Familial adenomatous polyposis

Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207

Contents lists available at ScienceDirect

Best Practice & Research Clinical Gastroenterology

6

Familial adenomatous polyposis Finlay Macrae, MBBS (Hons1), MD, FRACP, FRCP (UK), AGAF, Professor a, *, D. du Sart b, S. Nasioulas b a

Department of Colorectal Medicine and Genetics and Familial Cancer Clinic, PO Box 2010, The Royal Melbourne Hospital, Melbourne, Victoria 3050, Australia b Victorian Clinical Genetic Services, Murdoch Childrens Research Institute, Parkville, Melbourne, Australia

Keywords: familial adenomatous polyposis APC gene MYH gene mutational analysis genetic counselling

A multimodal approach of complementary techniques targeting primarily truncating, deletion and rearrangement mutations provides a robust screening protocol that identifies the vast majority of pathogenic germline APC gene mutations in FAP patients. Patients in whom no mutation is identified through this mutation protocol, may be sub-cohorts representing a different FAP pathogenesis including MYH associated polyposis and somatic cell mosaicism for APC gene mutations. Ó 2009 Elsevier Ltd. All rights reserved.

Introduction Familial adenomatous polyposis (FAP) is an autosomal dominant disorder characterised by adenomatous polyposis in the colon and rectum, and frequently involves extracolonic manifestations. In classical FAP, adenomas occur in their hundreds to thousands in the adolescence or early adulthood, with cancers developing nearly invariably by the fifth decade and often a lot earlier. An attenuated form of the disease also exists, where adenomas are less numerous and presentation with adenomas and cancer is later. Because of the very high cancer risk, at present colectomy is advised in both the classical and attenuated forms of the disease once adenomas develop beyond mid teenage years. Duodenal adenomas are common, though cancer at this site is much less common. Other characteristics are pigmented ocular lesions, osteomas especially of the jaw, epidermoid cysts, adrenal adenomas and carcinomas, thyroid tumours, desmoid tumours, and dentition abnormalities. The population frequency is w1 in 8000 with w100% penetrance. FAP is thus a characteristic clinical syndrome for which the revolution in molecular diagnostics provided one of its earliest benefits. It was in the 1980s that the locus for what was then known as

* Corresponding author. Tel.: þ61 3 9347 0788; Fax: þ61 3 9348 2004. E-mail address: fi[email protected] (F. Macrae). 1521-6918/$ – see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.bpg.2009.02.010

198

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207

familial polyposis coli was identified on the 5th chromosome, through cytogenetic and molecular studies in a family in which mental retardation and polyposis tracked – implying a large genetic defect [1–3]. Subsequent molecular cloning traced the defect to a genetic locus named as the adenomatous polyposis coli (APC) gene [4], and uncovered its biology – a tumour suppressor gene, which, when mutated and therefore functionally deficient, was unable to sequester (ubiquitise) the proto-oncogene beta-catenin in its cytoplasmic traverse to the nucleus [5]. APC gene mutational analyses in series of FAP patients followed quickly [6]. The genetic basis of FAP indeed lies in the presence of a germline mutation of the APC gene, located within chromosome region 5q21–22. The APC gene consists of 15 exons with a combined open reading frame of 8532 base pairs and encodes a protein of 2843 amino acids. Approximately 95% of the germline mutations in the APC gene lead to the synthesis of a truncated protein and they are spread throughout the gene (Fig. 1). Major pathogenic mechanism of FAP The APC gene protein has tumour suppressor functions and is part of the Wnt pathway. APC forms a complex with the cytoplasmic proteins beta-catenin, axin and glycogen synthase kinase-3b and this complex induces beta-catenin degradation. Truncating mutations in the APC gene cause an aberrant accumulation of beta-catenin because the resultant protein lacks the c-terminal, beta-catenin binding domain. The APC protein is the mediator of beta-catenin degradation, and thereby down-regulates transcription exerted by the nuclear beta-catenin -Tcf complex. Unbridled without its suppression by the APC complex, the beta-catenin -Tcf complex leads to transcriptional activation of several genes and oncogenes like c-myc, a transcription factor for several genes controlling cell growth and division. This cascade of events ultimately leads morphologically to adenomatous polyp formation, which, by definition, have dysplasia, and are the precursor of the many colorectal cancers defined by the chromosomal instability pathway. This pathway generally results in microsatellite stable cancers. The key point of understanding here is that the same gene (APC) when mutated in the germline, is responsible for the autosomal dominant condition familial adenomatous polyposis, and when mutated somatically (e.g. in the colon), is also a key molecular event in sporadic colorectal cancer. In the case of the latter, each allele of the gene has been mutated, lost (‘loss of heterozygosity’, implying the deletion of all or a large component of this chromosome 5 in the tumour) or silenced (through methylation of its

Spectrum of mutations in APC gene β-catenin binding site β-catenin, GSK3 β, axin binding sites

Dimerization domain Armadillo repeats

1

3

9

AAPC codons 78-157

AAPC codons 312-412

11

14

Microtubule binding

APC gene structure

Exon 15

Profuse polyposis codons 1250-1464 CHRPE codons 463-1387

Desmoid tumours codons 1444-1578

Fig. 1. The APC gene and FAP.

