Fasciola hepatica:Stage-Specific Expression of Novel Gene Sequences as Identified by Differential Display

EXPERIMENTAL PARASITOLOGY ARTICLE NO.

89, 169–179 (1998)

PR984287

Fasciola hepatica: Stage-Specific Expression of Novel Gene Sequences as Identified by Differential Display1

Michael B. Reed,*,† Terry W. Spithill,‡,2 Richard A. Strugnell,† and Michael Panaccio* *Victorian Institute of Animal Science, Attwood, Victoria, Australia 3049; †Department of Microbiology, University of Melbourne, Parkville, Victoria, Australia 3052; and ‡Department of Molecular Biology and Biochemistry, Monash University, Clayton, Victoria, Australia 3168

Reed, M. B., Spithill, T. W., Strugnell, R. A., and Panaccio, M. 1998. Fasciola hepatica: Stage-specific expression of novel gene sequences as identified by differential display. Experimental Parasitology 89, 169–179. Differences in gene expression between adult and immature Fasciola hepatica (liver fluke) parasites isolated from the mammalian host were investigated using the technique of differential display. For any given primer combination used to produce these displays there were, on average, 22% apparently adult-specific and 14% apparently immature-specific cDNA products able to be identified, consistent with a high degree of differential gene expression between these two parasite developmental stages. Several cDNA fragments specific to immature parasite RNA were isolated and cloned. An abundant 400- to 500-bp RNA species was identified on a Northern blot by hybridization to the cloned DD2 cDNA fragment and was determined to be expressed at levels at least 10-fold higher in immature parasites relative to adult parasites. mRNA transcripts corresponding to the remaining cDNA fragments (DD14, DD16, DISP10, and DISP2) were apparently expressed at levels below the sensitivity limits of Northern analysis, although differential expression of these transcripts was confirmed by reverse transcriptase PCR (RT-PCR). The identities or functional significance of each of the five differentially expressed cDNAs identified in this study is still unclear due to the lack of any significant sequence similarity to the entries currently held within sequence databases. q 1998 Academic Press Index Descriptors and Abbreviations: Fasciola hepatica; liver fluke; trematode; differential display; stage-specific gene expression; deoxyribonucleic acid (DNA); ribonucleic acid (RNA); complementary deoxyribonucleic acid (cDNA); messenger ribonucleic acid (mRNA); ribosomal ribonucleic acid (rRNA); polymerase chain reaction (PCR); 1 The sequence data reported herein has been submitted to GenBank and assigned Accession Nos. U38255–U38259 (inclusive). 2 To whom correspondence and reprint requests should be addressed: Department of Molecular Biology and Biochemistry, Monash University, Wellington Rd., Clayton, Victoria 3168, Australia. E-mail: Terry. [email protected]. Fax: 161-03-9905 4699.

0014-4894/98 $25.00 Copyright q 1998 by Academic Press All rights of reproduction in any form reserved.

reverse transcriptase-polymerase chain reaction (RT-PCR); phosphatebuffered saline (PBS); diethylpyrocarbonate (DEPC); dithiothreitol (DTT); deoxynucleotide triphosphates (dNTP’s); digoxigenin (DIG); sodium dodecyl sulfate (SDS); alkaline phosphatase (AP); Rapid Amplification of cDNA Ends (RACE); standard saline citrate (SSC); antigen binding fragment (Fab); Basic Local Alignment Search Tool (BLAST).

INTRODUCTION

Fasciola hepatica or “liver fluke” is a parasitic trematode that is predominantly of agricultural importance and is responsible for significant economic and animal welfare losses worldwide. In addition, fascioliasis is increasingly being recognized as a human health problem, with reports of infection having now been received from 56 countries. The World Health Organization (WHO) estimates that approximately 2.4 million people are infected with either F. hepatica or its larger relative F. gigantica, mostly within Bolivia, Peru, Egypt, Portugal, and China (Rim et al. 1993; WHO 1995). The complex process of F. hepatica development within the mammalian host includes defined stages such as the excystment of ingested metacercariae, penetration of the intestinal wall, migration through the abdominal cavity toward the liver, migration throughout the liver parenchyma, and, finally, lodgement within the bile ducts as a mature egg-laying parasite. Remarkably little is known about the molecular biology of F. hepatica during these developmental

