM family. The C-terminal of ezrin contains an F-actin-binding domain to promote F-actin

of

organization [19]. The combination of the C- and N-terminal domains puts ezrin in an inactive state

ro

and masks both of the membrane- and actin-binding sites, leading to the cytoplasmic localization of

-p

ezrin. By contrast, the inactive ezrin can be activated by interacting with phospholipid phosphatidylinositol 4,5-bisphosphate (PIP2) and phosphorylating Thr567 [17, 20].

re

The efficient local activation of ERM proteins is necessary for the formation of the nodes of

lP

Ranvier [21, 22]. Moreover, ezrin and L-PRX are also co-expressed in lens fiber cells as members of cytoskeletal complexes to maintain correct lens structure [23, 24]. These observations increase the

na

possibility that ERM proteins may play an important role in myelination and myelin maintenance. In the present study, the interaction mode between L-PRX and ezrin was investigated.

Jo ur

Characterizing the interaction between L-PRX and ezrin may clarify the molecular events involved in the maintenance of PNS.

2. Materials and methods

2.1. Plasmid construction and ezrin short hairpin RNA (shRNA) adenoviral vector L-PRX amplified from L-PRX cDNA (Homo sapiens, AB046840.1) was cloned into a pCMV-Tag3B expression vector with EcoRI and SalI and then sequenced (BGI, China). Ezrin amplified from Ezrin cDNA (Homo sapiens, BC013903.2) was cloned into a pGEX-6p-1 expression vector with EcoRI and SalI and then sequenced (BGI, China). A similar strategy was performed to generate c-Myc-tagged L-PRX (1-200), L-PRX (194-1059), and L-PRX (1060-1461); Flag-tagged ezrin (1-296), ezrin (297-474), ezrin (475-585), F1 (1-94), F2 (95-200), and F3 (202-296); and EGFP fusion constructs with L-PRX (1060-1367), L-PRX (1368-1461), PDZ (1-102), PDZ-NLS1 (1-102,

Journal Pre-proof 118-139), PDZ-NLS2 (1-102, 162-175), and PDZ-NLS3 (1-102, 183-194). Normal pCMV-Tag2B-ezrin (pCMV-Tag2B-ezrin [WT]) was mutated to pCMV-Tag2B-ezrin (T567A) and pCMV-Tag2B-ezrin (T567E) by using the Fast Mutagenesis System (#21207, TransGen Biotech, Beijing, China). Ezrin shRNA (shEzrin) was designed using a dedicated program provided by OriGene. Oligonucleotides corresponding to the nucleotides 1677–1705 in rat ezrin mRNA (GenBank accession No: 54319) were synthesized by Genscript (Nanjing, China). The shRNA sequences were 5′-CGCGTCGCCAAGGAAGAACTGGAGAGACAGGCACATTCAAGAGATGTGCCTGTCTCTCC AGTTCTTCCTTGGCTTTTTTCCAAA-3′

(sense)

and

5′-

of

AGCTTTTGGAAAAAAGCCAAGGAAGAACTGGAGAGACAGGCACATCTCTTGAATGTGCCT

ro

GTCTCTCCAGTTCTTCCTTGGCGA-3′ (antisense). The double-stranded DNA fragment was cloned

-p

into the MluI/HindIII restriction sites of a pRNAT-H1.1/Adeno vector (GenScript Corporation., America), yielding pRNAT-H1.1-shEzrin. The inserted sequences were verified by restricted enzyme

re

digestion and DNA sequencing. Adenovirus expressing shEzrin was packaged in BJ5183-AD-1

lP

(Agilent) and propagated in AD-293 cells (Invitrogen) by following the manufacture’s instruction. The Adenovirus was purified by cesium chloride density gradient centrifugation [25].

na

2.2. Cell culture and transfection

Rat SC RSC96 (Type Culture Collection of the Chinese Academy of Sciences, Shanghai, China)

Jo ur

was maintained in Dulbecco’s modified Eagle’s medium (DMEM, E500003, Sangon Biotech, Shanghai, China) supplemented with 10% (v/v) fetal bovine serum at 37 °C in a 5% CO2 humidified atmosphere. HeLa cells were grown at 37 °C and 5% CO2 in DMEM supplemented with 10% fetal bovine serum. Before transfection, the cells were seeded into six-well trays and cultured overnight. Subsequently, the cells were transiently transfected with Lipofectamine 2000 Reagent (#1854316, Thermo Fisher Scientific, USA) at 50%–70% confluency with indicated plasmids, in accordance with the manufacturer’s protocol. The proteins of the cytomembrane and cytoplasm were extracted separately by using membrane and cytoplasmic protein extraction kits, respectively (#AR0155, Boster, Wuhan, China).

2.3. Immunocytochemistry and immunohistochemistry After culturing for approximately 24 h, RSC96 cells grown on glass coverslips were fixed with

Journal Pre-proof absolute methanol at 4 °C for 7 min and blocked in a solution of 5% (v/v) fetal bovine serum and 0.3% (v/v) Triton X-100 in PBS at room temperature for 1 h. The blocked cells were incubated overnight with goat anti-L-PRX (1:300, #C2513, Santa Cruz, USA) and/or mouse anti-ezrin (1:300, #I0111, Santa Cruz, USA) in 5% (v/v) fetal bovine serum in PBS. The slides were then washed in blocking buffer without fetal bovine serum and incubated with the secondary antibodies, tetramethyl rhodamine isothiocyanate (TRITC)-labeled rabbit anti-goat (1:500, ZF-0317, ZSGB, Beijing, China) and/or fluorescein isothiocyanate (FITC)-labeled goat anti-mouse (1:500, ZF-0312, ZSGB, Beijing, China). Both antibodies were suspended in 5% (v/v) fetal bovine serum in PBS and incubated at room

of

temperature for 1 h. Subsequently, the cells were washed in PBS and then incubated with

ro

4′,6-diamidino-2-phenylindole (DAPI) (1:2000, D8200, Solarbio, Beijing, China) for 15 min. Finally,

-p

the cells were identified with the DeltaVision Microscopy Imaging Systems (GE, USA) at 60× magnification.

re

Rat sciatic nerves were prepared as previously described [26, 27] and embedded in OCT (Miles).

lP

Transverse sections of the nerves at 6 µm thickness were obtained and mounted on glass slides. The sections were treated with acetone for 10 min at room temperature, blocked for at least 1 h in PBS

na

containing 5% (v/v) fetal bovine serum and 0.3% (v/v) Triton X-100, and incubated for 24 h at 4 °C with a combination of goat anti-L-PRX (1:300, #C2513, Santa Cruz, USA), mouse anti-ezrin (1:300,

Jo ur

#I0111, Santa Cruz, USA) and rabbit anti-MBP (1:300, AE012758, Bioss, China). After incubation with the primary antibodies, the sections were washed and then incubated with the secondary antibodies TRITC-labeled rabbit anti-goat (1:500, ZF-0317, ZSGB, Beijing, China), FITC-labeled goat anti-mouse (1:500, ZF-0312, ZSGB, Beijing, China) and Alexa Fluor 405-conjugated goat anti-rabbit (1:500, AS056, ABclonal, USA) or FITC-labeled goat anti-rabbit (1:500, ZF-0311, ZSGB, Beijing, China) in PBS at room temperature for 1 h. Subsequently, sections were washed in PBS and then photographed under a confocal microscope (LSM880, Zeiss, USA) at 60× magnification.