Functional domains of APC gene

AAPC codons 1595-2843

Genotypephenotype correlations for APC gene and FAP

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207

199

promoter). With only two copies, each of us has but two chances to maintain the integrity of APC suppression process. Although one copy is enough for function of the APC gene, interference to the second allele has serious consequences, enabling beta-catenin to function unchecked, and drive myc associated proliferation and therefore (with a number of other key mutational events) neoplastic development. Families with FAP almost always harbour a germline mutation in the APC gene. Given its pivotal place in the Wnt pathway (see Fig. 2), it is no surprise that when the APC gene is inactivated by mutation and/or deletion or silencing, adenomas and then cancers develop. In a sense, APC mutation carriers are ‘primed’ for cancer development through the Wnt pathway, by harbouring a mutation in one of the APC alleles from birth. Minor pathogenic mechanisms of FAP A second mechanism involving the base-excision repair gene, MYH, has been shown to affect the APC gene, resulting in a milder variant of FAP. Patients who carry two germline mutations in the MYH gene have an increased rate of somatic APC gene mutations, which predisposes to polyp formation and cancer progression as a consequence of non-functional APC protein. For more detail on MYH associated polyposis, please see accompanying chapter on MYH. Somatic cell mosaicism for APC gene mutations is a third mechanism that could lead to FAP and is thought to occur in w20% of sporadic FAP cases [7]. Somatic cell mosaicism arises when a new mutation occurs in the APC gene post fertilisation and is present in only a subset of cell types or tissues. The timing of when the mutation occurs in embryogenesis, dictates the extent to which the mutation is present in different tissue types. In this situation, the cell type screened for mutation identification will have a critical impact on the result. For example, screening of blood may not reveal the presence of the APC gene mutation but screening of gut tissue may do so. Approximately 10–25% of FAP patients present as sporadic cases. Aretz S et al (2007) reported that 11% of the sporadic cases in their cohort indicated the presence of somatic cell mosaicism [8]; Hes FJ et al reported 21% in their sporadic FAP patients showed mosaicism [9].

cytoplasm

Non-functional protein APC protein

APC protein

nucleus

β-catenin

Binds to other proteins

APC, β-catenin, Axin and GSK3 complex

induces

β-catenin degradation

increased concentration of free β-catenin in nucleus

Cancer progression

Binds to other proteins Increases somatic mutations in APC

β-catenin TCF-4 complex

germline mutations in MYH gene

Activates transcription of several genes and oncogenes C-myc

Polyp formation *

Leads to

Increased cell division and inhibition of apoptosis

Wnt-pathway * including other tumours like: osteomas, periampullary carcinomas, hypertrophy of retinal pigment epithelium (CHRPE), and desmoids.

Fig. 2. APC protein functional pathway.

200

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207

Benefits of APC mutational analysis FAP generally has such a characteristic phenotype that one could question the need for a genotypic diagnosis. So why undertake genotyping? The advantages relate to the understanding of genotype–phenotype correlations, and the opportunities for predictive DNA testing of young family members at genetic risk, who can then be offered surveillance informed by their mutation status, or may be no surveillance at all – if they are identified as not carrying the family specific mutation. This essentially halves the number of family members that otherwise would need continuing annual or even bi-annual screening, and thus is quickly a cost effective strategy. Furthermore, the children of non-carriers do not need to be concerned about FAP risk, as the mutation cannot ‘skip’ generations. In addition, in some families with a very severe disease spectrum and early age onset of polyposis and tumours in childhood, parents have chosen prenatal testing for FAP or pre-implantation genetic diagnosis (PGD) for selection of unaffected embryos as part of their family planning options when the family pathogenic mutation is known. Consequently, genotyping makes an enormous impact on clinical management of these families. Phenotype genotype correlations There are certain sites on the APC gene which pre-dispose to specific phenotypic features. This correlation between the site of the APC gene mutation and the FAP phenotype is evident with a mild attenuated adenomatous polyposis (AAPC) usually observed when the mutation is at the 50 and 30 ends (between codons 78 and 157, 312 and 412, and 1595 and 2843) whereas severe classic FAP is seen when the mutation is in the middle of the APC gene, especially the well known 1309 codon (see Fig. 1). With the attenuated phenotype, adenomas are fewer and cancer often develops later. Though not generally accepted, a case can be made to simply observe (e.g. with annual colonoscopy removing polyps by snare polypectomy) these patients over several years before surgery. However, these observations on phenotype–genotype correlation are not invariable, and kindred are described where there are classic and attenuated phenotypes all with the same mutation. Kindred with mutations between codons 1250 and 1464 are associated with a dense rectal adenomatous phenotype, lending extra support to definitive excisional surgery (e.g. a proctocolectomy with ileal–anal anastomosis) to ablate any risk of large bowel cancer. So, these mid gene mutations could direct a surgical approach based on its prediction, rather than contemporary appearance, of dense rectal polyposis. Kindred with a mutation between codons 1444 and 1578 are associated with desmoid disease, accounting for some families where desmoid disease appears unusually frequently. Care should be taken in surgical decision making even for colectomy in these families, as the development of desmoid disease may be more hazardous than the risk of cancer from the polyposis. Clinical approach to gene testing in FAP Like many familial cancer syndromes, the approach to gene testing in a family involves: 1. Consultation with the proband in the family, to explain the benefits of gene testing for the patient and his/her family. 2. Pedigree assessment to decide whether the likely gene involved will be the APC or MYH gene. 3. Engaging a clearly affected family member in offering a DNA sample for mutational analysis of the APC or MYH gene 4. Once the family specific mutation has been identified, then offering other at risk family members the opportunity for predictive DNA testing for the family specific mutation. This usually means cascade testing of first degree relatives of carriers. Sometimes second degree relatives can be offered when a family member declines the offer of screening, or has died. The decision to test is based on the phenotype, and in particular, the number of adenomatous polyps the index case has had diagnosed. This means that a careful count of polyps is essential, either by the

