- Email: [email protected]
Family-with-sequence-similarity-46, member A (Fam46a) gene is expressed in developing tooth buds
archives of oral biology 54 (2009) 1002–1007
available at www.sciencedirect.com
journal homepage: www.intl.elsevierhealth.com/journals/arob
Family-with-sequence-similarity-46, member A (Fam46a) gene is expressed in developing tooth buds Godfrey E. Etokebe a,*, Axel M. Ku¨chler b,c, Guttorm Haraldsen b,c, Maria Landin a, Harald Osmundsen a, Zlatko Dembic a a
Department of Oral Biology, Faculty of Dentistry, University of Oslo, Norway LIIPAT, Division of Pathology, Oslo University Hospital, Rikshospitalet, Norway c Institute of Pathology, University of Oslo, Oslo, Norway b
article info
abstract
Article history:
Objective: In search for possible novel genes that may be involved in tooth development, we
Accepted 16 August 2009
analysed the genome-wide transcriptome of developing mandibular tooth germs of mouse during embryonic and early life and selected family-with-sequence-similarity-46, member
Keywords:
A (Fam46a) gene for further expression analysis.
Mouse
Methods: We applied microarray, quantitative real time polymerase chain reaction and in
Fam46a gene
situ hybridisation methods for the expression study of the mouse Fam46a gene.
mRNA
Results: We found the family-with-sequence-similarity-46, member A (Fam46a) gene to be
Microarray
highly expressed and further verify its temporo-spatial expression in the mouse tooth.
qPCR
Conclusion: We have shown that Fam46a is expressed in ameloblasts’ nuclei of tooth germs
In situ hybridisation
and hypothesise that it might act together with morphogenetic factors important for the formation of enamel in mouse tooth. # 2009 Elsevier Ltd. All rights reserved.
1.
Introduction
Due to its suitability for both genetic and embryologic studies, the mouse has emerged as an important model for contemporary experimental studies on tooth development. Their set of teeth consists of an incisor and a posterior group of three molars, each located in their respective quadrant. The incisors are separated from the molars by a large intervening toothless region called diastema, which in other species contain the canines and the premolars. Molecular events that take place during tooth development from the initiation at E10 to E18 have been extensively studied. The key regulatory mechanism involved is the reciprocal interaction between the epithelium and the mesenchyme. This is composed mainly of secreted signal molecules and
growth factors. The most studied and universal signals include members of four conserved families: the transforming growth factor beta family with bone morphogenetic proteins and activins, the fibroblast growth factor family, the hedgehog (in teeth only sonic hedgehog, Shh) and the wingless families. These families comprise numerous molecules involved in the signal pathways from the cell surface receptors to transcription factors mediating the signals to the nucleus and regulating gene expression.1–13 The mouse genome contains a precise developmental program, which defines the geometry of the developing tooth organs. This information is believed to be sequentially converted into the three dimensional structure of the developing dentition3 via a complex series of genetic interactions. These interactions involve growth factors, transcription factors, signal receptors and diffusible morphogens that employ a
* Corresponding author at: IOB, University of Oslo, PB-1052 Blindern, 0316 Oslo, Norway. Tel.: +47 228 40316; fax: +47 228 40302. E-mail address: [email protected] (G.E. Etokebe). 0003–9969/$ – see front matter # 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.archoralbio.2009.08.005
archives of oral biology 54 (2009) 1002–1007
number of independent intracellular signalling pathways the exact time of expression and tissue specificity of genes involved in tooth development include now more than 300 genes,1,12 but the total repertoire is yet to be discovered. We wished to find novel genes involved in mouse tooth development and understand their roles. The Fam46a gene has three exons, a 1484-bp transcript that codes for 428-amino acid long soluble protein, and is located on mouse chromosome 9 at position 85,218,012-..757. It contains a domain of unknown function (DUF1693) whose product is weakly similar to Prion-like-(q/n-rich)-domain-bearing protein 44, isoform d of Caenorhabditis elegans. Because proteins that interact with the human FAM46A protein include Smad anchor for receptor activation protein, involved in SMAD signalling by transforming growth factor beta family of cytokines, the mouse Fam46a gene might be involved in cell proliferation and morphogenesis. Here we describe the temporal and spatial expression dynamics of Fam46a, a previously uncharacterised gene, in the context of tooth development.
2.
Materials and methods
2.1.
Experimental animals
Mice strain (CD-1) was used. Pregnant mice were killed by cervical dislocation and the pups by decapitation. The pregnant mice were killed daily between 11.5 (E11.5) and 20.5 (E20.5) days post-coitum (dpc) for their embryos while pups were killed daily between 21.5 days (D1) and 26.5 days (D5) postnatal (DPN), with the day of vaginal plug being set to 0.5 dpc and embryos staged according to Theiler criteria. Animals were kept according to the regulations of the Norwegian Gene Technology Act of 1994.
2.2. Tooth germs isolation, RNA extraction and microarray analysis Embryos and pup heads obtained as described above were immediately immersed in RNAlater (Ambion Inc., TX, USA), rinsed with and immersed in 1:1 RNAlater:phosphate buffered saline solution. First mandibular molar tooth germs were micro-dissected from 10 embryos/pups at each indicated developmental stages with most of the tooth follicle remaining with the tooth germ. Total ribonucleic acid was extracted from single tooth germs by using the Qiagen RNeasy Mini-kitTM and treated with deoxyribonuclease I according to manufacturer’s protocol (Ambion Inc.). Microarray analysis was performed in triplicate as described previously14 using murine oligo (30 k) microarrays slides that had been printed with the Operon murine v.3 oligo set (Qiagen GmbH, Hilden, Germany). The ANOVA facility of the Spotfire program was used to select genes which exhibited statistically significant differences in levels of expression ( p < 0.015) with respect to developmental stage. For this purpose the measured fluorescence intensities (median values, with background subtracted) were converted to log2-scale, and the log2-values were subjected to z-score normalisation. The z-score normalised values were used in subsequent ANOVA analysis.