2.4. Co-immunoprecipitation (Co-IP) and western blotting analysis For Co-IP assays, cells were harvested and lysed in IP buffer (50mM Tris-HCl (pH 7.5), 150mM NaCl, 1mM EDTA, 1% NP-40) supplemented with proteinase inhibitors 1mM PMSF, 10 μg/mL aprotonin, 5 μg/mL leupeptin and 0.5 μg/mL pepstatin on ice for 20 min, centrifuged at 8000 × g and 4 °C for 20 min and the supernatants were collected in fresh tube. Half of lysate aliquots were

Journal Pre-proof incubated with 2 μg of anti-Myc, anti-Flag, or anti-GFP at 4 °C overnight in a rotator and 2 μg of mouse IgG. The other half was used as control. Endogenous protein IPs were performed with 2 μg of anti-L-PRX. Protein A+G Agarose (AB44171, Bioworld, USA) was added and incubated at 4 °C for 4 h. The beads were then washed three times with PBS. The reactions were stopped by adding 5× SDS-PAGE loading sample buffer, and the proteins were separated by SDS-PAGE and transferred to a nitrocellulose (NC) membrane. The blots were probed with the following primary antibodies: rabbit anti-Myc (1:1000, AM9933-1, Beyotime, Beijing, China), mouse anti-Flag (1:1000, AB23161, Bioworld, USA), mouse anti-GFP (1:1000, AG281-1, Beyotime, Beijing, China), or rabbit anti-L-PRX

of

(1:1000, R23874, Abmart, Shanghai, China). The horseradish peroxidase (HRP)-labeled secondary

ro

antibodies goat anti-rabbit (1:10000, ZB-2301, ZSGB, Beijing, China) or goat anti-mouse (1:10000,

-p

ZB-2305, ZSGB, Beijing, China) were also added. Immunoreactive bands were visualized by chemiluminescence using Western blot detection reagents (#29050, Engreen Biosystem, Beijing,

re

China).

lP

The proteins of the cytomembrane and cytoplasm were extracted separately by using membrane and cytoplasmic protein extraction kits, respectively (#AR0155, Boster, Wuhan, China). Equal amounts

na

of protein lysates (50 μg) were loaded for SDS-PAGE and transferred to a NC membrane. The signals were probed with primary antibodies and amplified by the secondary antibodies. The primary

Jo ur

antibodies included goat anti-L-PRX (1:500, #C2513, Santa Cruz, USA), mouse anti-ezrin (1:500, #I0111, Santa Cruz, USA) and rabbit anti-β-actin

(1:1000, #AP0060, Bioworld Technology, USA).

Finally, the bands were imaged by chemiluminescence using Western blot detection reagents (#29050, Engreen Biosystem, Beijing, China) and quantified by optical densities using Quantity One software version 4.6.2 (Bio‑Rad Laboratories, Inc.)

2.5. GST pull-down assay GST-ezrin was expressed in E.coli BL21 (DE3) cells and affinity purified with Glutathione Sepharose 4B beads (GE Healthcare, USA) and Sephacryl S-200 column (GE Healthcare, USA). In brief, the E.coli BL21 (DE3) cells were harvested by centrifugation and resuspended in 40 ml PBS (pH 7.4). The E.coli BL21 (DE3) cells were lysed by sonication and the soluble fraction was separated from debris by centrifugation at 8000 × g for 30 min. The supernatant were loaded onto Glutathione Sepharose 4B beads pre-equilibrated with PBS for 1.5 h. Unbound proteins were washed out with five

Journal Pre-proof column volumes of PBS and the bound proteins were eluted with the elution buffer (50mM Tris-HCl (pH 8.0), 10mM glutathione). The buffer of the eluate was exchanged to the GST binding buffer (50mM Tris-HCl (pH 7.4), 150mM NaCl, 1mM EDTA, 1mM DTT, 1% NP-40, 1mM PMSF, 5 μg/mL leupeptin, 0.5 μg/mL pepstatin) using the Sephacryl S-200 column.For the pull-down assay, transfected RSC96 cells were lysed on ice. Cell lysates were cleared by centrifugation at 8000 × g for 20 min. The purified GST-fused protein (150 μg) was initially attached to 20 μL of Glutathione Sepharose 4B beads (50% slurry) in GST binding buffer and then incubated with 250 μL of cell lysates after centrifugation in GST binding buffer for 4 h at 4 °C. The beads were washed three times with PBS, and bound

of

proteins were eluted with elution buffer. The samples were separated by 12% SDS-PAGE and

ro

transferred onto a NC membrane. The membrane was blotted with the following corresponding primary

-p

antibodies: rabbit anti-Myc (1:1000, AM9933-1, Beyotime, Beijing, China) and rabbit anti-GST (1:1000, A101611, GenScript Corporation., America). The HRP-labeled secondary antibody goat

re

anti-rabbit (1:10000, ZB-2301, ZSGB, Beijing, China) was then added. Immunoreactive bands were

lP

visualized by chemiluminescence by using Western blot detection reagents.

na

2.6. Bimolecular fluorescence complementation (BiFc) During the BiFc assay, yellow fluorescent protein (YFP) is generally cleaved at amino acidic

Jo ur

residues between 155 and 156 in YFP gene, whereas the N-terminal consists of residues 1–155 aa (YN), and the C-terminal comprise residues 156–238 aa (YC) [28]. Thus, pYN and pYC plasmids were constructed to display the YN and YC of the YFP. At ∼50% confluency, HeLa cells grown on glass coverslips were co-transfected with the combinations pYN-L-PRX (1-200)/pYC-ezrin (1-296), pYN-L-PRX (1-200)/pYC-ezrin (475-585), pYN-L-PRX (1060-1461)/pYC-ezrin (1-296), pYN-L-PRX (1060-1461)/pYC-ezrin (475-585), pYN-L-PRX (1060-1367)/pYC-ezrin (1-585), pYN-L-PRX (1368-1461)/pYC-ezrin (1-585), pYN-L-PRX (1368-1461)/pYC-ezrin (475-557), and pYN-L-PRX (1368-1461)/pYC-ezrin (558-585) and the control of pYN/pYC. Approximately 24 h after transfection, the cells were washed three times with PBS to remove DMEM. The cells were then fixed with absolute methanol at 4 °C for 7 min. Subsequently, the cells were washed in PBS and then incubated with DAPI for 15 min. Cells were identified with DeltaVision Microscopy Imaging Systems (GE, USA) at 60× magnification.

Journal Pre-proof 2.7. Reversible Renilla luciferase protein complementation assay In general, the Renilla luciferase protein is cleaved between amino acidic residues 229 and 230 in Renilla luciferase gene, whereas the N-terminal and C-terminal consist of residues 1–229 aa (RN) and 230–311 aa (RC), respectively. Thus, pRN and pRC plasmids were constructed to display the RN and RC of the Renilla luciferase [29]. At ∼50% confluency, HeLa cells grown on glass coverslips were co-transfected with the combinations pRN-PDZ-NLS3/pRC-F1, pRN-PDZ-NLS3/pRC-F2, and pRN-PDZ-NLS3/pRC-F3; pEGFP-Renilla (1-311); and the combination of pRN and pRC as control. Approximately 24 h after transfection, the cells were lysed in 1 × Renilla Luciferase Assay Lysis then centrifuged immediately at

of

Buffer (#E2810, Promega Corporation, USA) for 15 min on ice,

ro

8000 × g and 4 °C for 20 min. The supernatant of cytosolic fraction was transferred into a new tube.

-p

Finally, luciferase activity in the lystes was determined using the Renilla Luciferase Assay System

luciferase activity.

lP

2.8. Fluorescence spectrometry assay

re

(#E2810, Promega, USA) and a TD-20/20 luminometer. The data were expressed as the relative

His-tagged PDZ (1-102), PDZ-NLS (1-200), PDZ-NLS1 (1-102, 118-139), PDZ-NLS2 (1-102,

na

162-175), and F3 proteins were cloned in the pET-M-3C vector. The His-tagged fusion proteins were expressed in E. coli BL21 (DE3) cells and successively purified by nickel affinity chromatography and

Jo ur

Sephacryl S-200 chromatography. NLS3 peptide was synthesized by ChinaPeptide (Shanghai, China). His-F3 was labeled with FITC (F8070, Solarbio, Beijing, China), in accordance with the manufacturer’s protocol.

Fluorescence emission spectra were recorded with a Perkin Elmer LS55 fluorescence spectrometer at room temperature. The fluorescence intensity of FITC-F3 (500 μL, 0.12 μM) was measured in the absence of PDZ, PDZ-NLS, PDZ-NLS1, PDZ-NLS2, and NLS3 and at a variable concentration range of 0.12–5 μM. In all cases, FITC fluorescence was measured following excitation at 495 nm and emissions at 518 nm. Excitation and emission slits were set to 5 nm. All measurements in this study were performed in PBS (pH 7.3). The titration experiment was repeated three times, and the titration curves were prepared by plotting (F–F0)/F0 with gradually increasing molar ratios of PDZ, PDZ-NLS, PDZ-NLS1, PDZ-NLS2, NLS3, and FITC-F3. Curves were fitted using Origin Pro version 8.0. When small molecules are bound to equivalent sites on a macromolecule, the equilibrium between

Journal Pre-proof free and bound molecules can be calculated using the following equation [30]: log(F0-F)/F=nlog(1/Kd)-nlog[1/([Dt]-(F0-F)[Pt]/F0))]

(1)

where F0 and F are the relative steady-state fluorescence intensities in the absence and presence of quencher, respectively; [Dt] is the concentration of quencher; and [Pt] is the concentration of FITC-F3. The values of the dissociation constant (Kd) and number of binding sites (n) can be derived from the intercept and slope of a plot based on Eq. (1).