169

170 stages and, not surprisingly, even less is known regarding gene expression or the regulation of gene expression surrounding these events. The majority of the information gathered thus far regarding the molecular biology of F. hepatica development has been concerned with differences in the patterns of expression of cysteine proteases (Dalton and Heffernan 1989; McGinty et al. 1993; Heussler and Dobbelaere 1994) or the identification of female genital complexspecific transcripts (Zurita et al. 1987; Rice-Ficht et al. 1992; Waite and Rice-Ficht 1992). More recently, the tissuespecific expression patterns of some of the F. hepatica glutathione S-transferase isoenzymes was shown to alter during development (Creaney et al. 1995). Despite this lack of understanding of the molecular and genetic basis of parasite development, there is a large body of biochemical data concerning the transition from the aerobic metabolic activity of the invading juvenile liver fluke into the almost exclusively anaerobic/fermentative metabolism of the adult parasite residing within the oxygen depleted environment of the bile ducts (Tielens et al. 1984; Lloyd 1986; Tielens et al. 1987; Tielens 1994). Environmental and metabolic changes of this degree would appear to be indicative of large-scale changes in gene regulation and expression throughout F. hepatica maturation. The potential for new techniques such as “differential display” to define these changes at the transcriptional level, both rapidly and on a large scale, provides encouragement that valuable advances will soon be made into further understanding the biology of F. hepatica development. Differential display (Liang and Pardee 1992; Liang et al. 1993) is a recently described technique based on the polymerase chain reaction (Saiki et al. 1988) that allows the identification of specific differences in gene expression between closely matched cell populations. It has a number of distinct advantages over other approaches such as differential or subtractive hybridization (Sargent 1987; Myers 1993) in terms of time, amounts of starting materials required, and, perhaps most importantly, sensitivity. In essence the technique involves producing a “display” of radiolabeled, arbitrarily primed PCR products that have been produced from subpopulations of cDNAs derived from each of the target mRNA species to be studied. Differences in the pattern of the display products produced from each of the target species (as visualized on a polyacrylamide sequencing gel) allows the isolation and further characterization of cDNA products that are potentially of interest. In the present study we have utilized both a standard and a slightly modified differential display protocol to successfully identify and clone a number of novel, differentially expressed mRNA species from immature (5 week) parasites as compared to adult parasites. Each of these species was

REED ET AL.

subsequently confirmed to be differentially expressed, or to have altered expression levels either by Northern analysis or by RT-PCR. Importantly, the sensitivity of the technique was found to be such that the majority of the products identified are apparently expressed at levels below the sensitivity limits of Northern analysis— a testimony to the power of differential display as a tool for investigating the molecular mechanisms involved in F. hepatica development.

MATERIALS AND METHODS

Parasites Adult parasites (Compton strain; Compton Paddock Laboratories, Surrey, UK) were harvested from the bile ducts of Border Leicester/ Dorset cross sheep 35 weeks postinfection, washed extensively in PBS (378C), and subsequently snap-frozen in liquid nitrogen and stored at 2708C prior to RNA extraction. Immature parasites (Compton strain) were isolated from the livers of sheep at 5 weeks postinfection. In order to access the parasites at this early stage of infection it was necessary to first cut up the liver tissue into small cubes and “stomach” (Colworth 400 stomacher; London, UK) for 2–5 min in a plastic bag along with an equal volume of PBS (378C). This material was subsequently washed through sieves of mesh diameter 2 mm and 250 mm, respectively, whereby the parasites retained by the second sieve were placed onto a dark colored plastic tray and flooded with PBS (378C). The immature parasites were then collected using a pasteur pipette, rinsed extensively in PBS (378C), snap-frozen, and stored at 2708C prior to RNA isolation. RNA extraction. Total RNA was isolated from a single adult parasite and approximately 50 immature parasites using the RNAzol B (Biotecx Labs Inc., Houston, TX) protocol. RNA isolated in this manner was resuspended in DEPC (BDH, Poole, UK)-treated water and aliquots containing between 20–30 mg RNA were subsequently DNase treated for 30 min at 378C with 10 units (U) of RQ-1 RNase-free DNase (Promega, Madison, WI) in the presence of 40 U of RNasin ribonuclease inhibitor (Promega). This material was then phenol/chloroform extracted (1:1), precipitated, rinsed with 70% ethanol, and finally resuspended in DEPC-treated water prior to storage at 2708C. Poly (A)+ RNA samples for Northern analysis were isolated from adult parasites as previously described (Panaccio et al. 1992) and from immature parasites using the Micro-Fast Track (Invitrogen, San Diego, CA) procedure. Poly(A)+ RNA isolated in this manner was resuspended in DEPC-treated water and stored at 2708C. The concentrations of each of the RNA samples used in this study was determined spectrophotometrically. Differential display. Differential display was carried out essentially as described (Liang et al. 1993) with the following modifications. For both the adult and immature total RNA samples, four separate cDNA reactions were set up corresponding to each of four anchored oligodT primers, namely T12-UA, T12-UC, T12-UG, and T12-UT (where U5A,C, or G). Then 0.35 mg of total RNA along with sterile water and 20 U RNasin (Promega) was heated to 708C for 10 min and then immediately placed on ice. The T12 oligonucleotide (2.5 mM final concentration; synthesized by Macromolecular Resources, Fort Collins,