1003
2.3. Reverse transcription of RNA and quantitative real time polymerase chain reaction analysis Total ribonucleic acid was used for complementary deoxyribonucleic acid synthesis by the RevertAid First Strand complementary DNA Synthesis Kits (Fermentas, Ontario, Canada) using oligo dT primers according to manufacturer’s protocol, and used further for quantitative real time polymerase chain reaction. For amplification of Fam46a, we used forward GEE-SF3 (atctcttagtgcggggcttcag) and reverse GEE-SR3 (tctctgctgctctccgatgtct) primers. For qPCR (in triplicates), the SYBR green chemistry was applied (Eurogentec, Lie`ge, Belgium) and performed in Mx3005 P thermocycler (Stratagene, La Jolla, CA, USA). For analysis, the MxPro software (Stratagene) and Relative Expression Software Tool (RESTTM; Corbett Research, USA) were used.
2.4. Tooth germ isolation and preparation for in situ hybridisation Mouse tooth germs were micro-dissected from individual embryos/pups heads at the various developmental stages and placed in 10% formalin at 4 8C for 24 h. The fixed tissue samples were embedded in paraffin for in situ hybridisation analysis.
2.5.
In situ hybridisation
Antisense (complementary) and sense riboprobes were prepared as follows: a 444 bp DNA fragment of Fam46a was generated from mouse genomic DNA using IFAM46AF (ctgaccaaaatgtcattcct) and IFAM46AR (ccaattgggtagagaccata) primers by standard 35 cycles of PCR (95 8C for 20 s, 52 8C for 20 s, and 72 8C for 1 min), and amplicons sub-cloned into pCR1IITOPO1 plasmid (Invitrogen Corporation, Carlsbad, CA, USA). The plasmid (pFAM46A.7) was checked by DNA sequencing in 3130 l genetic analyser automatic sequencer using the Big Dye 3.1v chemistry (Applied Biosytems). The pFAM46A.7 plasmid (5 mg) was used for riboprobe preparation as described by the DIG labelling protocol (Roche Applied Science, Mannheim, Germany). Tissue samples were sectioned and subjected to semiautomatic in situ hybridisation on the Ventana Discovery robot (Ventana, Tucson, AZ, USA) using the Ribo Map Kit (Ventana). Digoxigenated riboprobes were detected using the BlueMap kit (Ventana). Processed tissue slides were viewed under Nikon Eclipse E800 microscope and pictures taken by Nikon digotal sight DS-5M camera (Nikon Incorporate, NY, USA).
3.
Results
The transcriptional profile of the mandibular molar tooth germ area during mouse development14 contains genes of presently unknown function that follow the expression pattern of tooth-specific genes during various stages of mouse development (data not shown). One of them was the family-with-sequence-similarity-46 A (Fam46a) gene which
1004
archives of oral biology 54 (2009) 1002–1007
Table 1 – Comparison between microarray and quantitative real time polymerase chain reaction analyses of the Fam46a gene expression in the mouse tooth bud. Time point 19.5d 20.5d D2 D3 D5
Microarray expression 1.0 0.3 1.6 1.2 0.1
qPCR expression 1.0 0.8 1.6 1.9 0.0
The results were obtained by calculating the ratio between the Fam46a mRNA levels at indicated time points and the level at embryonic day 19.5 (E19.5).
3.1.
Fig. 1 – (A) Analysis of the level of Fam46a gene mRNA transcription in the developing tooth buds of the mouse by microarray. The mRNAs were extracted from tooth buds at embryonic days 11–20 (E11.5–E20.5), and at each of the first 4 days post-coitum (D1–D4). Y-axis shows the net median fluorescence intensity (NMFI). (B) The Fam46a mRNA expression as ascertained by quantitative real time polymerase chain reaction analysis from selected embryonic mouse tooth buds (at E15.5, 19.5 and 20.5) and post-coital mouse tooth buds (at D1–D4). The expression levels of Fam46a mRNA at indicated time points were compared to that obtained at E15.5 by the REST software. Error bars shows standard deviation of measurements done in triplicates.
showed a fluctuating level of transcripts in tooth buds from mouse embryos obtained daily between E11.5 and E20.5, and between day 1 (D1) and day 5 (D5) post-partum (Fig. 1). Due to the persistent low level of expression of the Fam46a gene between E12.5 and E15.5, we selected E15.5 level as the basis amount, which would be used as a measure in further verification by real time polymerase chain reaction. We thus wished to verify this expression pattern by real time polymerase chain analysis, and then investigate the localisation of the Fam46a messenger ribonucleic acid (mRNA) by in situ hybridisation during tooth development.
Quantitative real time polymerase chain reaction
The expression of Fam46a gene in tooth buds between E19.5 and E20.5 were compared to E15.5 by real time qPCR. A similar analysis was performed to compare the Fam46a expression at D1, D2, D3 and D4 to E15.5. Relative Expression Software Tool (RESTTM; Corbett Research, USA) analysis of the data is shown in Fig. 1B, indicating that the expression of the Fam46a gene was up-regulated from day E19.5 (in comparison to E15.5) to day E23.5 (or D3), before being down-regulated at the last day of measurement (E25.5, or D5). These increased and decreased levels were all significantly different (compared to E15.5). The expression had the fold increase of 5.01 times at E19.5 ( p = 0.015), 3.91 at E20 ( p = 0.016), 7.91 at E21.5 ( p < 0.001), 8.22 at E22.5 ( p < 0.001), and 9.27 at E23.5 ( p = 0.016), and a decrease in expression of 0.17 times at D5 ( p = 0.032). A comparison of variations in Fam46a gene expression obtained by the quantitative polymerase chain reaction analysis with those obtained by the microarray analysis for some selected time points is shown in Table 1. The result showed a good correlation between the quantitative polymerase chain reaction result and the microarray data.