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207

201

endoscopist over one or several procedures, or by the pathologist from a colectomy specimen. Endoscopic assessment is best done with dye spray enhancement of the colon using dilute indigo carmine or methylene blue (5 ml in 20 ml of normal saline), allowing 2 min between application and mucosal observation (‘dye beats the eye’). In our clinical practice, we accept a total count of 10 adenomas as enough to offer mutational analysis. If the pedigree indicates dominant (vertical) transmission, we would start with the APC gene, whereas if the pedigree indicates a recessive (horizontal) pedigree with no parents of children affected, then the MYH gene will be tested first. The vast majority of MYH families carry the G382D or Y165C mutations, so many services will test only for these mutations, reserving full sequencing for those found to have one of these mutations only, or for those who have higher numbers of adenomas and without the common MYH or APC mutations. Predictive DNA testing carries counselling responsibilities, as not all family members want to know the result of a gene test. This is especially the case where health care systems are not community rated, and health insurance is loaded where risk has been identified, for example, through gene testing. In the United States, private health insurance until recently could be difficult to access where genetic testing has uncovered a serious risk pre-disposition. In most other countries, health care is equally available regardless of genetic risk determination. On the other hand, life and income protection, and some other forms of insurance are affected in most countries by genetic testing results. Counselling needs to take these consequences of genetic testing into account. Family members contemplating predictive DNA testing are well advised to attend to matters of insurance, according to the circumstances in their country, and policies of their own insurer.

Gene testing strategies Methods to identify mutations in the APC gene are under continuing evolution. A range of different mutation screening methods can be used in genetic testing of the APC gene. Full gene sequencing, considered as the gold standard, allows detection of point mutations and small intragenic deletions/duplications which lead to protein truncating changes and missense changes in the gene protein product. However, as this testing strategy is costly and sequence analyses are labour intensive, due to the large size of the gene (open reading frame of APC is 8529 bp), many laboratories use initial screening assays to reduce the total amount of sequencing required. Screening assays like high resolution melt analysis (HRM), denaturing high pressure liquid chromatography (dHPLC), single strand conformation polymorphism analysis (SSCP) Denaturing gradient gel electrophoresis (DGGE) and protein truncation test (PTT) are techniques which allow scanning of the gene exons for changes which is then followed by targeted sequencing of regions indicated. The PTT assay will detect only changes which lead to truncation of the gene protein. All other methods including full gene sequencing, will detect all sequence changes including non-pathogenic changes like polymorphic variants and missense mutations with uncertain clinical significance. These changes with unknown clinical significance result in a huge dilemma concerning the clinical management of family members of affected patients. There is no clear indication whether surveillance and further screening needs to continue. Mutation screening methods which target only pathogenic mutations translate into the highest clinical impact and the most cost effective genetic testing. It is known that most of the mutations in the APC gene leading to FAP are truncating mutations. However, recent reports have indicated that intragenic deletions and genomic rearrangements also account for a further percent of pathogenic mutations. Previous reports indicate identifiable pathogenic APC mutations account for between 50 and 82% of FAP [6,10–17]. Factors that influence the rate of mutation detection are primarily the limitations of the techniques used in the analyses and perhaps an inexact diagnosis of FAP. All the methods listed above would fail to identify pathogenic changes such as intragenic deletions as well as rearrangements, because they all require an initial amplification of both normal and mutated sequences to enable a successful mutation detection outcome. The preliminary amplification of the APC DNA needed in order to have enough to perform the testing, can be confounded by mutations which affect, even delete, the primer sites for the polymerase chain reactions (PCR), in which case the allele carrying the mutation will not amplify. Only the good allele will amplify, so the mutation is entirely missed as