2.9. Flow cytometry to detect fluorescence intensity in HeLa cells

of

HeLa cells were transfected with indicated plasmids at ∼50% confluency. In the control group,

ro

pYN and pYC were co-transfected. The two experimental groups were co-transfected with the

-p

combination of pYN-L-PRX (104-200), pYC-L-PRX (1060-1367), and pCMV-Tag3B and with pYN-L-PRX (104-200), pYC-L-PRX (1060-1367), and pCMV-Tag3B-ezrin. After approximately 24 h,

re

the cells were washed three times with PBS to remove DMEM. The cells were then trypsinized and

lP

spun down. The pellet was resuspended in 1 mL of PBS, and FITC fluorescence intensity was detected

na

by a flow cytometer (FACSCalibur, BD Bioscience, USA).

2.10. Preparation of the animals and surgical procedure

Jo ur

All animal studies were carried out in strict accordance with the recommendations in the ARRIVE guidelines and the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The animal use protocol was approved by the Institutional Animal Care and Use Committee of Hubei University of Medicine.

Approximately 150–200 g Sprague Dawley male rats (n =32) were used. The rats were randomly divided into the following four groups: sham group, sciatic nerve injury group, Ad-Ezrin intervention group, and Ad-shEzrin intervention group. Each group consisted of eight animals. Four groups of rats were housed separately in appropriate temperature and humidity. Peripheral nerve crushing was performed as previously described with minor modifications [31]. In brief, the rats were subjected to general anesthesia with intraperitoneal ketamine (90 mg/kg) and xylazine (10 mg/kg). The operative field was routinely prepared through hair trimming and disinfection with 20% iodine ethylic alcohol. The right sciatic nerve was exposed through a 1–2 cm posterolateral longitudinal straight incision on the lateral aspect of the right thigh, and a gluteal muscle splitting

Journal Pre-proof incision was then performed. The sciatic nerve was exposed, and with the use of needle holder, force equivalent to 7 kg was pressed on 2–3 mm of sciatic nerve three times for 30 s at 30 s intervals. Penicillin procaine was applied to the wounds, and the incision was stapled with sutures. All operations were performed on the right limb [32]. For the animals of the sham group, incisions were sutured directly after the sciatic nerve was exposed. Saline group was injected with 10 μg 0.9 % sodium chloride injection into the sciatic nerve. Ad-Ezrin group was injected with 10 μL Ad-Ezrin (8.674 × 107pfu/mL) into the sciatic nerve. Ad-shEzrin group was injected with 10 μL Ad-shEzrin (1.158 × 108pfu/mL) into the sciatic nerve. 14 d later, the sciatic nerves of four groups were removed for

2.11. Transmission electron microscope evaluations

ro

of

transmission electron microscope evaluations and immunohistochemistry.

-p

The ultrastructures of the sciatic nerve were identified using a transmission electron microscope.

re

Four tissue samples (1 mm × 1 mm × 1 mm) were prefixed with 2.5% glutaraldehyde and then postfixed with 1% osmium tetroxide. The samples were then dehydrated in a graded alcohol series,

lP

cleared with propylene oxide, and embedded in epoxy resin (EMBed-812 Embedding Kit; Electron Microscopy Sciences). Sections were cut by a microtome (Leica UC7, Leica Microsystems GmbH,

na

Vienna, Austria). Ultrathin sections were cut into 50–80 nm slices and then contrasted with uranyl acetate and lead citrate. The sections were imaged using an electron microscope (TECNAI G2 20

Jo ur

TWIN, FEI, American). All micrographs of the sciatic nerve sections were randomly captured at 1700× and 3500× magnifications from the sciatic nerve for all of the four groups.

2.12. Statistical analysis

The results provided in the figures are representative of at least three independent experiments. Quantitative data are presented as mean ± SD obtained from triplicate samples, unless otherwise described in figure legends. Statistical analysis was performed using Origin Pro version 8.0. Statistical significance is indicated in the figure captions.

3. Results 3.1. L-PRX interacts with ezrin by the "head to head and tail to tail" mode L-PRX and ezrin were identified by immunofluorescence staining to investigate their subcellular

Journal Pre-proof localization in RSC96. When L-PRX and ezrin were co-stained, their strong co-localization (yellow) was found in the cytomembrane and cytoplasm (Fig. 2A). The co-localization of L-PRX and ezrin was confirmed on the rat sciatic nerves by immunohistochemistry. As depicted in Fig. 2B, staining demonstrated a striking and robust expression of MBP, L-PRX and ezrin in transverse sections. MBP (blue), a compact myelin marker, was distributed along the axon. L-PRX (red) was predominately present in the abaxonal plasma membrane. Distinct staining of ezrin (green) localized at the abaxonal plasma membrane was also observed. The co-localization (yellow) of L-PRX and ezrin was detectable at the abaxonal surface of myelinating SCs.

of

Co-IP assay was performed to determine whether endogenous L-PRX interacts with endogenous

ro

ezrin. L-PRX co-immunoprecipitated with ezrin, whereas mouse IgG did not (Fig. 2C). To confirm this

-p

interaction, GST-ezrin was purified (Fig. 2D) and a GST pull-down experiment was performed. As expected, GST-fused ezrin could pull down Flag-tagged L-PRX (Fig. 2E).

combinations

pCMV-tag-3B-L-PRX/pCMV-tag-2B-ezrin

lP

The

re

To substantiate the interaction mode of L-PRX with ezrin, Co-IP experiments were performed.

pCMV-tag-3B-L-PRX/pCMV-tag-2B-ezrin

(297-474),

and

(1-296),

pCMV-tag-3B-L-PRX/

na

pCMV-tag-2B-ezrin (475-585) were transfected into RSC96 cells. The cells were lysed, and the supernatant was subjected to Co-IP. Interaction was detected by Western blot analysis (Fig. 3A).

Jo ur

Flag-ezrin (1-296) and Flag-ezrin (475-585) could be detected by anti-Flag antibody in the Myc-L-PRX (1-1461)/Flag-ezrin (1-296) and Myc-L-PRX (1-1461)/Flag-ezrin (475-585) groups. It suggested that ezin (1-296) and ezrin (475-585) could interact with L-PRX. The interactions between ezrin and L-PRX (1-200), L-PRX (194-1059), and L-PRX (1060-1461) were detected by Western blot analysis (Fig. 3B). Flag-ezrin co-precipitated with Myc-L-PRX (1-200) and Myc-L-PRX (1060-1461), indicating that L-PRX (1-200) and L-PRX (1060-1461) could interact with ezrin. The experiments presented in Figs. 3C and 3D demonstrated that L-PRX (1-200) interacts with ezrin (1-296) and that L-PRX (1060-1461) interacts with ezrin (475-585). BiFc techniques were also used to confirm the interactions between L-PRX (1-200) and ezrin (1-296), L-PRX (1060-1461), and ezrin (475-585). The results showed that the pYN-L-PRX (1-200) and pYC-ezrin (1-296) interaction and the pYN-L-PRX (1060-1461) and pYC-ezrin (475-585) interaction induced strong fluorescence compared with the YN and pYC interaction (Fig. 3E). The results also indicated that L-PRX interacted with ezrin by a "head to head and tail to tail"

Journal Pre-proof mode. In other words, the N- and C-termini of L-PRX interacted with the N- and C-termini of ezrin, respectively.