3.2.
In situ hybridisation
The expression of Fam46a mRNA in the tooth bud of a molar was analysed by in situ hybridisation (Fig. 2A–E) from the early bud stage (E12.5) to the terminal differentiation stage (21.5 days; day 1 postnatal, D1). These assays were done independently and hybridisation intensities were thus not comparable. The expression of Fam46a shifts from initial (early bud stage) widespread expression in the dental sheet, oral epithelium, mesenchyme and in cells surrounding the tooth bud (Fig. 2A) to the tooth germbud, ectomesenchyme (Fig. 2B) at a later stage. However, the Fam46a mRNA expression becomes more pronounced in the dental papilla and the dental epithelium (Fig. 2C) at a cap stage. Then, at the early bell stage (E16.5), the Fam46a mRNA was still most abundant in the dental epithelium and the dental papilla (Fig. 2D). We began to find some differences at the late bell stage (E17.5) when the Fam46a transcript was expressed predominantly in the outer epithelium. However, the epithelium areas undergoing enamel production had stronger expression of the Fam46a then the adjacent areas with a lower generation of enamel in molars (Fig. 2E). At birth, the tissues of mouse incisor (D1)
archives of oral biology 54 (2009) 1002–1007
1005
Fig. 2 – In situ hybridisation of tooth germs with the Fam46a gene-derived ribonucleic acid probe at indicated time points during mouse development. Stages of odontogenesis are depicted at (A) E12.5/late dental lamina stage: dental sheet, oral epithelium and mesenchyme (400T). (B) E13.5/bud stage: tooth germbud, ectomesenchyme and oral epithelium (100T). (C) E14.5/early cap stage (molar): dental epithelium and dental papilla (200T). (D) Late cap stage (molar): dental papilla and dental epithelium (200T). (E) Bell stage (molar): outer dental papilla, inner dental epithelium and outer dental epithelium (100T). (F) D1/terminal tooth differentiation stage (incisor): ameloblast, enamel, dentin (100T). (G) D1/terminal tooth differentiation stage (incisor) negative control (with antisense ribonucleic acid probe) (100T).
1006
archives of oral biology 54 (2009) 1002–1007
showed that the Fam46a transcript (detected by the sense probe) was predominantly expressed in the ameloblasts’ nuclei (Fig. 2F), and this also correlated with the strong production of enamel. The antisense probe stained at background levels, indicating a clear predominance of the open reading frame transcript in these tissues (Fig. 2G).
4.
Discussion
The Fam46a gene has, so far, no specified role in the mouse. Its transcript was first detected in mus musculus 15 days embryo head as a complementary deoxyribonucleic acid clone (D930050G01Rik) in RIKEN full-length enriched cDNA library.15–17 The Fam46a mRNA is 1484 basepair long and encodes a predicted protein of 428 amino acids. This gene is located in the mouse genome at chromosome 9 E3.1 having three exons. Putative orthologues of this gene exist in many organisms, from insect to human. Putative domain homology search in databases revealed similarity to family of proteins containing a domain of unknown function (DUF1693) whose product is weakly similar to Prion-like(q/n-rich)-domain-bearing protein 44, isoform d of C. elegans, and a pfam domain that gave the name. Here we showed temporal and spatial expression pattern of the Fam46a gene during development of mouse teeth. This is the first study to show the Fam46a gene expression in dental tissues of mouse mandible. Microarray analysis of tooth germs showed a fluctuating time dependent expression profile of the Fam46a gene during development. The Fam46a mRNA was expressed at a relative steady level during the early stages of tooth germ development (E11.5–E13.5). This result was further corroborated by in situ hybridisation, which showed high expression of the Fam46a mRNA in the dental sheet, oral epithelium, and mesenchyme at E12.5; in the tooth germ bud, ectomesenchyme and oral epithelium at 13.5; and in the dental papilla and dental epithelium at E14.5. These regions of the developing tooth bud are known to correspond to the localisation of proliferating cells.18,19 At the later stage of tooth bud development (E16.5-D3), microarray analysis of Fam46a mRNA expression level revealed an average of 500-fold increase as compared to that of the early stage. This result was corroborated by quantitative polymerase chain reaction analysis, which showed a 6-fold average increase in Fam46a messenger ribonucleic acid expression at the same stage. The variation of the Fam46a gene expression between the early and late development stages suggests that it may be regulated at the transcription level.18,20 At the bell stage (E17.5), in situ hybridisation analysis of the Fam46a messenger ribonucleic acid showed that it was expressed in the outer and inner epithelium as well as in the dental papilla. This observation made it tempting to speculate that the Fam46a gene might be related to the proliferation, differentiation, and function of ameloblast as well as generation of enamel. This is consistent by the observation that the Fam46a mRNA was highly expressed in ameloblast nuclei at D1 of incisors. High expression of the Fam46a messenger ribonucleic acid in dental papilla may
indicate that it could also play a role in odontoblast differentiation and proliferation, as odontoblasts differentiate from precursor cells of the dental papilla.21 Since the mouse incisors grow constantly, the enamel is being constantly produced at their labial side. The in situ hybridisation showed that at D1, before the eruption of the incisors all the enamel producing cells were highly positive for the Fam46a sense transcript, as the antisense probe did not pick any message. Interestingly in humans, there are transcripts of the antisense strand (which does not contain an open reading frame) of the Fam46A cDNA detectable across various tissues.22 We find that this might be true also for the mouse Fam46a, as in situ hybridisation with the antisense Fam46a probe gave some background staining of tissues surrounding the incisor at day 1. The human Fam46a gene, an orthologue of the mouse Fam46a, has a product that might have sixteen potential protein interacting partners as determined by the yeast twohybrid system.23 In this system, the best interactions was demonstrated with the Smad anchor for receptor activation protein, which recruits SMAD family member 2 protein to the transforming growth factor beta receptor and high density lipoprotein binding protein. Therefore, Fam46A product might be involved in the transforming growth factor beta family signal transduction, which includes bone morphogenetic proteins and activins. These molecules and receptors are known to play important roles during development in processes such as cell proliferation, apoptosis, and differentiation. It is therefore tempting to anticipate that the mouse Fam46a gene might have a similar interaction with the corresponding orthologue of the zinc finger, FYVE domain containing 9 genes during mouse tooth development. In conclusion, this is the first time that the expression of the Fam46a gene was shown in developing mouse tooth germs of molars and incisors. The Fam46a gene is differently expressed in tooth buds both spatially and temporally, predominating in nuclei of cells that actively produce enamel in incisors. The expression pattern is consistent with the speculation that the Fam46a gene could be involved in cell proliferation, apoptosis and differentiation activities in tooth buds, and perhaps enamel production.