STAGE-SPECIFIC EXPRESSION OF NOVEL GENE SEQUENCES OF F. hepatica

CO), dNTP’s (2 mM final concentration; Promega), 200 U SuperScript II reverse transcriptase (Gibco-BRL, Gaithersburg, MD), 13 SuperScript II reaction buffer and DTT (10 mM final concentration; GibcoBRL) were added in a final reaction volume of 20 ml. Reverse transcription was carried out at 378C for 1 h, following which the reactions were heated to 958C for 5 min. Two distinct protocols (“standard” and “modified”) were used for the PCR phase of the differential display procedure. The second of these protocols involved an adaptation of a previously described technique (Sokolov and Prockop 1994). For the standard protocol, 1/10th (2 ml) of the cDNA reaction mixture was added to the PCR mixture (final volume 20 ml), containing the respective oligo-dT anchor primer (2.5 mM final concentration), an arbitrary 10-mer oligo (Operon Technologies, Inc., Alameda, CA) at 0.5 mM (final concentration), dNTP’s (2 mM final concentration), 2.5 U Taq polymerase (Boehringer Mannheim, Mannheim, Germany), 13 Taq reaction buffer (Boehringer Mannheim), and 1 ml [a-35S]dATP (sp act . 1000 Ci/mmol; Amersham, Arlington Heights, IL). For the modified protocol, the only change to the reaction mixture was the replacement of the oligo-dT primer with a second arbitrary 10-mer oligonucleotide primer at a final concentration of 0.5 mM. The 58–38 nucleotide sequence of the arbitrary 10-mer primers used in this study are as follows: CCTACACGGT (OPAF1), CAGCCGAGAA (OPAF2), GAAGGAGGCA (OPAF3). PCR cycling conditions for all reactions were 958C 15 s, 408C 15 s, 728C 30 s for 40 cycles, followed by a final extension at 728C for 5 min. Cycling was carried out using a GeneAmp 9600 thermal cycler (Perkin–Elmer, Norwalk, CT) and MicroAmp reaction tubes (Perkin–Elmer). Following the cycling reactions, 7 ml of the PCR mixture was added to 5 ml of sequencing “stop-mix” (Pharmacia, Uppsala, Sweden), heated to 958C for 2 min, and then loaded onto 6% acrylamide (Promega)/8 M urea (Promega) sequencing gels and electrophoresed using a GibcoBRL sequencing tank. The control M13mp18 template included with the T7 sequencing kit (Pharmacia) was sequenced and run alongside the display reactions as a size standard. Once electrophoresis was complete the gels were soaked in water for 15 min and then dried directly onto the sequencing plate (without fixation) and exposed to X-ray film (Amersham) for 12 h. Extreme care was taken so as to be able to orientate the film correctly once developed. Display products of interest were subsequently excised from the dried gel using a scalpel blade following which the gel was exposed to a second piece of film in order to confirm the excision of the correct fragments. DNA was eluted from the gel-slices by boiling in 100 ml sterile water for 15–20 min and then ethanol precipitating in the presence of 0.3 M Na Acetate and 2.5 ml glycogen (20 mg/ml; Boehringer Mannheim). After rinsing in 75% ethanol the pellet was dried and resuspended in 10 ml sterile water. Cloning and sequencing of display products. Four microliters of each the excised display products was reamplified (100 ml final volume) in the absence of the labeled-nucleotide, using identical reaction conditions to those above except for an increase in the dNTP concentration from 2 to 20 mM, and a reduction in the number of cycles from 40 to 35. The ends of the PCR products generated in this manner were “polished” or “blunt ended” by incubation at 728C for 30 min in the presence of 5 U pfu polymerase (Stratagene, La Jolla, CA) at an adjusted dNTP concentration of 100 mM. PCR products were then purified using Promega’s “Wizard” DNA clean-up resin and dried under vacuum. After resuspending the purified PCR products in 10 ml sterile water, 4 ml was used in ligation reactions with the pCR-script cloning vector (Stratagene) and transformed into XL- 1 Blue MRF’ cells (Stratagene).