3.2. NLS3 region and F3 subdomain mediates N-terminal interaction between L-PRX and ezrin To determine the specific interaction domains in the N-terminal of L-PRX and ezrin, Co-IP experiment

between

Flag-FERM

and

GFP-PDZ,

GFP-PDZ-NLS1,

GFP-PDZ-NLS2,

and

GFP-PDZ-NLS3 were carried out. As shown in Fig. 4A, only GFP-PDZ-NLS3 could bind with Flag-FERM, as detected by the anti-GFP antibody. The result confirmed that the NLS3 region of

of

L-PRX was the critical fragment for interacting with the FERM domain of ezrin.

ro

Reversible Renilla luciferase protein complementation assay and a Co-IP were performed to clarify that one or more of the three fragments of FERM domain, namely, F1, F2, and F3, interact with

-p

the NLS3 region of L-PRX. Fluorescence value analysis of HeLa cells after 24 h showed that

re

pRN-PDZ-NLS3 and pRC-F3 exhibited a fairly higher fluorescence value than the combinations of pRN/pRC, pRN-PDZ-NLS3/pRC-F1 and pRN-PDZ-NLS3/pRC-F2 (Fig. 4B). The Co-IP assay result

lP

indicated that GFP-PDZ-NLS3 co-precipitated with Flag-F3 instead of Flag-F1 and Flag-F2 (Fig. 4C). The peptide binding data in the fluorescence spectrum also implied an increase in FITC-F3

na

binding of PDZ-NLS and NLS3 (Fig. 4D). Kd = 7.9 × 10-6 mol·L-1 and n = 0.83 for PDZ-NLS, and Kd = 2.5 × 10-5 mol·L-1 and n = 0.70 for NLS3, where Kd is the dissociation constant and n is the number

Jo ur

of binding sites determined by Eq. (1). The NLS3 region and F3 subdomain mediates the N-terminal interaction between L-PRX and ezrin.

3.3. L-PRX (1368-1461) and ezrin (475-557) domains mediate C-terminal interaction between L-PRX and ezrin To clarify the specific domains participating in the C-terminal interaction of L-PRX and ezrin, L-PRX (1060-1461) was divided into L-PRX (1060-1367) and L-PRX (1368-1461) and ezrin (475-585) was divided into ezrin (475-557) and ezrin (558-585). In the BiFc experiment, the interaction of L-PRX (1368-1461) with ezrin (475-557) was indicated via the fairly high BiFc fluorescence induced by pYN-L-PRX (1368-1461)/pYC-ezrin (1-585) and pYN-L-PRX (1368-1461)/pYC-ezrin (475-557). However, fluorescence was almost undetectable when pYN/pYC, pYN-L-PRX (1060-1367)/pYC-ezrin (1-585), and pYN-L-PRX (1368-1461)/pYC-ezrin

Journal Pre-proof (558-585) were co-overexpressed (Fig. 5A). The fragments co-precipitating with Flag-ezrin (475-585) was GFP-L-PRX (1368-1461) and not GFP-L-PRX (1060-1367) (Fig. 5B). A Co-IP experiment was then carried out to test which between ezrin (475-557) and ezrin (558-585) could interact with L-PRX (1368-1461). Evident co-precipitation was detected in the group of ezrin (475-557) and L-PRX (1368-1461) (Fig. 5C).

3.4. Self-association of L-PRX is pulled apart by ezrin The self-association of L-PRX is mediated by its NLS2/NLS3 region and C-terminal domain [12].

of

To examine whether ezrin affects the L-PRX self-association, we performed a BiFc experiment and

ro

recorded the mean fluorescence intensity of the cells by using a flow cytometer. The mean fluorescence

-p

intensities of the cells were 13.78 and 8.87 for co-overexpressing YN-L-PRX (104-200)/YC-L-PRX (1060-1367) and the control group, respectively, which resulted from L-PRX self-association (Fig. 6A).

re

By contrast, for co-overexpressing YN-L-PRX (104-200), YC-L-PRX (1060-1367), and Myc-tagged

lP

ezrin (1-585), the mean fluorescence intensity of cells decreased to 9.18, which was almost similar to the control group (Fig. 6A). Competitive Co-IP was performed to examine whether ezrin affects

na

L-PRX self-association. Western blot results showed weakened interaction between GFP-L-PRX (104-200) and Flag-L-PRX (1060-1367) when they were competitively co-immunoprecipitated with

Jo ur

Myc-ezrin (1-585) (Fig. 6B). In conclusion, ezrin is suggested to inhibit the self-association of L-PRX.

3.5. A phosphorylation-mimicking mutation of ezrin increases the membrane localization of L-PRX The decline of ezrin was triggered by transfecting shEzrin, resulting in the marked decrease of endogenous L-PRX’s cytomembrane localization in RSC96 cells (Figs. 7A–D). Ezrin exerted a considerable action on L-PRX localization. Thr567 in the ezrin was replaced by Ala or Glu to mimic the dephosphorylated or phosphorylated state of ezrin. When Flag-ezrin (T567A) was overexpressed, endogenous L-PRX and Flag-ezrin (T567A) showed reduced co-localization in the cytomembrane and concentrated in the cytoplasm in RSC96 cells. By contrast, when Flag-ezrin(T567E) was overexpressed, endogenous L-PRX and Flag-ezrin (T567E) was co-localized in the ctyomembrane (Figs. 7E–H). Co-IP was performed to determine whether the phosphorylation-mimicking

or dephosphorylation-mimicking mutation of

Thr567 in ezrin influences the interaction between ezrin and L-PRX. Myc-L-PRX but not mouse IgG

Journal Pre-proof co-immunoprecipitated with Flag-ezrin (T567A) (Fig. 7I). Co-IP was detected in the group of Myc-L-PRX and Flag-ezrin (T567E) but not in the group of mouse IgG and Flag-ezrin (T567E) (Fig. 7J). The presence and phosphorylation-mimicking mutation of ezrin is sufficient to accelerate the membrane

localization

of

L-PRX.

However,

the

phosphorylation-mimicking

or

dephosphorylation-mimicking mutation of Thr567 in the ezrin does not affect the interaction between ezrin and L-PRX (Figs. 7I–J).

of

3.6. Ezrin promotes the regeneration of myelin sheath around the injured sciatic nerve

ro

The ultrastructures of the sciatic nerve in the sham group were observed by a transmission

-p

electron microscope, which showed that normal axons were surrounded by a common myelin sheath. Electron micrographs of injured sciatic nerve in the saline group revealed findings consistent with

re

myelin damage, such as uncompacted, deteriorating myelin or onion bulbs. Compared with the saline

lP

group, the Ad-Ezrin group showed disproportionately thin myelin sheaths. This phenomenon indicates that attempts at remyelination were initiated, and the integrity of injured sciatic nerve was improved by

na

ezrin over-expression. By contrast, axons in Ad-shEzrin group remained surrounded by fragmented myelin structures and were not significantly different compared with the saline group (Fig. 8A).

Jo ur

The immunostaining analysis of MBP and L-PRX was also performed in the sciatic nerves of sham group, Saline group, Ad-Ezrin group and Ad-shEzrin group. MBP was detected as a marker to indicate the integrity of the myelin sheath. The results in Fig. 8B show that the myelin sheath was normal and L-PRX distributed in the abaxonal plasma membrane in sham group. In Saline group, the myelin sheath was damaged obviously and the distribution of L-PRX was disordered. On the injured sciatic nerves with the administration of Ad-Ezrin for 14d in Ad-Ezrin group, the regeneration of the myelin sheath was improved distinctly. Meanwhile the expression of L-PRX concentrated on the abaxonal plasma membrane. On the contrary, in Ad-shEzrin group, the myelin sheath was still damaged and the location of L-PRX distributed in cytoplasm. These results demonstrate that overexpression of ezrin promoted the regeneration of myelin sheath and the translocation of L-PRX to the abaxonal plasma membrane.