202

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207

a consequence. This is a problem common to all analytic methodologies that rely on amplification of the patients DNA before testing. Given that intragenic deletions and gene rearrangements are also gene changes that impact on the gene protein structure and function, and may also impact on the level of protein expression, these types of changes must also be included in any mutation screening protocol. Thus, PCR-independent techniques, like southern blotting or chromosome fluorescence in situ hybridisation (FISH) analysis or quantitative PCR assays like multiplex ligation-dependent probe amplification (MLPA) [18], or real time PCR should be included in the screening protocol. There have been a number of reports associating deletion and rearrangement mutations in the APC gene with FAP [19–23]. There are also reports on the presence of blocks of Alu repeat sequences within the intronic regions of the APC gene that may predispose to deletions and rearrangement changes [24,25]. Therefore, techniques used in the second stage screening should be aimed at overcoming the trap of conventional hi-resolution mutation scanning assays which do not detect large deletion or rearrangement mutations. The number of reported genomic deletions and rearrangements has increased as laboratories use techniques directed towards the detection of these types of gene alterations. Methods used for mutation screening The protein truncation test (PTT) assay starts with the coding sequence of the APC gene and then transcribes it into mRNA, which is then translated into the APC gene protein. In this assay, the size of the generated protein is compared to the size of the normal protein, to detect the presence of mutations leading to truncation of the protein. For exons 1–14, high quality RNA is required for testing and for exon 15, DNA is used. The RNA-PTT analysis of exons 1–14 identifies more mutations than other nonRNA-based detection methods. The study of Powel et al (1993) [14] identified 47% of their mutations within exons 1–14 by using RNA PTT, which is consistent with our experience (47% – unpublished). Non-RNA based methods identify between 4 and 26% mutations in exons 1–14 [10–12,15,16,20,26–29]. High quality RNA is best achieved through the use of transformed lymphoblast cell lines treated with a protein-synthesis-inhibitor to stop mutant RNA decay. The addition of a protein synthesis inhibitor (e.g. cyclohexamide) to reduce mutant RNA decay before RNA extraction, preserves the mutant mRNA and enhances the intensity of truncated fragments in the PTT. This enables clearer identification of truncated proteins above the constant background bands, decreasing the false negative rate and increasing the detection rate of the PTT [30]. However, it is thought that nonsense-mediated mRNA decay is not a major problem in detecting APC gene mutations [31], and therefore RNA-based PTT analysis without the use of cyclohexamide still gives good detection rates. The high resolution melt assay is a two step technique that first incorporates saturating DNAbinding fluorescent dye into the PCR product during amplification, then, during a melt reaction, detects the DNA becoming single stranded as the fluorescence is released. This melt process generates a specific trace pattern that shows a difference when there is a sequence difference in the DNA product. The assay will then indicate which region or gene exon may have a sequence change, and therefore requires assessment with sequencing. Other mutation scanning techniques operate on similar principles. SSCP exploits the tertiary structure of DNA single strands in specific physical conditions, e.g. temperature and ionic environment, to detect sequence differences. DGGE separates fragments with different sequences by detecting differences in the partially melted fragments in denaturing conditions. All these above assays will indicate specific regions for sequencing, where changes, variants or mutations, are identified. FISH is a good tool for detecting deletions and rearrangements in genes. The use of high resolution FISH can detect smaller changes within a few kilobases. The resolution of the FISH analysis can be increased by using smaller probes, or by using target DNA like stretched chromosomes or chromatin fibres. This is useful in detecting rearrangements like inversions of a few kb in size. In addition, a single FISH experiment can identify translocations between different chromosomes that may not be observed cytogenetically or identified with other molecular methods. Chromosome translocations can affect the level of gene expression, or prevent gene expression altogether due to position effect variegation or changes in translation direction, even though the whole genome is present and balanced.

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207

203

Quantitative real time PCR and MLPA can detect mutations when amplification has occurred from only one allele. Consequently, any type of mutation that prevents PCR amplification of the mutant allele will be detected. Quantitative real time PCR is a technique that determines the amount of product amplified at each PCR cycle by quantitation of fluorescence generated at end of each cycle. The amount of product amplified is directly proportional to the amount of starting template alleles. MLPA is a two stage assay that first hybridises and ligates probes to the specific gene regions, and these ligated probes are then amplified by PCR in a quantitative manner [18]. Both the above assays require comparative analysis with control samples and normalisation of data to generate values that indicate whether gene regions are deleted, or duplicated or normal. Though Southern blot analysis is labour intensive, not conducive to high-throughput screening and requires a large amount of DNA, it allows detection of gene rearrangements not detected by standard FISH or quantitative PCR analysis.

Suggested testing protocol Stage I: Stage II: Stage III:

Screening for mutations and/or high throughput sequencing Screening for deletion mutations Screening for DNA/chromosomal rearrangements Somatic mosaicism Other genes – MYH?