171

Positive clones were initially picked on the basis of blue-white selection and screened for the presence of the appropriate size inserts by restriction digestion of plasmid DNA purified by alkaline-lysis (Sambrook et al. 1989). Sequencing was carried out using the T7 sequencing kit (Pharmacia) together with universal forward and T3promoter sequencing primers. Reactions were electrophoresed on 6% acrylamide/8 M urea sequencing gels. To confirm the sequence in both directions for all of the differential display clones identified, plasmid DNA purified with both the QIA-well 8 and QIA-prep 8 plasmid kits (Qiagen GmbH, Hilden, Germany) was sequenced on an ABI 373A DNA Sequencer (Applied Biosystems, Foster City, CA), using universal forward and reverse primers in conjunction with the ABI PRISM Dye Deoxy Terminator Cycle Sequencing kit (Applied Biosystems) according to the manufacturer’s recommendations. Northern analysis. On separate occasions, both 10 mg of total RNA and 1.4 mg poly (A)+ RNA isolated from adult and immature parasites was electrophoresed in 1.2% agarose (Promega)/formaldehyde (Sigma, St. Louis, MO) gels and subsequently transferred overnight in 20 3 SSC (3 M NaCl/ 0.3 M Na3 Citrate, pH 7.0) to a positively charged nylon membrane (Boehringer Mannheim) as described in Sambrook et al. (1989). Following transfer, the RNA bound to the membrane was UV crosslinked for 3 min (Stratalinker, Stratagene) and the membrane rinsed in 2 3 SSC. Prehybridization was carried out at 378C for 1 h in hybridization solution containing 2% blocking reagent (Boehringer Mannheim; prepared from a 10% stock), 50% formamide (Sigma), 53 SSC, 0.1% SDS. In order to confirm the integrity of the total RNA and that equivalent amounts of RNA from each of the developmental at stages had been loaded prior to transfer, 10 mg of adult and immature total RNA along with 10 mg Gibco-BRL RNA size standards (0.24–9.49 kb) were loaded onto the same gel. Once electrophoresis was complete these lanes were stained for 45 min in 0.1 M ammonium acetate containing 0.5 mg/ml ethidium bromide and destained in sterile water at 48C overnight. As a control for both the integrity and amount of poly(A)+ RNA transferred, the second membrane was probed with a DIG-labeled probe, derived by PCR (described below) using specific primers directed against the sequence of a F. hepatica Cathepsin L protease cDNA clone (Wijffels et al. 1994). The 58–38 sequences of these primers are as follows: GCCGTACCCGACAAAA (ICE 125; nucleotides 343–358), TCACGGAAATCGTGCC (ICE 126; nucleotides 1005–990). In order to generate specific probes for Northern analysis, pairs of oligonucleotide primers were synthesized (DNAgency; Malvern, PA) for use in PCR-labeling reactions that were based on the sequence of each of the individual differential display clones. The 58–38 sequences of these oligonucleotides, along with their respective nucleotide positions within the clones they are derived from are as follows: GAACCTAGTGAAGAGGCTGCT (DD2F (forward); nulceotides 11–31), CAATTGATATTCATGGTTTAT (DD2R (reverse); nucleotides 271– 251), GTTAAACTTCTCGGGGGTGG (DD14F; 12–31), GGGACTATGTTACCTATTTGC (DD14R; 353–333), GGGATATGAAGGTTGTGAT (DD16F; 33–51), GGCATAAATTGGACAAACTGC (DD16R; 336–316), GAATGATGCAAGCCAAGGAAA (DISP10F; 21–41), GGCCTCATGTCCCCTTGA (DISP 10R; 215–198), CATTCACAGGACAAAGCCTG (DISP2F; 16–35), GGGCAGAATTGATATTGGCC (DISP 2R; 289–270). Each of the primer pairs was used in a PCR reaction that incorporated DIG-dUTP for labeling purposes. Approximately 10 ng of purified plasmid DNA for each of the display clones was added to a reaction mixture (20 ml final volume) containing the appropriate primer pair (0.5 mM final concentration), 13 Taq reaction buffer, 2.5 U Taq polymerase

172 (Boehringer Mannheim), and 2 ml DIG-dNTP mix (Boehringer Mannheim; 1 mM dATP/dCTP/dGTP, 0.65 mM dTTP, 0.35 mM DIG-dUTP). Reaction mixtures were then cycled on a GeneAmp 9600 (Perkin– Elmer) machine using the following parameters: 948C for 1 min, followed by 35 cycles of 948C 10 s, 558C 10 s, 728C 30 s. The resultant PCR products were purified so as to remove any unincorporated label using Promega’s “Wizard” DNA clean-up resin. For probing, 10–20 ng of denatured probe was used for each milliliter of fresh hybridization solution added to the membrane and incubated in a sealed hybridization bag at 428C overnight. Membranes were washed in 23 SSC/0.1% SDS at room temperature for 5 min (twice), at 658C for 15 min, and finally in 13 SSC/0.1% SDS at 658C for 15 min. Bound probe was detected by incubating the membrane with anti-digoxigenin antibody, Fab fragments (APconjugated; 1:10,000 dilution) provided with the DIG Luminescent Detection kit (Boehringer Mannheim). All procedures were carried out in accordance with the manufacturer’s recommendations. The alkaline phosphatase substrate CSPD (Boehringer Mannheim) was added to the washed membrane for 2–5 min at a dilution of 1:100 in AP buffer (0.1 M Tris–HCl, pH 9.5, 50 mM MgCl2, 0.1 M NaCl), following which the membrane was sealed in Gladwrap and incubated at 378C for 1 h prior to exposure to X-ray film (Amersham) for between 4–24 h. Once the desired exposure was obtained the membranes were then gently stripped prior to reprobing by washing them twice for 5–10 min in boiling 0.1% SDS. Reverse transcriptase PCR. With the primers described above for Northern blot analysis, RT-PCR reactions were carried out on both immature and adult stage DNase-treated total RNA (1.05 mg per reaction) using the Perkin–Elmer “EZ rTth RNA PCR” kit. Each reaction mixture (50 ml final volume) contained the appropriate forward and reverse primers at 0.45 mM, 300 mM dNTPs, 13 EZ buffer, 5 U rTth, 40 U RNasin, and 2.5 mM Mn(OAc)2. The reaction mixtures were preheated to 608C at which point the RNA was added. Following reverse transcription for 30 min at 608C, samples were heated to 948C for 1 min and then cycled between 948C for 10 s, 558C for 10 s, 608C for 30 s (40 cycles), with a final extension of 7 min at 608C. Samples were electrophoresed in 2% agarose and visualized under UV-light following ethidium bromide staining. In order to confirm that similar amounts of adult and immature total RNA had been added to the RTPCR reactions, control primers FABP1 and FABP2 were designed around nucleotides 1–20 and 416–435, respectively, of the F. hepatica fatty acid-binding protein homologue (Fh15 cDNA clone; RodriguezPerez et al. 1992). These primers were included into control RT-PCR reactions under identical conditions. The 58–38 sequences of these oligonucleotides are: CACGATGGCTGACTTTGTGG (FABP1) and CAGTGGGATGCTCAAAATCG (FABP2).