Conflict of interest None declared.
Acknowledgement We thank the Faculty of Dentistry, University of Oslo for the financial support of the project. Funding: Faculty of Dentistry, University of Oslo, Oslo, Norway. Competing interests: None declared. Ethical approval: Ethical approval given by the Norwegian Ethical Committee.
archives of oral biology 54 (2009) 1002–1007
references
1. Slavkin HC. 1987 Kreshover lecture. Gene regulation in the development of oral tissues. J Dent Res 1988;67(9): 1142–9. 2. Partanen AM, Thesleff I. Growth factors and tooth development. Int J Dev Biol 1989;33(1):165–72. 3. Slavkin HC. Molecular determinants of tooth development: a review. Crit Rev Oral Biol Med 1990;1(1):1–16. 4. Thesleff I, Vaahtokari A, Partanen AM. Regulation of organogenesis. Common molecular mechanisms regulating the development of teeth and other organs. Int J Dev Biol 1995;39(1):35–50. 5. Maas R, Bei M. The genetic control of early tooth development. Crit Rev Oral Biol Med 1997;8(1):4–39. 6. Thesleff I, Aberg T. Molecular regulation of tooth development. Bone 1999;25(1):123–5. 7. Jernvall J, Thesleff I. Reiterative signaling and patterning during mammalian tooth morphogenesis. Mech Dev 2000;92(1):19–29. 8. Miletich I, Sharpe PT. Normal and abnormal dental development. Hum Mol Genet 2003;12(Spec No 1):R69–73. 9. Thesleff I. Epithelial-mesenchymal signalling regulating tooth morphogenesis. J Cell Sci 2003;116(Pt 9):1647–8. 10. Tucker A, Sharpe P. The cutting-edge of mammalian development; how the embryo makes teeth. Nat Rev Genet 2004;5(7):499–508. 11. Tompkins K. Molecular mechanisms of cytodifferentiation in mammalian tooth development. Connect Tissue Res 2006;47(3):111–8. 12. Thesleff I. The genetic basis of tooth development and dental defects. Am J Med Genet A 2006;140(23):2530–5. 13. Kapadia H, Mues G, D’Souza R. Genes affecting tooth morphogenesis. Orthod Craniofac Res 2007;10(3):105–13.
1007
14. Osmundsen H, Landin MA, From SH, Kolltveit KM, Risnes S. Changes in gene-expression during development of the murine molar tooth germ. Arch Oral Biol 2007;52(9):803–13. 15. Kawai J, Shinagawa A, Shibata K, Yoshino M, Itoh M, Ishii Y, et al. Functional annotation of a full-length mouse cDNA collection. Nature 2001;409(6821):685–90. 16. Okazaki Y, Furuno M, Kasukawa T, Adachi J, Bono H, Kondo S, et al. Analysis of the mouse transcriptome based on functional annotation of 60, 770 full-length cDNAs. Nature 2002;420(6915):563–73. 17. Carninci P, Kasukawa T, Katayama S, Gough J, Frith MC, Maeda N, et al. The transcriptional landscape of the mammalian genome. Science 2005;309(5740):1559–63. 18. Shigemura N, Kiyoshima T, Kobayashi I, Matsuo K, Yamaza H, Akamine A, et al. The distribution of BrdU- and TUNELpositive cells during odontogenesis in mouse lower first molars. Histochem J 1999;31(6):367–77. 19. Xie M, Kobayashi I, Kiyoshima T, Yamaza H, Honda JY, Takahashi K, et al. Functional implication of nucleolin in the mouse first molar development. J Biol Chem 2007;282(32):23275–83. 20. Vainio S, Jalkanen M, Vaahtokari A, Sahlberg C, Mali M, Bernfield M, et al. Expression of syndecan gene is induced early, is transient, and correlates with changes in mesenchymal cell proliferation during tooth organogenesis. Dev Biol 1991;147(2):322–33. 21. Thesleff I, Keranen S, Jernvall J. Enamel knots as signaling centers linking tooth morphogenesis and odontoblast differentiation. Adv Dent Res 2001;15:14–8. 22. Matsuzaka Y, Tounai K, Denda A, Tomizawa M, Makino S, Okamoto K, et al. Identification of novel candidate genes in the diffuse panbronchiolitis critical region of the class I human MHC. Immunogenetics 2002;54(5):301–9. 23. Colland F, Jacq X, Trouplin V, Mougin C, Groizeleau C, Hamburger A, et al. Functional proteomics mapping of a human signaling pathway. Genome Res 2004;14(7):1324–32.