The Human Variome Project Sequencing will identify changes in the gene which may be clearly pathogenic. Mutations that introduce a stop codon into the transcription process through a frame shift in transcription, can be called pathogenic. Other changes are clearly normal variants, or polymorphisms, with no consequences for disruptive alteration to the APC protein. There is a third class of variant, unclassified, where the consequences in vivo are uncertain. These changes represent a serious challenge in interpretation for clinical predictive purposes, and are the reason for attention to the Human Variome Project (HVP). The HVP (http://www.humanvariomeproject.org) is an initiative of the Human Genetic Variation Society (HGVS) [32]. The HGVS aims to catalogue all variation across all genes in the human genome and annotate those variations with all known information that relates to the consequences of the variation. This will include phenotypes associated with the changes. For the APC gene, this task is being undertaken by the International Society for Gastrointestinal Hereditary Tumours (InSiGHT) through its Locus Specific Databases (LSDBs) housed on its website http://www.insight-group.org. The HVP is a critically important process required to facilitate the tasks of interpretation of unclassified variants as they are progressively uncovered through the increasing practices of gene sequencing in diagnostic and research laboratories world-wide. Unless we have a common ‘clearing house’ of such information publicly available, there will be intolerable delays in realising the full benefit of the revolution in diagnostic molecular genetics in which we are in the midst. InSiGHT and its membership are acutely aware of the need for the Human Variome Project and actively supporting it through its own LSDBs.

Appendix An effective strategy for APC gene mutational analysis Sample preparation DNA is isolated from 10 ml of EDTA blood with the nucleon extraction kit (Amersham). RNA is extracted from transformed lymphoblast cell lines after a pre-incubation in cyclohexamide (1 mg/ml) at 37  C for 2 h using the RNeasy minikit (Qiagen). cDNA synthesis is performed as per kit method (Roche).

204

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207

PTT assay The PTT assay is performed using a T7 reticulocyte lysate kit (Promega) which involves incorporation of 35S methionine to detect the protein products. The assay has been modified from previously published methods [14,33–37] by the addition of cyclohexamide before RNA isolation. Lymphoblasts are incubated for 2 h at 37  C at a final concentration of 0.1 mg/mL [30]. There are six overlapping PTT fragments (see Table 1). Sequencing of implicated regions to further characterise mutations follows identification of truncated protein. Sequencing Sequencing of individual exons from exons 1 to 14, including about 10 bases of intronic sequence on each end [5] and exons 15-1 to 15-7 [6] is performed using published methods. FISH analysis Probe isolation is performed by screening the RPCI-1 PAC library [38] with PCR primers specific for the APC gene (brain specific promoter, exons 6, 9 and 15-6). Two clones containing the brain specific promoter and exons 1–5 (163M2 and 319I6) and three clones containing exons 6–15 (257A10, 257D9, 74G23) are isolated. A previously published BAC clone, which contains the entire APC gene (6e10), is also used to screen the metaphase spreads [39]. PAC 72M20 maps on the short-arm of chromosome-5 and is used as a chromosome-5 tag on the metaphase spreads. The PAC and BAC clones were labelled with DIG or Biotin by nick translation according to the manufacture’s instructions (Roche). For each slide, 100 ng labelled DNA, 10 mg COT-1 DNA and 10 mg herring sperm DNA is suspended in 15 ml hybridisation mix (50% deionised formamide/10% dextran sulphate/5 SSCC). This is pre-annealed for 1 h at 37  C, before adding to chromosome slides and hybridising overnight at 37  C. Chromosome preparations are made from transformed lymphocyte cells as per standard cytogenetic protocols. Slide washing is performed at 60  C 0.1 SSC. Dual colour FISH is produced by first incubating in avidin-FITC, then with biotinylated goat anti-avidin and antidigoxygenin and finally with avidin-FITC and anti-mouse Texas Red, all for 30 min each. The slides are visualised with a fluorescent microscope equipped with a CCD camera using Photometrics V for windows imaging software. A minimum of 20 cells is analysed for each probe. Quantitative real time PCR Real time quantitative PCR with the TaqMan fluorescent probes is based on the 50 exonuclease activity of Taq polymerase to cleave the fluorescent labelled hybridisation probe during the extension phase of the PCR [40] and the fluorescence is captured by an optical system. The cycle at which the fluorescence rises above background is called the threshold cycle (Ct). There is a linear relationship

Table 1 PTT fragments and conditions for analysis of the APC gene. PCR fragment

Size bp

PCR conditions

Oligo name

Oligo sequence

Segment 1A (codons 1–431)

1293

Segment 1B (codons 251–832)

1780

Segment 1 (codons 1–811)

2468

Fragment 2 (codons 654–1263)

1869

Fragment 3 (codons 1029–1701)

2058

Fragment 4 (codons 1596–2338)

2266

60  C, 3.5 mM MgCl2, Qiagen HOT Star Taq 60  C, 3.5 mM MgCl2, Qiagen HOT Star Taq 66  C, 3.5 mM MgCl2, wax bead, AmpliTaq 59  C, 3.5 mM MgCl2, AmpliTaq 59  C, 1.5 mM MgCl2, wax bead, AmpliTaq 59  C, 3.5 mM MgCl2, wax bead, AmpliTaq