RESULTS

Reproducibility of the differential display technique. In order to confirm that the patterns obtained by differential display would, in our hands, show the same high levels of reproducibility as originally described for the technique (Liang and Pardee 1992; Liang et al. 1993), several identical display reactions were carried out in parallel employing the

REED ET AL.

standard conditions described above. For each of the primer pairs, T12UG/OPAF1 and T12UG/OPAF2, multiple PCR reactions were performed using aliqouts of cDNA prepared from both immature and adult RNA samples that had been primed using the T12UG oligonucleotide. Following electrophoresis and visual inspection of the resultant autoradiograph, it was determined that 95% of all display products were reproducibly generated in each of the multiple samples employing the same primer/cDNA combination (data not shown). In addition, a number of display products were readily identified as being consistently present in the reactions from one RNA preparation and absent from the corresponding reactions employing the other RNA preparation. Both these results serve to confirm the reliability and reproducibility of the differential display technique as applied to the identification of differentially expressed sequences within F. hepatica. Differential display of immature and adult F. hepatica RNA. The reverse transcription phase of the differential display protocol was carried out essentially as described (Liang and Pardee 1992; Liang et al. 1993) using each of the four oligo-dT anchor primers together with total RNA isolated from both immature (5 weeks) and adult F. hepatica. Two distinct strategies were then used for the PCR phase of the protocol. The first involved the inclusion of the oligodT anchor primer used for cDNA synthesis (along with an arbitrary 10-mer oligonucleotide) in the PCR reaction, as in the original descriptions of the technique. Assuming that the majority of oligo-dT priming occurs at the poly(A) tail of mRNAs, the effect of this is to restrict the PCR reactions to the 38 termini of their respective transcripts, potentially limiting the usefulness of the information gained from cloned display products. The second strategy was therefore put into place in an attempt to avoid this limitation and involved the use of different combinations of arbitrary 10-mer oligo’s within the PCR mixture, in the absence of the oligo-dT primer. Representative displays from each of these strategies are presented in Fig.1. The effect in terms of product specificity of changing a single PCR oligonucleotide is clearly evident (Fig. 1) and is critical from the point of view of the differential display technique to be able to display fragments that represent the entire transcript pool present within each of the F. hepatica developmental stages. Rarely, the same PCR product is visible in all reactions that may have only a single PCR primer in common. This is likely to be the result of mispriming events either at the cDNA or PCR level. In this particular study 20 distinct primer combinations were trialed with both adult and immature total RNA samples. Depending upon the particular primer combination and RNA sample utilized, between 39 and 112 individual display

STAGE-SPECIFIC EXPRESSION OF NOVEL GENE SEQUENCES OF F. hepatica

173

products of varying intensities could be distinguished, at an average of 71 per reaction. This number corresponds to approximately 50–70% of the number of display fragments seen with mammalian RNA samples using comparable reaction and cycling conditions (Bauer et al. 1993, Liang et al. 1993). Importantly, for any given primer combination there was between 10 and 22 apparently adult-specific products (average of 16, or 22%, of the total number of products) and between 3 and 22 apparently immature-specific products (average of 10, or 14%, of the total). It should be noted that all of these sets of figures take into account the effect that is seen toward the bottom of display gels, whereby the same product may appear to migrate as multiple fragments due to strand separation and the frequent addition of 38 terminal residues by Taq polymerase (Baeur et al. 1993). As a control to assess the efficiency of the DNase treatment of the RNA, samples of both immature and adult total RNA were incorporated into separate display reactions that did not include the SuperScript II reverse transcriptase (Gibco-BRL) enzyme in the first step. As expected, no products were able to be visualized following electrophoresis and autoradiography in this case (data not shown). Cloning of immature parasite-specific display products. A total of eight apparently stage-specific products were excised from a number of different display gels. Seven of these corresponded to PCR fragments derived from immature RNA, while the other fragment was derived from adult RNA. Apart from the apparent differential expression of these fragments they were also selected due to the fact that they were well separated within the gel, thereby limiting the possibility of subsequently reamplifying and cloning a contaminating fragment. Each of these excised fragments is indicated in Fig. 1. Following elution and precipitation, the excised PCR fragments were reamplified in the absence of any radiolabeled nucleotide, using the same primers and essentially the same reaction conditions used to generate the products initially. The only changes to the reaction conditions were a 10-fold increase in the nucleotide concentration and a decrease in the number of cycles. In most instances only a single PCR product of the expected size was visible FIG. 1. Differential display. Total RNA from both adult (A) and immature (Im) Fasciola hepatica parasites was subject to differential display as described under Materials and Methods. A side-by-side comparison of the display fragments produced for each of these RNA species using a number of distinct primer combinations is shown. The oligo-dT anchor primers (T12UN) used in the cDNA synthesis reactions are indicated above each paired adult and immature display. The respective T12UN anchor primers used for cDNA synthesis in combination with the arbitrary 10-mer oligonucleotides OPAF1 or OPAF3 were used for the PCR phase of the differential display protocol in (A) and

(C), respectively. OPAF1 and OPAF3 were used together in the absence of any anchor primer in (B). Each of the eight fragments referred to in this study that were apparently differentially expressed are indicated by arrows. Fragments able to be reamplified and cloned (Table 1) are shown beneath the respective lanes they were isolated from. The size markers (M) run alongside the display reactions in (A) are shown. It should be noted that the apparent molecular sizes of the fragments indicated by arrows are not comparable between A, B, or C.