4. Discussion

Journal Pre-proof Numerous studies have provided crucial insights into how ezrin interacts with membrane components via its N- and C-terminal domains [15, 33, 34]. The mechanism of the interaction is negatively regulated by an intramolecular interaction between the N-terminal F2 and F3 subdomains and the C-terminal domain of ezrin or an intermolecular interaction between ezrin and other ERM molecules. In this closed conformation, ezrin is restricted in the cytoplasm with the membrane and actin binding sites masked [35], and its biological function is inhibited. In vivo, the activation of ezrin is triggered by the dissociation of the N- and C-terminal domains via the binding of the F1 and F3 subdomains to PIP2 and the phosphorylation of Thr567 in the F-actin binding site. The proper

of

activation of ezrin is critical for its correct localization and functions in cells.

ro

Self-association between the NLS2 and NLS3 regions and the C-terminal acidic domain (residues

-p

1060-1367) was detected in L-PRX. Self-association influences the localization of LPRX in SCs. The self-association of L-PRX is remarkably weakened by DRP2 and the free NLS3 peptide [12]. The

re

NLS3 region of L-PRX also mediates nuclear targeting and nuclear–cytoplasmic trafficking of L-PRX.

lP

Both NLS2 and NLS3 regions play an important role in mediating the interaction between L-PRX and DRP2, contributing to the formation of the PRX–DRP2–dystroglycan (PDG) complex [13, 35]. In the

na

present study, both the F3 subdomain of ezrin and the NLS3 of L-PRX were confirmed to be involved in the “head to head” interaction between ezrin and L-PRX. Therefore, NLS is considered as a trigger

Jo ur

for the localization and functions of L-PRX. The residues 475-557 fragment in ezrin is also involved in “tail-to-tail” interaction with the C-terminal domain (residues 1368-1461) of L-PRX. The parallel interaction between ezrin and L-PRX leads to the breaking of the self-associated state of L-PRX, and the correct location of L-PRX plays a biological function in SCs. A recent study suggested that the C-terminal domain of L-PRX was intrinsically disordered and flexible. Although the exact binding site on L-PRX C-terminal domain remains to be determined, a direct interaction between the C-terminal domain and the β4 integrin cytoplasmic domain has been confirmed，which illustrates that L-PRX acts as a central protein scaffold to bridge PDG complex and L-PRX-β4 integrin complex together. This mode is important to link the Schwann cell cytoplasm to the basal lamina [14]. At the early phase of PNS development, PRX is initially detectable in the adaxonal and abaxonal membranes of myelinating SCs. As myelin sheaths mature, L-PRX extensively occurs in the abaxonal membrane [5]. Changes in the localization of L-PRX in the different stages of PNS formation indicate

Journal Pre-proof that L-PRX may contribute to the stabilization of the myelin sheath by participating in membrane– protein interactions. Ezrin phosphorylation can induce the up-regulation of L-PRX in the cytomembrane of SCs. Therefore, ezrin may influence myelination via mediating the L-PRX involved in membrane–protein interactions. Based on the gathered data, we illustrated a new interaction mechanism between L-PRX and ezrin in Fig. 9. The tight interaction between the FERM domain and the C-terminal of ezrin molecule presumably restrains ezrin in a kinetically inactive state, but inactive ezrin may still interact with L-PRX. Following phosphorylation (e.g., phosphorylation of Thr567), the self-association of ezrin is

of

broken, and ezrin is translocated to the cytomembrane by cytoskeleton proteins. L-PRX forms a

ro

“head-to-tail” self-association conformation by the combination of its NLS region and the C-terminal

-p

acidic domain. In it self-associated state, L-PRX may lose the capacity to bind to other ligands in the cytoplasm, such as DRP2 [12]. When the self-association conformation of L-PRX is disrupted by some

re

ligands, such as ezrin or DRP2, then L-PRX is transferred to the cytomembrane by phosphorylated

lP

ezrin or DRP2. In the cytomembrane, L-PRX can form a homodimer via its PDZ domain [4, 12, 36] and serves as an intermediary protein that transduces signals to regulate the myelination and

na

maintenance of SCs. It is verified that ezrin is a new ligand that can transfer L-PRX to cytomembrane. We have a hypothesis that DRP2-L-PRX-β4 integrin complex and ezrin-L-PRX complex are two

Jo ur

parallel models involved in the cytomembrane localization of L-PRX and the myelination. The competitive Co-IP experiment among the Myc-L-PRX (1060-1461), GFP-β4-FNIII-3 (1512-1602) and Flag-ezrin (475-585) indicated that ezrin and β4 integrin bond to the C terminal of L-PRX in synergy (Supplementary Fig. S1). In addition, it is probable that L-PRX mediates some specific downstream signaling of ezrin. As for the relationship among L-PRX, ezrin, β4 integrin and DRP2, it remains to be further studied. After peripheral nerve injury, the interaction between SCs and axons mediates the remyelination of SCs, along with the remodeling of the nodes of Ranvier [2]. All three proteins in the ERM family are expressed in myelinating SCs and show characteristic localizations and functions. The role of ezrin in myelinating SCs is mainly to facilitate the development and polarization of SCs microvilli during myelination. Active ezrin is required for the formation of the nodes of Ranvier [21]. In this study, ezrin could promote the remyelination process of injured sciatic nerves. However, the influence of ezrin on the myelination and remyelination of PNS requires further investigation.

Journal Pre-proof In summary, ezrin can interact with L-PRX in SCs via the “head to head and tail to tail” mode. The dephosphorylated or phosphorylated state of Thr567 in the ezrin does not influence the interaction between ezrin and L-PRX. The self-association of L-PRX can be inhibited by ezrin. However, the phosphorylation-mimicking mutation of Thr567 in ezrin induces the up-regulation of L-PRX in the cytomembrane of SCs. The over-expression of ezrin promotes the progress of remyelination in the injured sciatic nerves. Thus, ezrin plays a crucial role in myelination. However, the specific molecular mechanism of the mediation of ezrin in the myelination and remyelination of PNS remains to be

of

determined.

ro

Declaration of interest

-p

The authors declare that they have no conflicts of interest with the contents of this article.

re

Author contributions

lP

Design of the study: YS; performing the experiments and analyzing the data: TG and LZ; preparing the

all of the authors.

Jo ur

Acknowledgements

na

manuscript draft: TG and LZ; revising the manuscript: HX and YY; final approval of the manuscript:

This work was supported by the National Natural Science Foundation of China (No.31170748), the Natural Science Foundation of Shanxi Province (No.201701D121085), and the Youth Science Foundation of Shanxi Province (No.201701D221163). We thank the Scientific Instrument Center of Shanxi University and Miss Wang Juanjuan for their assistance with confocal microscopy.

Funding sources This work was supported by the National Natural Science Foundation of China (No.31170748), the Natural Science Foundation of Shanxi province (No.201701D121085) and the Youth Science Foundation of Shanxi province (No.201701D221163).

Journal Pre-proof References [1] M.L. Feltri, Y. Poitelon, S.C. Previtali, How Schwann Cells Sort Axons: New Concepts, Neuroscientist. 22 (2016) 252-265. https://doi.org/10.1177/1073858415572361. [2] S.L. Roberts, X.P. Dun, G. Dee, B. Gray, T. Mindos, D.B. Parkinson, The role of p38alpha in Schwann cells in regulating peripheral nerve myelination and repair, J Neurochem. 141 (2017) 37-47. https://doi.org/10.1111/jnc.13929. [3] L.F. Castelnovo, V. Bonalume, S. Melfi, M. Ballabio, D. Colleoni, V. Magnaghi, Schwann cell development,maturation and regeneration:a focus on classic and emerging intracellular signaling

of

pathways, Neural Regen Res. 12 (2017) 1013-1023. https://doi.org/10.4103/1673-5374.211172.

ro

[4] H. Han, P. Kursula, Periaxin and AHNAK nucleoprotein 2 form intertwined homodimers through

-p

domain swapping, J Biol Chem. 289 (2014) 14121-14131. https://doi.org/10.1074/jbc.M114.554816. [5] S.S. Scherer, Y.T. Xu, P.G. Bannerman, D.L. Sherman, P.J. Brophy, Periaxin expression in

Development.

121

(1995)

4265-4273.

lP

development,

re

myelinating Schwann cells: modulation by axon-glial interactions and polarized localization during

https://doi.org/10.1111/j.1365-2303.1995.tb00491.x.

na

[6] D.L. Sherman, P.J. Brophy, A murine model of Charcot-Marie-Tooth disease 4F reveals a role for the C-terminus of periaxin in the formation and stabilization of Cajal bands, Wellcome Open Res. 3

Jo ur

(2018) 20. https://doi.org/10.12688/wellcomeopenres.13673.1. [7] Y.J. Choi, Y.S. Hyun, S.H. Nam, H. Koo, Y.B. Hong, K.W. Chung, B.O. Choi, Novel Compound Heterozygous Nonsense PRX Mutations in a Korean Dejerine-Sottas Neuropathy Family, J Clin Neurol. 11 (2015) 92-96. https://doi.org/10.3988/jcn.2015.11.1.92. [8] Y. Yang, Y. Ren, Y. Shi, Intermolecular disulfide bond in the dimerization of S-periaxin mediated by Cys88

and

Cys139,

Acta

Biochim

Biophys

Sin

(Shanghai).