available at www.sciencedirect.com
journal homepage: www.intl.elsevierhealth.com/journals/arob
Family-with-sequence-similarity-46, member A (Fam46a) gene is expressed in developing tooth buds Godfrey E. Etokebe a,*, Axel M. Ku¨chler b,c, Guttorm Haraldsen b,c, Maria Landin a, Harald Osmundsen a, Zlatko Dembic a a
Department of Oral Biology, Faculty of Dentistry, University of Oslo, Norway LIIPAT, Division of Pathology, Oslo University Hospital, Rikshospitalet, Norway c Institute of Pathology, University of Oslo, Oslo, Norway b
article info
abstract
Article history:
Objective: In search for possible novel genes that may be involved in tooth development, we
Accepted 16 August 2009
analysed the genome-wide transcriptome of developing mandibular tooth germs of mouse during embryonic and early life and selected family-with-sequence-similarity-46, member
Keywords:
A (Fam46a) gene for further expression analysis.
Mouse
Methods: We applied microarray, quantitative real time polymerase chain reaction and in
Fam46a gene
situ hybridisation methods for the expression study of the mouse Fam46a gene.
mRNA
Results: We found the family-with-sequence-similarity-46, member A (Fam46a) gene to be
Microarray
highly expressed and further verify its temporo-spatial expression in the mouse tooth.
qPCR
Conclusion: We have shown that Fam46a is expressed in ameloblasts’ nuclei of tooth germs
In situ hybridisation
and hypothesise that it might act together with morphogenetic factors important for the formation of enamel in mouse tooth. # 2009 Elsevier Ltd. All rights reserved.
1.
Introduction
Due to its suitability for both genetic and embryologic studies, the mouse has emerged as an important model for contemporary experimental studies on tooth development. Their set of teeth consists of an incisor and a posterior group of three molars, each located in their respective quadrant. The incisors are separated from the molars by a large intervening toothless region called diastema, which in other species contain the canines and the premolars. Molecular events that take place during tooth development from the initiation at E10 to E18 have been extensively studied. The key regulatory mechanism involved is the reciprocal interaction between the epithelium and the mesenchyme. This is composed mainly of secreted signal molecules and
growth factors. The most studied and universal signals include members of four conserved families: the transforming growth factor beta family with bone morphogenetic proteins and activins, the fibroblast growth factor family, the hedgehog (in teeth only sonic hedgehog, Shh) and the wingless families. These families comprise numerous molecules involved in the signal pathways from the cell surface receptors to transcription factors mediating the signals to the nucleus and regulating gene expression.1–13 The mouse genome contains a precise developmental program, which defines the geometry of the developing tooth organs. This information is believed to be sequentially converted into the three dimensional structure of the developing dentition3 via a complex series of genetic interactions. These interactions involve growth factors, transcription factors, signal receptors and diffusible morphogens that employ a
* Corresponding author at: IOB, University of Oslo, PB-1052 Blindern, 0316 Oslo, Norway. Tel.: +47 228 40316; fax: +47 228 40302. E-mail address: [email protected] (G.E. Etokebe). 0003–9969/$ – see front matter # 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.archoralbio.2009.08.005
archives of oral biology 54 (2009) 1002–1007
number of independent intracellular signalling pathways the exact time of expression and tissue specificity of genes involved in tooth development include now more than 300 genes,1,12 but the total repertoire is yet to be discovered. We wished to find novel genes involved in mouse tooth development and understand their roles. The Fam46a gene has three exons, a 1484-bp transcript that codes for 428-amino acid long soluble protein, and is located on mouse chromosome 9 at position 85,218,012-..757. It contains a domain of unknown function (DUF1693) whose product is weakly similar to Prion-like-(q/n-rich)-domain-bearing protein 44, isoform d of Caenorhabditis elegans. Because proteins that interact with the human FAM46A protein include Smad anchor for receptor activation protein, involved in SMAD signalling by transforming growth factor beta family of cytokines, the mouse Fam46a gene might be involved in cell proliferation and morphogenesis. Here we describe the temporal and spatial expression dynamics of Fam46a, a previously uncharacterised gene, in the context of tooth development.
2.
Materials and methods
2.1.
Experimental animals
Mice strain (CD-1) was used. Pregnant mice were killed by cervical dislocation and the pups by decapitation. The pregnant mice were killed daily between 11.5 (E11.5) and 20.5 (E20.5) days post-coitum (dpc) for their embryos while pups were killed daily between 21.5 days (D1) and 26.5 days (D5) postnatal (DPN), with the day of vaginal plug being set to 0.5 dpc and embryos staged according to Theiler criteria. Animals were kept according to the regulations of the Norwegian Gene Technology Act of 1994.
2.2. Tooth germs isolation, RNA extraction and microarray analysis Embryos and pup heads obtained as described above were immediately immersed in RNAlater (Ambion Inc., TX, USA), rinsed with and immersed in 1:1 RNAlater:phosphate buffered saline solution. First mandibular molar tooth germs were micro-dissected from 10 embryos/pups at each indicated developmental stages with most of the tooth follicle remaining with the tooth germ. Total ribonucleic acid was extracted from single tooth germs by using the Qiagen RNeasy Mini-kitTM and treated with deoxyribonuclease I according to manufacturer’s protocol (Ambion Inc.). Microarray analysis was performed in triplicate as described previously14 using murine oligo (30 k) microarrays slides that had been printed with the Operon murine v.3 oligo set (Qiagen GmbH, Hilden, Germany). The ANOVA facility of the Spotfire program was used to select genes which exhibited statistically significant differences in levels of expression ( p < 0.015) with respect to developmental stage. For this purpose the measured fluorescence intensities (median values, with background subtracted) were converted to log2-scale, and the log2-values were subjected to z-score normalisation. The z-score normalised values were used in subsequent ANOVA analysis.