174

REED ET AL.

following electrophoresis in 3% agarose and ethidium bromide staining. On one occasion a spurious product much larger than the expected size was produced in addition to the correct fragment, although this didn’t affect the subsequent cloning of the correct product. For one of the excised fragments the correct sized product was unable to be reamplified at all. The seven display products that were able to be reamplified were subsequently ligated into the pCR-script cloning vector (Stratagene). Each of the PCR products, except for the single adult-specific fragment, were able to be cloned in this manner. Characterization of the differential display clones. In order to characterize the cloned products, plasmid DNA representing each of the remaining six differential display fragments (all putatively specific to immature F. hepatica) was sequenced with universal forward and reverse primers. Table I summarizes some of the features of the differential display clones identified in this study and compares the primers used within the PCR reactions to the primers actually involved in generating the products, as determined by sequence analysis. Interestingly, it would appear that each of the three clones (DD14, DD16, and DD24) generated by the second differential display PCR protocol, are actually singleprimer products derived from the same arbitrary 10-mer (OPAF3; Operon Technologies Inc.). A BLAST search (Altschul et al. 1990) of the combined NCBI, EMBL, and SwissProt databases was able to identify clone DD24 as being derived from 18S rRNA—presumably obtained by oligo-dT cDNA priming at a poly(A) stretch within the rRNA sequence. It is not clear as to why a PCR product was not visible at an identical position within the corresponding differential display reaction using adult RNA. However, a number of such anomalies have previously been described for this technique (Liang et al. 1993; Li et al. 1994). Clone DD24 was not characterized any further. Unfortunately, BLAST searches using the other differential display clones

failed to give a clear indication as to their identity or their possible functional significance. For only one (clone DD2) of the five remaining clones is the orientation of the display fragment with respect to the mature RNA transcript evident. This is based on the identification of a single putative open reading frame, a putative termination codon, and a consensus polyadenylation signal within 30 nucleotides of the poly(A) tail (Fig 2). Although both DISP10 and DISP2 contain the sequence of the oligo-dT anchor primer, it is not yet known whether or not this corresponds to the true poly(A) tail, due primarily to the absence of a consensus polyadenylation signal. The possibility therefore remains that in both instances priming may have occurred at an internal poly(A) tract. In addition, there are no clearly defined open reading frames for either clone, consistent with the display fragments representing a large portion of the 38 untranslated regions of their parent transcripts and having been primed from a poly(A) stretch within this region. It is equally difficult to assign an orientation to the two clones bound by OPAF3 at either end (DD14, DD16), particularly for DD16 due to the existence of a number of putative open reading frames on either strand, none of which show significant similarities to sequences currently present in either the GenBank, EMBL, or SwissProt databases. Confirmation of the developmentally regulated expression of the differential display cDNA clones. Northern blot analysis was performed in order to confirm that each of the display clones was, in fact, expressed differentially in a stage-specific manner. As all the clones were relatively short, nonradioactive DIG (Boehringer Mannheim) labeling was carried out by PCR, rather than by a random primer method, using primers specific for each of the five clones being characterized (see Materials and Methods). Ten micrograms of total RNA from both the adult and immature developmental stages was probed with each of the DIG-labeled

TABLE I Summary of the Features of Each of the Differential Display Fragments Cloned in This Study Clone

RNA source

Size (bp)

cDNA primer (U 5 A, C, G)

PCR primers

Actual primers

GenBank accession

DD2 DD14 DD16 DD24 DISP10 DISP2

Immature Immature Immature Immature Immature Immature

286 365 346 303 258 303

T12UC T12UA T12UT T12UT T12UC T12UT

T12UC, OPAF1 OPAF1, OPAF3 OPAF1, OPAF3 OPAF1, OPAF3 T12UC, OPAF3 T12UT, OPAF3

T12UC, OPAF1 OPAF3, OPAF3 OPAF3, OPAF3 OPAF3, OPAF3 T12UC, OPAF3 T12UT, OPAF3

U38255 U38256 U38257 N.A. U38258 U28259

STAGE-SPECIFIC EXPRESSION OF NOVEL GENE SEQUENCES OF F. hepatica

175

FIG. 2. The nucleotide and predicted amino sequence of the partial cDNA clone DD2 identified by differential display. The sequences of the PCR primers OPAF1 and T12UC used to generate this display fragment are shown in lower case letters at either end of the sequence. The putative termination codon (boxed) and consensus polyadenylation signal (underlined) are also indicated.