Seg.1 Int.50 Exon 9R Exon 7F 15B3b Seg. 1 Int.50 Seg. 1 Int.30 15AT7 15F3b 15ET7 15J3 15JT7 15Q3b

T7GCTGCAGCTTCATATGATC CATGCCTGGTTCATGAGC T7GAAACCGGCTCACATGATG GGGTAACACTGTAGTATTCAAAT T7GCTGCAGCTTCATATGATC CTGACCTATTATCATCATGTGG T7CAAATCCTAAGAGAGAACAACTGTC CAC AAT AAG TCT GTA TTG TTT CTT T7CTTAAATATTCAGATGAGCAGTTGAA GAG CCT CAT CTG TAC TTC TGC T7GCCCAGACTGCTTCAAAATTA CTTATTCCATTTCTACCAGGGGAA

Segment internal 50 and exon 7F T7 sequence: GGATCCTAATACGACTCACTATAGGGAGACCACCATG. Fragments 2, 3, 4 and 5 T7 sequence: GGATCCTAATACGACTCACTATAGGAACAGACCACCATG (Powell, 1998; Powell et al., 1993; van der Luijt et al., 1994; van der Luijt et al., 1996).

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207

205

within the exponential growth phase between the template copy number and the Ct value. Duplexing with an internal control gene (labelled with a different reporter dye) allows relative quantitation. This eliminates the need for all DNA samples to have the same amount of template DNA added at the beginning of the PCR reaction. The Ct value of the test probe and internal control probe are compared and normalised by calculating the 2^(2DCt) value. DCt is the Ct difference between the test exon and the control exon. 2DCt is the difference between the DCt value and an average DCt of the negative controls included in assay. The 2^(2DCt) value calculated shows that non-deleted samples have a value of 1 and deleted samples have a value of zero. In other words, a value below 0.5 has one copy of the APC gene exon being tested and a value above 0.5 has two copies of the APC gene exon. The quantitative real time PCR is carried out as a duplex PCR for the test exon, labelled with FAM and CFTR exon 24 as an internal control labelled with HEX, in a reaction volume of 25 ml using the Brilliant QPCR kit (Stratagene, Integrated Sciences). The TaqMan fluorescent probes are synthesised according to the Applied Biosystems primer-express software program, allowing a standard amplification thermal cycling conditions (denaturation 95  C for 10 min, and subsequent cycles of 95  C for 15 s and 60  C for 1 min for 40 cycles). Each exon specific PCR reaction mixture consists of 200 nM exon specific forward and reverse primers, 100 nM exon specific probe to a final concentration of 5.0 mM MgCl2 and 200 ng DNA sample. The CFTR forward and reverse primers are at a concentration of 200 nM each and the HEX labelled CFTR exon 24 probe was at a concentration of 400 nM. Amplifications are carried out in the iCycler detection system (Bio–Rad) and analyses are performed in triplicate using the iCycler iQ real time detection system software version 2.3 for windows. Southern blot analysis Ten mg DNA is digested with a minimum of seven restriction enzymes (EcoRI, BglI, NsiI, XbaI, DraI, HindIII, BamHI) and separated on 0.8% agarose gels. Denaturation and then transferred under alkaline conditions (0.1 M NaOH) with a charged nylon membrane (Hybond Nþ, Amersham). Cloned PCR fragments (from PTT analysis) are labelled with a32P dCTP by random priming. 150–200 ng denatured labelled probe is pre-annealed with 30 mg placental DNA and 2 mg herring sperm DNA in Church buffer for a minimum 30 min at 65  C to remove repeat sequences and hybridised overnight at 65  C. The final wash is at 0.1 SSC at 65  C. Filters are exposed to auto-radiographic film for 3–10 days. Multiplex ligation dependent probe amplification MLPA analysis is performed using kits from MRC-Holland (Amsterdam, The Netherlands). The kits include probes for each exon of the APC gene, control regions across the genome and further controls to check for adequate quality of DNA and efficient ligation. A total of 1 ml of DNA is used per MLPA reaction. MLPA PCR products are separated on an ABI3100 genetic analyser and interpreted using Genotyper version 2.0. Peak heights are exported to an Excel spreadsheet designed to assess the ratios or each test peak relative to all other peaks for that individual. Ratios of test peaks to control peaks and control peaks top other control peaks in each patient sample are compared to the same ratios obtained from two normal individuals which are included in each run. For normal sequences, a dosage quotient of 1.0 is expected.; if a deletion or duplication is present, the dosage quotient should be 0.5 and 1.5 respectively. Results ware deemed acceptable if the dosage quotient for control peaks fall within the range 0.8 to 1.2. A deletion is scored if the mean dosage quotient of the test to internal control peaks is less than 0.7, and a duplication is scored if the mean dosage quotient is 1.3 or greater.

Clinical key points  Familial adenomatous polyposis (FAP) is a highly penetrant inherited condition predisposing almost inevitably to colorectal cancer, which can be prevented by timely diagnosis and intervention with colectomy.