1003
2.3. Reverse transcription of RNA and quantitative real time polymerase chain reaction analysis Total ribonucleic acid was used for complementary deoxyribonucleic acid synthesis by the RevertAid First Strand complementary DNA Synthesis Kits (Fermentas, Ontario, Canada) using oligo dT primers according to manufacturer’s protocol, and used further for quantitative real time polymerase chain reaction. For amplification of Fam46a, we used forward GEE-SF3 (atctcttagtgcggggcttcag) and reverse GEE-SR3 (tctctgctgctctccgatgtct) primers. For qPCR (in triplicates), the SYBR green chemistry was applied (Eurogentec, Lie`ge, Belgium) and performed in Mx3005 P thermocycler (Stratagene, La Jolla, CA, USA). For analysis, the MxPro software (Stratagene) and Relative Expression Software Tool (RESTTM; Corbett Research, USA) were used.
2.4. Tooth germ isolation and preparation for in situ hybridisation Mouse tooth germs were micro-dissected from individual embryos/pups heads at the various developmental stages and placed in 10% formalin at 4 8C for 24 h. The fixed tissue samples were embedded in paraffin for in situ hybridisation analysis.
2.5.
In situ hybridisation
Antisense (complementary) and sense riboprobes were prepared as follows: a 444 bp DNA fragment of Fam46a was generated from mouse genomic DNA using IFAM46AF (ctgaccaaaatgtcattcct) and IFAM46AR (ccaattgggtagagaccata) primers by standard 35 cycles of PCR (95 8C for 20 s, 52 8C for 20 s, and 72 8C for 1 min), and amplicons sub-cloned into pCR1IITOPO1 plasmid (Invitrogen Corporation, Carlsbad, CA, USA). The plasmid (pFAM46A.7) was checked by DNA sequencing in 3130 l genetic analyser automatic sequencer using the Big Dye 3.1v chemistry (Applied Biosytems). The pFAM46A.7 plasmid (5 mg) was used for riboprobe preparation as described by the DIG labelling protocol (Roche Applied Science, Mannheim, Germany). Tissue samples were sectioned and subjected to semiautomatic in situ hybridisation on the Ventana Discovery robot (Ventana, Tucson, AZ, USA) using the Ribo Map Kit (Ventana). Digoxigenated riboprobes were detected using the BlueMap kit (Ventana). Processed tissue slides were viewed under Nikon Eclipse E800 microscope and pictures taken by Nikon digotal sight DS-5M camera (Nikon Incorporate, NY, USA).
3.
Results
The transcriptional profile of the mandibular molar tooth germ area during mouse development14 contains genes of presently unknown function that follow the expression pattern of tooth-specific genes during various stages of mouse development (data not shown). One of them was the family-with-sequence-similarity-46 A (Fam46a) gene which
1004
archives of oral biology 54 (2009) 1002–1007
Table 1 – Comparison between microarray and quantitative real time polymerase chain reaction analyses of the Fam46a gene expression in the mouse tooth bud. Time point 19.5d 20.5d D2 D3 D5
Microarray expression 1.0 0.3 1.6 1.2 0.1
qPCR expression 1.0 0.8 1.6 1.9 0.0
The results were obtained by calculating the ratio between the Fam46a mRNA levels at indicated time points and the level at embryonic day 19.5 (E19.5).
3.1.
Fig. 1 – (A) Analysis of the level of Fam46a gene mRNA transcription in the developing tooth buds of the mouse by microarray. The mRNAs were extracted from tooth buds at embryonic days 11–20 (E11.5–E20.5), and at each of the first 4 days post-coitum (D1–D4). Y-axis shows the net median fluorescence intensity (NMFI). (B) The Fam46a mRNA expression as ascertained by quantitative real time polymerase chain reaction analysis from selected embryonic mouse tooth buds (at E15.5, 19.5 and 20.5) and post-coital mouse tooth buds (at D1–D4). The expression levels of Fam46a mRNA at indicated time points were compared to that obtained at E15.5 by the REST software. Error bars shows standard deviation of measurements done in triplicates.
showed a fluctuating level of transcripts in tooth buds from mouse embryos obtained daily between E11.5 and E20.5, and between day 1 (D1) and day 5 (D5) post-partum (Fig. 1). Due to the persistent low level of expression of the Fam46a gene between E12.5 and E15.5, we selected E15.5 level as the basis amount, which would be used as a measure in further verification by real time polymerase chain reaction. We thus wished to verify this expression pattern by real time polymerase chain analysis, and then investigate the localisation of the Fam46a messenger ribonucleic acid (mRNA) by in situ hybridisation during tooth development.
Quantitative real time polymerase chain reaction
The expression of Fam46a gene in tooth buds between E19.5 and E20.5 were compared to E15.5 by real time qPCR. A similar analysis was performed to compare the Fam46a expression at D1, D2, D3 and D4 to E15.5. Relative Expression Software Tool (RESTTM; Corbett Research, USA) analysis of the data is shown in Fig. 1B, indicating that the expression of the Fam46a gene was up-regulated from day E19.5 (in comparison to E15.5) to day E23.5 (or D3), before being down-regulated at the last day of measurement (E25.5, or D5). These increased and decreased levels were all significantly different (compared to E15.5). The expression had the fold increase of 5.01 times at E19.5 ( p = 0.015), 3.91 at E20 ( p = 0.016), 7.91 at E21.5 ( p < 0.001), 8.22 at E22.5 ( p < 0.001), and 9.27 at E23.5 ( p = 0.016), and a decrease in expression of 0.17 times at D5 ( p = 0.032). A comparison of variations in Fam46a gene expression obtained by the quantitative polymerase chain reaction analysis with those obtained by the microarray analysis for some selected time points is shown in Table 1. The result showed a good correlation between the quantitative polymerase chain reaction result and the microarray data.