probes and detected using a chemiluminescent detection system (Boehringer Mannheim). Prior to detection, blots were washed under reasonably low stringency conditions (13 SSC, 658C). Even after long exposures to X-ray film, only one of the probes (DD2) produced a detectable signal with either the adult or immature RNA. After exposure to film for 3–4 h an intense signal was able to be seen with immature RNA probed with DD2 and, in addition, a barely detectable signal was also visible in the corresponding position of the adult RNA (Fig. 3). The intensity of the signal produced with immature RNA would appear to be at least one order of magnitude greater than that seen with adult RNA. The size of the transcript detected using the DD2 probe was determined to be between 400 and 500 bp. To confirm that equivalent amounts of total RNA had been used for the Northern blot, 10-mg RNA samples from both adult and immature F. hepatica were run on the same gel and visualized following ethidium bromide staining (Fig. 3). In an attempt to raise the sensitivity of detection, the Northern blot was repeated using 1.4 mg poly(A)+ RNA isolated from both developmental stages. This blot was probed under identical conditions with each of the unsuccessful probes retained from the previous Northern blots. Once again, no signal was obtained for any of the probes, even after lengthy exposures (data not shown). It is most likely, therefore, that the transcripts from which the differential display clones DD14, DD16, DISP10, and DISP2 are derived are all expressed at levels below the level of sensitivity of Northern blotting. To confirm the integrity of both

the transferred poly(A)+ RNAs, the blot was similarly probed with a DIG-labeled F. hepatica Cathepsin L probe (Wijffels et al. 1993). Following exposure to X-ray film for as little as 1 h, an intense signal was produced in this case for both RNA species at the expected position (approximately 1200 bp; data not shown) as judged from Gibco-BRL RNA markers. The finding that clone DD2 is readily detectable by Northern blot analysis while the remaining clones are all of low abundance is consistent with the relative intensities seen for each the PCR fragments originally excised from the differential display gels (Fig. 1). In a further effort to confirm the developmental expression of the display clones, each of the specific primer pairs used previously to prepare the PCR-labeled probes for Northern analysis were used in reverse transcriptase-PCR (RT-PCR) reactions with both adult and immature DNase-treated total RNA. A “single-tube” RT-PCR protocol (EZ rTth RNA PCR kit; Perkin–Elmer) was chosen so as to minimize the possibility of transfer and handling errors that may lead to inaccuracies when trying to make comparisons between the two RNA species. As for Schistosoma mansoni (Skelly et al. 1993), no definitive standards have yet been described for F. hepatica in terms of a constitutive gene that is known to be transcribed at comparable levels throughout development. However, in order to ensure that similar amounts of both adult and immature RNA were aliquoted into the reaction tubes, primers specific to the sequence of a F. hepatica fatty acid-binding protein homologue (Fh15 cDNA clone; (Rodriguez-Perez et al. 1992)) were included into identical

176

FIG. 3. Northern analysis of DD2 expression. 10 mg of total RNA from both immature (lane 1) and adult (lane 2) Fasciola hepatica parasites was electrophoresed and transferred to a nylon membrane as described under Materials and Methods. The membrane was hybridized with a DIGdUTP-labeled probe specific to display fragment DD2. After washing, detection was carried out using the Boehringer Mannheim DIG luminescent detection kit according to the manufacturer’s recommendations and the membrane was exposed to X-ray film (Amersham) for 4 h at room temperature. The abundance of a single 400- to 500-bp RNA species specific to clone DD2 was visually determined to be at least one order of magnitude greater in immature parasites as compared to adults. The positions of the 1,350- and 240-bp RNA molecular weight markers (GibcoBRL) are indicated. To confirm that equivalent amounts of total RNA were loaded prior to transfer, seperate 10-mg samples of total RNA from both immature and adult parasites were stained with ethidium bromide following electrophoresis (lower panel).

RT-PCR reactions. This molecule has shown, in our hands, consistent levels of expression in a range of RNA samples prepared at different times and by different procedures (unpublished observations). Figure 4 shows the results of the RT-PCR reactions and confirms the differential expression of each of the five display clones. These results have been repeated on two separate occasions. The RT-PCR result obtained using the DD2F and DD2R primers (specific to clone DD2) is consistent with the Northern blot result, in that although there is some expression detectable within adult parasites, the level of expression is greatly diminished with respect to immature parasites. Of the other clones, only DISP10 also showed detectable levels of expression by RTPCR in adult parasites, once again at reduced levels in comparison to immature parasites. The difference in the abundance of the DISP10 mRNA between the two developmental stages does not appear to be as apparent as that for DD2. Expression of DD14, DD16, and DISP2 was not detectable

REED ET AL.