206

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207

 Attenuated forms exist which present at a later age with a smaller number of adenomatous polyps; these include families with recessively inherited MYH mutations.  Genotype phenotype correlation has some utility in surgical decision making, and establishing risk of desmoid disease.  Germline Mutations in the APC gene are responsible for FAP; one of a large number of mutations in the APC gene is usually identified through one of a variety of mutational analytic techniques.  Sequencing of the gene often is insufficient alone to detect all APC mutations due to cryptic changes such as large deletions or rearrangements, somatic mosaicism to identify the family specific mutation.  Identifying the family specific APC gene mutation through a clearly affected proband allows predictive testing to be offered to other family members, which has major cost efficiencies in family management and surveillance, and enhances opportunities for early diagnosis and prophylactic surgery.  Mutations in the APC gene are not only responsible for FAP when inherited, but also are a key molecular oncogenic event in colorectal cancer when occurring somatically.

Research key points  Families that do not harbour an APC or MYH mutation are likely to provide important new insights into the pathogenesis of colorectal cancer and are worthy of research focus.  Modifier genes and environmental influences affecting penetrance and expression of multiple adenomas need to be studied. This may inform common colorectal cancer aetiology as well.  Clinical management of families with attenuated APC using endoscopic ablation or polypectomy needs further research as to the level of confidence with which colorectal neoplasia can be controlled.  FAP is an ideal population for trials of chemoprevention against colorectal neoplasia.  APC and MYH mutational and phenotypic databases should form part of the Human Variome Project through the International Society for Gastrointestinal Hereditary Tumours.

References [1] Herrara L, Kakati S, Gibas L, et al. Brief clinical report: Gasrdner Syndrome in a man with interstitial deletion of 5q. Am J Med Genet 1986;25:473–6. [2] Bodmer WF, Bailey C, Bodmer J, et al. Localization of the gene for familial adenonmatous polyposis on chromosome 5. Nature 1987;328:614–6. [3] Hockey KA, Mulcahy MT, Montgomery P, Levitt S. Deletion of chromosome 5q and familial adenomatous polyposis. J Med Genet 1989;26:61–82. [4] Kinzler KW, Nilbert MC, Su LK, et al. Identification of FAP locus genes from chromosome 5q21. Science 1991;253:661–5. [5] Groden J, Thliveris A, Samowitz W, et al. Identification and characterization of the familial adenomatous polyposis coli gene. Cell 1991;66:589–600. [6] Miyoshi Y, Ando H, Nagase H, et al. Germ-line mutations of the APC gene in 53 familial adenomatous polyposis patients. Proc Natl Acad Sci U S A 1992;89:4452–6. [7] Tuohy TM, Burt RW. Somatic mosaicism: a cause for unexplained cases of familial adenomatous polyposis? Gut 2008;57: 10–2. [8] Aretz S, Stienen D, Friedrichs N, et al. Somatic mosaicism: a frequent cause of FAP. Hum Mutat 2007;28:985–92. [9] Hes FJ, Nielsen M, Bik WM, et al. Somatic APC mosaicism: an underestimated cause of polyposis coli. Gut 2008;57:71–6. [10] Armstrong JG, Davies DR, Guy SP, Frayling IM, Evans DG. APC mutations in familial adenomatous polyposis families in the Northwest of England. Hum Mutat 1997;10:376–80. [11] Dobbie Z, Spycher M, Mary JL, et al. Correlation between the development of extracolonic manifestations in FAP patients and mutations beyond codon 1403 in the APC gene. J Med Genet 1996;33:274–80.