48

(2016)

326-333.

https://doi.org/10.1093/abbs/gmw008. [9] Y. Yenan, S. Yawei, L-periaxin interacts with S-periaxin through its PDZ domain, Neurosci Lett. 609 (2015) 23-29. https://doi.org/10.1016/j.neulet.2015.10.020. [10] D.L. Sherman, P.J. Brophy, A tripartite nuclear localization signal in the PDZ-domain protein L-periaxin, J Biol Chem. 275 (2000) 4537-4540. https://doi.org/10.1074/jbc.275.7.4537. [11] E.A. Nigg, Nucleocytoplasmic transport: signals, mechanisms and regulation, Nature. 386 (1997) 779-787. https://doi.org/10.1038/386779a0.

Journal Pre-proof [12] Y. Yang, L. Min, Y. Shi, Self-association of L-periaxin occurs via its acidic domain and NLS2/NLS3, and affects its trafficking in RSC96 cells, Rsc Advances. 7 (2017) 44112-44123. https://doi.org/10.1039/c7ra06853k. [13] Y. Yang, Y. Shi, Spectrin-like domain 2 of DRP2 serves as a novel binding region for the NLS2 and

3

sub-domains

of

L-periaxin,

Rsc

Advances.

5

(2015)

84356-84366.

https://doi.org/10.1039/C5RA12703C. [14] A. Raasakka, H. Linxweiler, P.J. Brophy, D.L. Sherman, P. Kursula, Direct Binding of the Flexible C-Terminal Segment of Periaxin to beta4 Integrin Suggests a Molecular Basis for CMT4F, Front Mol

of

Neurosci. 12 (2019) 84. https://doi.org/10.3389/fnmol.2019.00084.

ro

[15] A.R. Dukic, P. Gerbaud, J. Guibourdenche, B. Thiede, K. Tasken, G. Pidoux, Ezrin-anchored PKA

-p

phosphorylates serine 369 and 373 on connexin 43 to enhance gap junction assembly, communication, and cell fusion, Biochem J. 475 (2018) 455-476. https://doi.org/10.1042/bcj20170529.

re

[16] R.G. Fehon, A.A. Mcclatchey, Organizing the cell cortex: the role of ERM proteins, Nat Rev Mol

lP

Cell Biol. 11 (2010) 276-287. https://doi.org/10.1038/nrm2866. [17] B. Biri-Kovács, B. Kiss, H. Vadászi, G. Gógl, G. Pálfy, G. Török, L. Homolya, A. Bodor, L.

na

Nyitray, Ezrin interacts with S100A4 via both its N- and C-terminal domains, PloS One. 12 (2017) e0177489. https://doi.org/10.1371/journal.pone.0177489.

Jo ur

[18] T.A. Martin, G. Harrison, R.E. Mansel, W.G. Jiang, The role of the CD44/ezrin complex in cancer metastasis,

Crit

Rev

Oncol

Hematol.

46

(2003)

165-186.

https://doi.org/10.1016/S1040-8428(02)00172-5. [19] H. Celik, K.P. Sajwan, S.P. Selvanathan, B.J. Marsh, A.V. Pai, Y.S. Kont, J. Han, T.Z. Minas, S. Rahim, H.V. Erkizan, J.A. Toretsky, A. Uren, Ezrin Binds to DEAD-Box RNA Helicase DDX3 and Regulates

Its

Function

and

Protein

Level,

Mol

Cell

Biol.

35

(2015)

3145-3162.

https://doi.org/10.1128/mcb.00332-15. [20] V. Horwitz, B. Davidson, D. Stern, C.G. Tropé, R.e.T. Tavor, R. Reich, Ezrin Is Associated with Disease

Progression

in

Ovarian

Carcinoma,

PloS

One.

11

(2016)

e0162502.

https://doi.org/10.1371/journal.pone.0162502. [21] C.L. Gatto, B.J. Walker, L. Stephen, Local ERM activation and dynamic growth cones at Schwann cell tips implicated in efficient formation of nodes of Ranvier, J Cell Biol. 162 (2003) 489-498. https://doi.org/10.1083/jcb.200303039.

Journal Pre-proof [22] M. Kazuki, S. Nortina, U. Thirugnanam, C. Yee-Cheun, H. Koichi, Y. Nobuhiro, Are ERM (ezrin/radixin/moesin) proteins targets for autoantibodies in demyelinating neuropathies?, Hum Immunol. 75 (2014) 1089-1091. https://doi.org/10.1016/j.humimm.2014.09.010. [23] R. Maddala, N.P. Skiba, R.L. Iii, D.L. Sherman, P.J. Brophy, P.V. Rao, Periaxin is required for hexagonal geometry and membrane organization of mature lens fibers, Dev Biol. 357 (2011) 179-190. https://doi.org/10.1016/j.ydbio.2011.06.036. [24] B.K. Straub, B. Judit, K. Caecilia, S. Martina, K. Ulrike, K. Tore, S. Herbert, H. Mechthild, W.W. Franke, A novel cell-cell junction system: the cortex adhaerens mosaic of lens fiber cells, J Cell Sci.

of

116 (2003) 4985-4995. https://doi.org/10.1242/jcs.00815.

ro

[25] C. Chartier, E. Degryse, M. Gantzer, A. Dieterle, A. Pavirani, M. Mehtali, Efficient generation of

-p

recombinant adenovirus vectors by homologous recombination in Escherichia coli, J Virol. 70 (1996) 4805-4810. https://doi.org/10.1016/0166-0934(96)02096-4.

re

[26] S. Poliak, S. Matlis, C. Ullmer, S.S. Scherer, E. Peles, Distinct claudins and associated PDZ

lP

proteins form different autotypic tight junctions in myelinating Schwann cells, J Cell Biol. 159 (2002) 361-372. https://doi.org/10.1083/jcb.200207050.

na

[27] S. Poliak, D. Salomon, H. Elhanany, H. Sabanay, B. Kiernan, L. Pevny, C.L. Stewart, X. Xu, S.Y. Chiu, P. Shrager, A.J. Furley, E. Peles, Juxtaparanodal clustering of Shaker-like K+ channels in

Jo ur

myelinated axons depends on Caspr2 and TAG-1, J Cell Biol. 162 (2003) 1149-1160. https://doi.org/10.1083/jcb.200305018. [28] T.K. Kerppola, Bimolecular fluorescence complementation (BiFC) analysis as a probe of protein interactions

in

living

cells,

Annu

Rev

Biophys.

37

(2008)

465-487.

https://doi.org/10.1146/annurev.biophys.37.032807.125842. [29] J. Wang, W. Guo, C. Long, H. Zhou, H. Wang, X. Sun, The split Renilla luciferase complementation assay is useful for identifying the interaction of Epstein-Barr virus protein kinase BGLF4

and

a

heat

shock

protein

Hsp90,

Acta

Virol.

60

(2016)

62-70.

https://doi.org/10.4149/av_2016_01_62. [30] B.W. Zhang, L.I. Bo, W.S. Xia, L. Ding, Selection of Models in the Calculation of Binding Constants in the Study of Interaction between Molecules by Fluorescence Spectroscopy, Progress in Pharmaceutical Sciences. (2011). [31] A.M. Kalender, A. Dogan, V. Bakan, H. Yildiz, M.A. Gokalp, M. Kalender, Effect of Zofenopril

Journal Pre-proof on regeneration of sciatic nerve crush injury in a rat model, J Brachial Plex Peripher Nerve Inj. 4 (2009) 6. https://doi.org/10.1186/1749-7221-4-6. [32] F. Bobinski, D.F. Martins, T. Bratti, L. Mazzardo-Martins, E.C. Winkelmann-Duarte, L.G. Guglielmo, A.R. Santos, Neuroprotective and neuroregenerative effects of low-intensity aerobic exercise

on

sciatic

nerve

crush

injury

in

mice,

Neuroscience.