3.2.
In situ hybridisation
The expression of Fam46a mRNA in the tooth bud of a molar was analysed by in situ hybridisation (Fig. 2A–E) from the early bud stage (E12.5) to the terminal differentiation stage (21.5 days; day 1 postnatal, D1). These assays were done independently and hybridisation intensities were thus not comparable. The expression of Fam46a shifts from initial (early bud stage) widespread expression in the dental sheet, oral epithelium, mesenchyme and in cells surrounding the tooth bud (Fig. 2A) to the tooth germbud, ectomesenchyme (Fig. 2B) at a later stage. However, the Fam46a mRNA expression becomes more pronounced in the dental papilla and the dental epithelium (Fig. 2C) at a cap stage. Then, at the early bell stage (E16.5), the Fam46a mRNA was still most abundant in the dental epithelium and the dental papilla (Fig. 2D). We began to find some differences at the late bell stage (E17.5) when the Fam46a transcript was expressed predominantly in the outer epithelium. However, the epithelium areas undergoing enamel production had stronger expression of the Fam46a then the adjacent areas with a lower generation of enamel in molars (Fig. 2E). At birth, the tissues of mouse incisor (D1)
archives of oral biology 54 (2009) 1002–1007
1005
Fig. 2 – In situ hybridisation of tooth germs with the Fam46a gene-derived ribonucleic acid probe at indicated time points during mouse development. Stages of odontogenesis are depicted at (A) E12.5/late dental lamina stage: dental sheet, oral epithelium and mesenchyme (400T). (B) E13.5/bud stage: tooth germbud, ectomesenchyme and oral epithelium (100T). (C) E14.5/early cap stage (molar): dental epithelium and dental papilla (200T). (D) Late cap stage (molar): dental papilla and dental epithelium (200T). (E) Bell stage (molar): outer dental papilla, inner dental epithelium and outer dental epithelium (100T). (F) D1/terminal tooth differentiation stage (incisor): ameloblast, enamel, dentin (100T). (G) D1/terminal tooth differentiation stage (incisor) negative control (with antisense ribonucleic acid probe) (100T).
1006
archives of oral biology 54 (2009) 1002–1007
showed that the Fam46a transcript (detected by the sense probe) was predominantly expressed in the ameloblasts’ nuclei (Fig. 2F), and this also correlated with the strong production of enamel. The antisense probe stained at background levels, indicating a clear predominance of the open reading frame transcript in these tissues (Fig. 2G).
4.
Discussion
The Fam46a gene has, so far, no specified role in the mouse. Its transcript was first detected in mus musculus 15 days embryo head as a complementary deoxyribonucleic acid clone (D930050G01Rik) in RIKEN full-length enriched cDNA library.15–17 The Fam46a mRNA is 1484 basepair long and encodes a predicted protein of 428 amino acids. This gene is located in the mouse genome at chromosome 9 E3.1 having three exons. Putative orthologues of this gene exist in many organisms, from insect to human. Putative domain homology search in databases revealed similarity to family of proteins containing a domain of unknown function (DUF1693) whose product is weakly similar to Prion-like(q/n-rich)-domain-bearing protein 44, isoform d of C. elegans, and a pfam domain that gave the name. Here we showed temporal and spatial expression pattern of the Fam46a gene during development of mouse teeth. This is the first study to show the Fam46a gene expression in dental tissues of mouse mandible. Microarray analysis of tooth germs showed a fluctuating time dependent expression profile of the Fam46a gene during development. The Fam46a mRNA was expressed at a relative steady level during the early stages of tooth germ development (E11.5–E13.5). This result was further corroborated by in situ hybridisation, which showed high expression of the Fam46a mRNA in the dental sheet, oral epithelium, and mesenchyme at E12.5; in the tooth germ bud, ectomesenchyme and oral epithelium at 13.5; and in the dental papilla and dental epithelium at E14.5. These regions of the developing tooth bud are known to correspond to the localisation of proliferating cells.18,19 At the later stage of tooth bud development (E16.5-D3), microarray analysis of Fam46a mRNA expression level revealed an average of 500-fold increase as compared to that of the early stage. This result was corroborated by quantitative polymerase chain reaction analysis, which showed a 6-fold average increase in Fam46a messenger ribonucleic acid expression at the same stage. The variation of the Fam46a gene expression between the early and late development stages suggests that it may be regulated at the transcription level.18,20 At the bell stage (E17.5), in situ hybridisation analysis of the Fam46a messenger ribonucleic acid showed that it was expressed in the outer and inner epithelium as well as in the dental papilla. This observation made it tempting to speculate that the Fam46a gene might be related to the proliferation, differentiation, and function of ameloblast as well as generation of enamel. This is consistent by the observation that the Fam46a mRNA was highly expressed in ameloblast nuclei at D1 of incisors. High expression of the Fam46a messenger ribonucleic acid in dental papilla may
indicate that it could also play a role in odontoblast differentiation and proliferation, as odontoblasts differentiate from precursor cells of the dental papilla.21 Since the mouse incisors grow constantly, the enamel is being constantly produced at their labial side. The in situ hybridisation showed that at D1, before the eruption of the incisors all the enamel producing cells were highly positive for the Fam46a sense transcript, as the antisense probe did not pick any message. Interestingly in humans, there are transcripts of the antisense strand (which does not contain an open reading frame) of the Fam46A cDNA detectable across various tissues.22 We find that this might be true also for the mouse Fam46a, as in situ hybridisation with the antisense Fam46a probe gave some background staining of tissues surrounding the incisor at day 1. The human Fam46a gene, an orthologue of the mouse Fam46a, has a product that might have sixteen potential protein interacting partners as determined by the yeast twohybrid system.23 In this system, the best interactions was demonstrated with the Smad anchor for receptor activation protein, which recruits SMAD family member 2 protein to the transforming growth factor beta receptor and high density lipoprotein binding protein. Therefore, Fam46A product might be involved in the transforming growth factor beta family signal transduction, which includes bone morphogenetic proteins and activins. These molecules and receptors are known to play important roles during development in processes such as cell proliferation, apoptosis, and differentiation. It is therefore tempting to anticipate that the mouse Fam46a gene might have a similar interaction with the corresponding orthologue of the zinc finger, FYVE domain containing 9 genes during mouse tooth development. In conclusion, this is the first time that the expression of the Fam46a gene was shown in developing mouse tooth germs of molars and incisors. The Fam46a gene is differently expressed in tooth buds both spatially and temporally, predominating in nuclei of cells that actively produce enamel in incisors. The expression pattern is consistent with the speculation that the Fam46a gene could be involved in cell proliferation, apoptosis and differentiation activities in tooth buds, and perhaps enamel production.