F. Macrae et al. / Best Practice & Research Clinical Gastroenterology 23 (2009) 197–207

207

[12] Giarola M, Stagi L, Presciuttini S, et al. Screening for mutations of the APC gene in 66 Italian familial adenomatous polyposis patients: evidence for phenotypic differences in cases with and without identified mutation. Hum Mutat 1999;13: 116–23. [13] Nagase H, Miyoshi Y, Horii A, et al. Screening for germ-line mutations in familial adenomatous polyposis patients: 61 new patients and a summary of 150 unrelated patients. Hum Mutat 1992;1:467–73. [14] Powell SM, Petersen GM, Krush AJ, et al. Molecular diagnosis of familial adenomatous polyposis [see comments]. Comment in: SS N Engl J Med SS 1993 Dec 30;329(27): 2028–9. N Engl J Med 1993;329:1982-7. [15] van der Luijt RB, Khan PM, Vasen HF, et al. Molecular analysis of the APC gene in 105 Dutch kindreds with familial adenomatous polyposis: 67 germline mutations identified by DGGE, PTT, and southern analysis. Hum Mutat 1997;9:7–16. [16] Wallis YL, Morton DG, McKeown CM, Macdonald F. Molecular analysis of the APC gene in 205 families: extended genotype-phenotype correlations in FAP and evidence for the role of APC amino acid changes in colorectal cancer predisposition. J Med Genet 1999;36:14–20. [17] Aretz S, Stienen D, Uhlhaas S, et al. Large submicroscopic genomic APC deletions are a common cause of typical familial adenomatous polyposis. J Med Genet 2005;42:185–92. [18] Schouten JP, Mc Elgunn CJ, Waaijer R, et al. Relative quantification of 40 nucleic acid sequences by multiplex liganddependent amplification probe amplification. Nucleic acid Res 2002;30:e57. [19] Gayther S, Wells D, Gulati K, et al. Germline rearrangement of MCC and APC detected by pulsed field gel electrophoresis and fluorescent in situ hybridization [published erratum appears in Ann Hum Genet 1993 Oct;57(Pt 4):311]. Ann Hum Genet 1993;57:169–78. [20] Mandl M, Caspari R, Jauch A, et al. Familial adenomatous polyposis: a submicroscopic deletion at the APC locus in a family with mentally normal patients. Hum Genet 1996;97:204–8. [21] Pilarski RT, Brothman AR, Benn P, Shulman Rosengren S. Attenuated familial adenomatous polyposis in a man with an interstitial deletion of chromosome arm 5q. Am J Med Genet 1999;86:321–4. [22] Prosser J, Condie A, Wright M, et al. APC mutation analysis by chemical cleavage of mismatch and a protein truncation assay in familial adenomatous polyposis. Br J Cancer 1994;70:841–6. [23] van der Luijt RB, Tops CM, Khan PM, et al. Molecular, cytogenetic, and phenotypic studies of a constitutional reciprocal translocation t(5;10)(q22;q25) responsible for familial adenomatous polyposis in a Dutch pedigree. Genes Chromosomes Cancer 1995;13:192–202. [24] Cao X, Eu KW, Seow-Choen F, et al. Topoisomerase-I- and Alu-mediated genomic deletions of the APC gene in familial adenomatous polyposis. Hum Genet 2001;108:436–42. [25] Su LK, Kohlmann W, Ward PA, Lynch PM. Different familial adenomatous polyposis phenotypes resulting from deletions of the entire APC exon 15. Hum Genet 2002;111:88–95. [26] Giardiello FM, Petersen GM, Piantadosi S, et al. APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis. Gut 1997;40:521–5. [27] Olschwang S, Laurent-Puig P, Groden J, et al. Germ-line mutations in the first 14 exons of the adenomatous polyposis coli (APC) gene. Am J Hum Genet 1993;52:273–9. [28] Scott RJ, Meldrum C, Crooks R, et al. Hunter Family Cancer Service. Familial adenomatous polyposis: more evidence for disease diversity and genetic heterogeneity. Gut 2001;48:508–14. [29] Walon C, Kartheuser A, Michils G, et al. Novel germline mutations in the APC gene and their phenotypic spectrum in FAP kindreds. Hum Genet 1997;100:601–5. [30] Bateman JF, Freddi S, Lamande SR, et al. Reliable and sensitive detection of premature termination mutations using a protein truncation test designed to overcome problems of nonsense-mediated mRNA instability. Hum Mutat 1999;13: 311–7. [31] Su LK, Steinbach G, Sawyer JC, et al. Genomic rearrangements of the APC tumor-suppressor gene in familial adenomatous polyposis. Hum Genet 2000;106:101–7. [32] Cotton RG, Auerbach AD, Axton M, et al. Genetics: the Human Variome Project. Science 2008;322:861–2. [33] Powell SM. Direct analysis for familial adenomatous polyposis mutations. Methods Mol Biol 1998;92:251–66. [34] Powell SM. Direct analysis for familial adenomatous polyposis mutations. Mol Biotechnol 2002;20:197–207. [35] Roest PA, Roberts RG, Sugino S, et al. Protein truncation testing for rapid for rapid detection for translation-terminating mutations. Hum Mol Genet 1993;2:17–21. [36] van der Luijt R, Khan PM, Vasen H, et al. Rapid detection of translation-terminating mutations at the adenomatous polyposis coli (APC) gene by direct protein truncation test. Genomics 1994;20:1–4. [37] van der Luijt RB, Meera Khan P, Vasen HF, et al. Germline mutations in the 30 part of APC exon 15 do not result in truncated proteins and are associated with attenuated adenomatous polyposis coli. Hum Genet 1996;98:727–34. [38] Ioannou PA, Amemiya CT, Garnes J, et al. A new bacteriophage P1-derived vector for the propagation of large human DNA fragments. Nat Genet 1994;6:84–9. [39] Kenck C, Bugert P, Wilhelm M, Kovacs G. Duplication of an approximately 1.5 Mb DNA segment at chromosome 5q22 indicates the locus of a new tumour gene in nonpapillary renal cell carcinomas. Oncogene 1997;14:1093–8. [40] Holland PM, Abramson RD, Watson R, Gelfand DH. Detection of specific polymerase chain reaction product by utilising the 50 –30 exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci U S A 1991;88:7276–80.