194

(2011)

337-348.

https://doi.org/10.1016/j.neuroscience.2011.07.075. [33] F.C. Tsai, A. Bertin, H. Bousquet, J. Manzi, Y. Senju, M.C. Tsai, L. Picas, S. Miserey-Lenkei, P. Lappalainen, E. Lemichez, Ezrin enrichment on curved membranes requires a specific conformation or

of

interaction with a curvature-sensitive partner, Elife. 7 (2018). https://doi.org/10.7554/eLife.37262.

ro

[34] E.R. Ferreira, A. Bonfim-Melo, E.M. Cordero, R.A. Mortara, ERM Proteins Play Distinct Roles in

-p

Cell Invasion by Extracellular Amastigotes of Trypanosoma cruzi, Front Microbiol. 8 (2017) 2230. https://doi.org/10.3389/fmicb.2017.02230.

re

[35] K.M. Brennan, Y. Bai, C. Pisciotta, S. Wang, S.M.E. Feely, M. Hoegger, L. Gutmann, S.A. Moore,

with

Charcot–Marie–Tooth

lP

M. Gonzalez, D.L. Sherman, Absence of Dystrophin Related Protein-2 disrupts Cajal bands in a patient disease,

Neuromuscul

Disord.

25

(2015)

786-793.

na

https://doi.org/10.1016/j.nmd.2015.07.001.

[36] D.L. Sherman, C. Fabrizi, C.S. Gillespie, P.J. Brophy, Specific disruption of a schwann cell

Jo ur

dystrophin-related protein complex in a demyelinating neuropathy, Neuron. 30 (2001) 677-687. https://doi.org/10.1016/S0896-6273(01)00327-0.

Figure captions Fig. 1. Schematic structures of L-periaxin and ezrin. Amino acid residues in each domain are numbered on top of the diagram. (A) L-periaxin comprises a PDZ domain, a NLS region, a repeat

Journal Pre-proof domain and an acidic domain in. The NLS region includes the NLS1, NLS2, and NLS3 regions. (B) The N-terminal of ezrin is the FERM domain, which is composed of three subdomains (F1, F2, and F3). The C-terminal of ezrin contains the actin-binding domain with a phosphorylation site (Thr567). The FERM domain and actin-binding domain are connected by a coiled-coil structure. (C) A schematic representation of the L-PRX and ezrin fusion proteins used in this study. RN (Nterminus: 1–229

residues of Renilla luciferase) is fused in frame to the N-terminus of truncated L-PRX. RC (C-terminus: 230–311 residues of Renilla luciferase) is fused in frame to the C-terminus of truncated ezrin. YN (Nterminus: 1–155 residues of YFP) is fused in frame to the C-terminus of

of

truncated L-PRX. YC (C-terminus: 156–239 residues of YFP) is fused in frame to the N-terminus

-p

ro

of truncated ezrin.

Fig. 2. L-PRX interacts with ezrin. (A) Co-localization of L-PRX (red) and ezrin (green) in RSC96.

re

The nuclei of all cells were stained blue with 4′,6-diamidino-2-phenylindole (DAPI), analyzed with FITC and TRITC fluorescence, and imaged at 60× magnification. The overlap of staining appears

lP

yellow in the merged images. Scale bar: 10 μm. (B) Immunohistochemical analysis of MBP (blue),

na

L-PRX (red) and ezrin (green) in adult rat sciatic nerves. MBP was detected as a compact myelin marker. The transverse section of sciatic nerve indicated that L-PRX and ezrin were expressed and

Jo ur

co-localized in a collar of staining in the abaxonal plasma membrane. The merge of L-PRX and ezrin appeared yellow in the merged images. Scale bar: 15 μm. (C) The verification of interaction between endogenous L-PRX and ezrin by Co-IP. RSC96 lysates were subjected to co-immunoprecipitation by using anti-IgG or anti-Myc as indicated and analyzed by Western blot with anti-Flag, anti-Myc, and anti-IgG antibodies. One tenth of the lysates was run as input. L-PRX: 147 KDa; ezrin: 80KDa. (D) SDS PAGE analysis shows that pure GST and GST-ezrin were used in the GST pull-down assay. (E) GST pull-down assay to evaluate the interaction between L-PRX and ezrin. Myc-tagged L-PRX expressed in RSC96 cells was pulled down with GST and GST-fused ezrin. Bound proteins were probed with anti-Myc or anti-GST antibodies as indicated. One tenth of the lysates was run as input. Myc-L-PRX: 147 KDa; GST-ezrin: 113 KDa; GST: 26 KDa.

Fig. 3. L-PRX interacts with ezrin by a "head to head and tail to tail" mode.(A) Verification of interaction between L-PRX (1-1461) and ezrin (1-296), ezrin (297-474), and ezrin (475-585) by Co-IP.

Journal Pre-proof RSC96 cells were transfected with the indicated plasmids for 48 h and then lysed. Lysates were subjected to co-immunoprecipitation by using anti-Myc, as indicated. The lysates were then analyzed by Western blot with anti-Flag. One tenth of the lysate was run as input. Myc-L-PRX (1-1461): 148 KDa; Flag-ezrin (1-296): 33 KDa; Flag-ezrin (297-474): 20 KDa; Flag-ezrin (475-585): 12 KDa. (B) The verification of interaction between ezrin (1-585) and L-PRX (1-200), L-PRX (194-1059), L-PRX (1060-1461) by Co-IP. RSC96 cells were transfected with the indicated plasmids for 48 h and lysed. Lysates were subjected to co-immunoprecipitation by using anti-Flag, as indicated, and then analyzed by Western blot with anti-Myc. One tenth of the lysate was run as input. Flag-ezrin (1-585): 81 KDa;

of

Myc-L-PRX (1-200): 23 KDa; Myc-L-PRX (194-1059): 96 KDa; Myc-L-PRX (1060-1461): 46 KDa.

ro

(C) The verification of interaction of L-PRX (1060-1461) with ezrin (1-296) and ezrin (475-585) by

-p

Co-IP. RSC96 cells were transfected with the indicated plasmids for 48 h and lysed. Lysates were subjected to co-immunoprecipitation by using anti-Myc, as indicated, and then analyzed by Western

re

blot with anti-Flag. One tenth of the lysates was run as input. Myc-L-PRX (1060-1461): 46 KDa;

lP

Flag-ezrin (1-296): 33 KDa; Flag-ezrin (475-585): 12 KDa. (D) The verification of interaction of ezrin (1-296) with L-PRX (1-200) and L-PRX (1060-1461) by Co-IP. RSC96 cells were transfected with the

na

indicated plasmids for 48 h and lysed. Lysates were subjected to co-immunoprecipitation by using anti-Flag, as indicated, and then analyzed by Western blot with anti-Myc. One tenth of the lysates was

Jo ur

run as input. Flag-ezrin (1-296): 33 KDa; Myc-L-PRX (1-200): 23 KDa; Myc-L-PRX (1060-1461): 46 KDa. (E) BiFc assay to evaluate the interaction of L-PRX(1-200) with L-PRX (1060-1461), ezrin (1-296), and ezrin (475-585). Scale bar: 10 μm.