Conflict of interest None declared.
Acknowledgement We thank the Faculty of Dentistry, University of Oslo for the financial support of the project. Funding: Faculty of Dentistry, University of Oslo, Oslo, Norway. Competing interests: None declared. Ethical approval: Ethical approval given by the Norwegian Ethical Committee.
archives of oral biology 54 (2009) 1002–1007
references
1. Slavkin HC. 1987 Kreshover lecture. Gene regulation in the development of oral tissues. J Dent Res 1988;67(9): 1142–9. 2. Partanen AM, Thesleff I. Growth factors and tooth development. Int J Dev Biol 1989;33(1):165–72. 3. Slavkin HC. Molecular determinants of tooth development: a review. Crit Rev Oral Biol Med 1990;1(1):1–16. 4. Thesleff I, Vaahtokari A, Partanen AM. Regulation of organogenesis. Common molecular mechanisms regulating the development of teeth and other organs. Int J Dev Biol 1995;39(1):35–50. 5. Maas R, Bei M. The genetic control of early tooth development. Crit Rev Oral Biol Med 1997;8(1):4–39. 6. Thesleff I, Aberg T. Molecular regulation of tooth development. Bone 1999;25(1):123–5. 7. Jernvall J, Thesleff I. Reiterative signaling and patterning during mammalian tooth morphogenesis. Mech Dev 2000;92(1):19–29. 8. Miletich I, Sharpe PT. Normal and abnormal dental development. Hum Mol Genet 2003;12(Spec No 1):R69–73. 9. Thesleff I. Epithelial-mesenchymal signalling regulating tooth morphogenesis. J Cell Sci 2003;116(Pt 9):1647–8. 10. Tucker A, Sharpe P. The cutting-edge of mammalian development; how the embryo makes teeth. Nat Rev Genet 2004;5(7):499–508. 11. Tompkins K. Molecular mechanisms of cytodifferentiation in mammalian tooth development. Connect Tissue Res 2006;47(3):111–8. 12. Thesleff I. The genetic basis of tooth development and dental defects. Am J Med Genet A 2006;140(23):2530–5. 13. Kapadia H, Mues G, D’Souza R. Genes affecting tooth morphogenesis. Orthod Craniofac Res 2007;10(3):105–13.
1007
14. Osmundsen H, Landin MA, From SH, Kolltveit KM, Risnes S. Changes in gene-expression during development of the murine molar tooth germ. Arch Oral Biol 2007;52(9):803–13. 15. Kawai J, Shinagawa A, Shibata K, Yoshino M, Itoh M, Ishii Y, et al. Functional annotation of a full-length mouse cDNA collection. Nature 2001;409(6821):685–90. 16. Okazaki Y, Furuno M, Kasukawa T, Adachi J, Bono H, Kondo S, et al. Analysis of the mouse transcriptome based on functional annotation of 60, 770 full-length cDNAs. Nature 2002;420(6915):563–73. 17. Carninci P, Kasukawa T, Katayama S, Gough J, Frith MC, Maeda N, et al. The transcriptional landscape of the mammalian genome. Science 2005;309(5740):1559–63. 18. Shigemura N, Kiyoshima T, Kobayashi I, Matsuo K, Yamaza H, Akamine A, et al. The distribution of BrdU- and TUNELpositive cells during odontogenesis in mouse lower first molars. Histochem J 1999;31(6):367–77. 19. Xie M, Kobayashi I, Kiyoshima T, Yamaza H, Honda JY, Takahashi K, et al. Functional implication of nucleolin in the mouse first molar development. J Biol Chem 2007;282(32):23275–83. 20. Vainio S, Jalkanen M, Vaahtokari A, Sahlberg C, Mali M, Bernfield M, et al. Expression of syndecan gene is induced early, is transient, and correlates with changes in mesenchymal cell proliferation during tooth organogenesis. Dev Biol 1991;147(2):322–33. 21. Thesleff I, Keranen S, Jernvall J. Enamel knots as signaling centers linking tooth morphogenesis and odontoblast differentiation. Adv Dent Res 2001;15:14–8. 22. Matsuzaka Y, Tounai K, Denda A, Tomizawa M, Makino S, Okamoto K, et al. Identification of novel candidate genes in the diffuse panbronchiolitis critical region of the class I human MHC. Immunogenetics 2002;54(5):301–9. 23. Colland F, Jacq X, Trouplin V, Mougin C, Groizeleau C, Hamburger A, et al. Functional proteomics mapping of a human signaling pathway. Genome Res 2004;14(7):1324–32.