Fig. 4. N-terminal binding of L-PRX and ezrin depends on the NLS3 and F3 domains. (A) The verification of interaction of FERM domain with PDZ, PDZ-NLS1, PDZ-NLS2 and PDZ-NLS3 by Co-IP. RSC96 cells were transfected with the indicated plasmids for 48 h and lysed. Lysates were subjected to co-immunoprecipitation by using anti-Flag, as indicated, and then analyzed by Western blot with anti-GFP. One tenth of the lysates was run as input. Flag-FERM: 33 KDa; GFP-PDZ: 37 KDa; GFP-PDZ-NLS1: 38 KDa; GFP-PDZ-NLS2: 38 KDa; GFP-PDZ-NLS3: 38 KDa. (B) Reversible Renilla luciferase protein complementation assays were performed to evaluate interactions of PDZ-NLS3 with F1, F2, and F3 (R: Renilla (1-311 aa); RN: Renilla-N (230-311 aa); RC: Renilla-C (1-229 aa)). Values are expressed as the mean ± SD of three determinations from independent

Journal Pre-proof experiments. The asterisk denotes statistically significant difference, *p < 0.05, compared with the group co-transfected with pNRL-C (1-299 aa)-Linker and pCRL-N (230-311 aa)-Linker. (C) The verification of interaction of PDZ-NLS3 with F1, F2, and F3 by Co-IP. RSC96 cells were transfected with the indicated plasmids for 48 h and lysed. Lysates were subjected to co-immunoprecipitation by using anti-GFP, as indicated, and then analyzed by Western blot with anti-Flag. One tenth of the lysates was run as input. GFP-PDZ-NLS3: 38 KDa; Flag-F1: 11 KDa; Flag-F2: 12 KDa; Flag-F3: 11 KDa. (D) The interaction of F3 with PDZ-NLS, PDZ-NLS1, PDZ-NLS2, and NLS3 was investigated by

of

fluorescence spectrometry at room temperature.

ro

Fig. 5. C-terminal binding of L-PRX and ezrin depends on L-PRX (1368-1461) and ezrin (475-557). (A) BiFc assay to evaluate the interaction of L-PRX (1060-1367) and L-PRX (1368-1461)

-p

with ezrin (1-585), ezrin (475-557), ezrin (558-585). Scale bar: 10 μm. (B) The verification of

re

interaction of L-PRX (1060-1367) and L-PRX (1368-1461) with ezrin (475-585) by Co-IP. RSC96

lP

cells were transfected with the indicated plasmids for 48 h and lysed. Lysates were subjected to co-immunoprecipitation by using anti-GFP, as indicated, and then analyzed by Western blot with

na

anti-Flag. One tenth of the lysate was run as input. GFP-L-PRX (1060-1367): 60 KDa; GFP-L-PRX (1368-1461): 35 KDa; Flag-ezrin (475-585): 12 KDa. (C) The verification of the interaction of L-PRX

Jo ur

(1368-1461) with ezrin (475-557) and ezrin (558-585) by Co-IP. RSC96 cells were transfected with the indicated plasmids for 48 h and lysed. Lysates were subjected to co-immunoprecipitation using anti-GFP as indicated, and then analyzed by Western blot with anti-Flag. One tenth of the lysates was run as input. GFP-ezrin (475-557): 34 KDa; GFP-ezrin (558-585): 28 KDa; Flag-L-PRX (1368-1461): 11 KDa.

Fig. 6. The self-association of L-PRX is inhibited by ezrin. (A) Flow cytometer diagrams of HeLa cells transfected with pYN and pYC; pYN-L-PRX (104-200), pYC-L-PRX (1060-1367) and pCMV-Tag3B; and pYN-L-PRX, pYC-L-PRX, and pCMV-Tag3B-ezrin (1-585). (B) A competitive Co-IP experiment was conducted to examine whether ezrin affects L-PRX self-association. RSC96 co-transfected

with

pEGFP-L-PRX

(104–200),

pCMV-Tag2B-L-PRX

(1060–1367),

and/or

pCMV-Tag3B-ezrin (1-585). The RSC96 lysates were subjected to co-immunoprecipitation by anti-IgG or anti-GFP and analyzed by Western blot by using anti-GFP, anti-Flag, anti-Myc, and anti-IgG

Journal Pre-proof antibodies. One tenth of the lysate was run as the input. GFP-L-PRX (14-102): 35 KDa; Flag-L-PRX (1060-1367): 34 KDa; Myc-ezrin (1-585): 81 KDa.

Fig. 7. A phosphorylation-mimicking mutation of ezrin increases the cytomembrane localization of L-PRX. (A) The localization of L-PRX (red) in RSC96 (WT, Ad-shEzrin). The nuclei of all cells were stained blue with 4′,6-diamidino-2-phenylindole (DAPI), analyzed with TRITC fluorescence, and imaged at 60× magnification. Scale bar: 10 μm. (B) The quantitative analysis of L-PRX expression on the cytomembrane or in the cytoplasm. Values are expressed as mean ± SD of three statistics for 100

of

cells, *p <0.05 compared with the RSC96 (WT) group. (C) The cytoplasm and cytomembrane were

ro

separated, and Western blot was used to determine the distribution of L-PRX in RSC96 (WT) or RSC96 (Ad-shEzrin). β-actin served as the internal control (Cy: cytoplasm, CM: cytomembrane).

-p

L-PRX: 147 KDa; ezrin: 80 KDa; β-actin: 45 KDa. (D) Quantitative analysis of the distribution of

re

L-PRX in the two fractions normalized to the internal control level. The protein levels of L-PRX in the

lP

RSC96(WT) group were arbitrarily defined as 1.0. *p <0.05. (E) Co-localization of L-PRX (red) and ezrin (WT, T567/E, T567/A; (green) in RSC96. RSC96 cells grown on glass coverslips were

na

transfected with the ezrin (WT, T567/E, T567/A). The nuclei of all cells were stained blue with 4′,6-diamidino-2-phenylindole (DAPI), analyzed with FITC and TRITC fluorescence, and imaged at

Jo ur

60× magnification. Scale bar: 10 μm. (F) The mathematical statistics of RSC96 cells and the successful detection of the immunofluorescence signal on the cytomembrane or in the cytoplasm. Values are expressed as the mean ± SD of three statistics for 100 cells, *p <0.05 compared with the Flag-ezrin (WT) group. (G) The cytoplasm and cytomembrane were separated, and Western blot was performed to determine the distribution of L-PRX in RSC96 cells cultured with the Flag-ezrin (WT), Flag-ezrin (T567A), or Flag-ezrin (T567E). β-actin served as the internal control (Cy: cytoplasm, CM: cytomembrane). L-PRX: 147 KDa; ezrin: 80 KDa; β-actin: 45 KDa. (H) Quantitative analysis of the distribution of L-PRX in the two fractions normalized to the internal control level. The protein levels of L-PRX in the Flag-ezrin (WT) group were arbitrarily defined as 1.0. *p <0.05. (I) The verification of interaction between Myc-L-PRX and Flag-ezrin (T567A) by Co-IP. RSC96 lysates were subjected to co-immunoprecipitation with anti-IgG or anti-Myc, as indicated, and analyzed by Western blot by using anti-Flag, anti-Myc, and anti-IgG antibodies. One tenth of the lysates was run as input. Myc-L-PRX: 148 KDa; Flag-ezrin (T567A): 81 KDa. (J) The Verification of interaction between Myc-L-PRX and

Journal Pre-proof Flag-ezrin (T567E) by Co-IP. RSC96 lysates were subjected to co-immunoprecipitation with anti-IgG or anti-Myc, as indicated, and analyzed by Western blot using anti-Flag, anti-Myc, and anti-IgG antibodies. One tenth of the lysates was run as input. Myc-L-PRX: 148 KDa; Flag-ezrin (T567E): 81 KDa.

Fig. 8. Ezrin promotes remyelination in injured sciatic nerves. (A) Observations on the morphological changes of injured sciatic nerves after Ad-Ezrin or Ad-shEzrin administration in rats. The tissues were stained by uranium-lead and imaged by transmission electron microscope. Scale bar:

of

1.5 μm. (B) Immunohistochemical analysis of MBP (green), L-PRX (red) and nucleus (blue) in the

-p

ro

sciatic nerves of sham group, Saline group, Ad-Ezrin group and Ad-shEzrin group. Scale bar: 15 μm.

Fig. 9. Proposed model of the ezrin and L-PRX interaction and the model of DRP2-L-PRX-β4

re

integrin complex. In the inactive state, ezrin and L-PRX hold a self-associated conformation in the

lP

cytoplasm. When the self-association of L-PRX (inactive form) was broken, it can to be dock with inactive ezrin in cytoplasm and with active ezrin in cytomembrane by the "head to head and tail to tail"

na

mode. The active form of L-PRX also interacts with DRP2 and β4 integrin in the cytomembrane and

further research.

Jo ur

serves as a scaffold protein in PDG complex. But the relationship between the two models needs

Journal Pre-proof Highlights ·L-periaxin and ezrin interacted in a "head to head and tail to tail" mode in Schwann cells. ·A phosphorylation-mimicking mutation of ezrin resulted in L-periaxin accumulation on SC RSC96 membrane and inhibit the self-association of L-periaxin.

Jo ur

na

lP

re

-p

ro

of

·Ezrin overexpression in sciatic nerve injury rats could facilitate the repair of impaired myelin sheath.

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9