FIG. 4. Confirmation of differential expression. RT-PCR reactions using primers specific to each of the differential display fragments cloned in this study were carried out using equivalent amounts of total RNA from both adult (A) and immature (Im) parasites as described under Materials and Methods. Once cycling was complete the reaction mixtures were electrophoresed in 2% agarose and visualized under UV-light following ethidium bromide staining. It can be seen that for two of the differential display clones identified in this study (DD2 and DISP10), expression of the parent RNA transcipts is down-regulated to a large extent as the parasite reaches maturity. For the remaining three clones (DD14, DD16, DISP2) expression is not detectable in adult parasites and only barely detectable in immature-stage parasites. In order to confirm that similar amounts of RNA from both adult and immature parasites were added to the reaction mixtures, control reactions employing primers specific to a Fasciola hepatica fatty-acid binding protein homologue (FABP; Rodriguez-Perez et al., 1992) were also carried out under identical conditions. The sizes of the FABP (435 bp) and DISP10 (194 bp) RT-PCR products are indicated.

in adult RNA and only detectable in immature RNA at levels significantly below that for either DD2 or DISP10. As a further control, RNA prepared from the liver tissue of an uninfected Merino lamb using the RNAzol B method (Biotecx Labs Inc.) was also included into RT-PCR reactions. This was so as to ensure that none of the display fragments were derived from contaminating liver tissue collected along with the parasites. These controls were negative when tested for each of the five primer combinations described in the legend to Fig. 4 (data not shown).

DISCUSSION In the present study we have explored for the first time the use of differential display as a tool with which to investigate some of the molecular changes that occur in F. hepatica during development within the mammalian host. Specifically, we have been interested in the ability of the technique to identify changes in gene expression between immature (5 week) migrating parasites, which cause much of the damage seen in liver fluke infection, and adult parasites (14 weeks and above) resident within the bile ducts. Thus far, five partial cDNA sequences have been identified and cloned from immature F. hepatica, although as yet it is still not clear as to the nature of these sequences. Within the limits

STAGE-SPECIFIC EXPRESSION OF NOVEL GENE SEQUENCES OF F. hepatica

of sensitivity of either Northern analysis or RT-PCR it has been demonstrated that expression of three of these sequences is confined to immature parasites (clones DD14, DD16, and DISP2), while the remaining two (clones DD2 and DISP10) are significantly down-regulated as the parasite reaches maturity. The fact that no significant matches with the current sequence databases were obtained for any of these clones is not surprising given the limited sequence information that is presently available for parasitic helminths, particularly trematode parasites such as F. hepatica. Much of the available sequence data concerning F. hepatica currently relates to highly expressed molecules that include the cysteine proteases (Yamasaki and Aoki 1993; Smith et al. 1993; Wijffels et al. 1994; Heussler and Dobbelaere 1994), glutathione Stransferases (Panaccio et al. 1992), eggshell precursor proteins (Rice-Ficht et al. 1992; Waite and Rice-Ficht 1992), and a fatty acid-binding protein homologue (RodriguezPerez et al. 1992). The possibility that some of the fragments cloned in this study may largely be derived from 38 untranslated sequences would also make their identification difficult. It is worth noting that two recent papers describing the use of differential display with both coccidian (Abrahamsen et al. 1995) and nematode (Joshua and Hsieh 1995) parasites have similarly identified a number of stage-specific molecules of unknown identity. This situation has also been described for mammalian embryos (Zimmermann and Schultz 1994). The considerable sequence divergence that is likely to exist for many of the F. hepatica homologues of mammalian sequences may, in some instances, be responsible for the lack of apparent similarity to any of the large number of database entries for these particular species. Apart from one notable exception (cloning a cDNA fragment derived from 18S rRNA) there appeared to be a good correlation between the signal intensity observed for each of the fragments excised from the differential display gels (Fig. 1) and the relative abundance of the respective parent RNA transcripts as judged by either Northern analysis (Fig. 3) or RT-PCR (Fig. 4). For example, by far the strongest display signal was seen for fragment DD2, which subsequently was the only clone that was abundant at levels sufficient to produce a signal on a Northern blot. Similarly, primers specific to clone DD2 gave the strongest signal intensity by RT-PCR. The inability to detect a hybridization signal on a Northern blot for four of the five cDNA fragments identified in this study is not unusual and has been reported a number of times in previous studies employing differential display (Liang et al. 1992, 1993). Results such as these are a testimony to the sensitivity and power of this technique for identifying differentially expressed molecules. In fact,

177

the abundance of many of the mRNAs identified by Guimaraes et al. (1995) was estimated to be as low as 1 in 60,000. One of the apparent limitations of the differential display technique stems from the inclusion of the oligo-dT anchor primer used for cDNA synthesis in the PCR reaction. In addition, the fragments identified are small and generally in the order of 200–500 bp. Unless priming occurs at an internal poly(A) region—as appears to have occurred with clones DISP10 and DISP2—the majority of products obtained using this technique will, in theory, be derived from the sequence present at the 38 terminus of the parent mRNA. Therefore, the possibility exists that the sequences of cloned display fragments may be composed entirely of the 38 untranslated regions of mRNAs. In order to overcome this limitation, a novel PCR strategy adapted from a previously described technique (Sokolov and Prockop 1994) was employed in addition to the standard display protocol. This strategy involved performing the PCR reactions in the absence of the oligo-dT primer such that priming was possible along the length of the cDNA molecule. Not including the 18S rRNA derived cDNA, each of the two clones produced using this strategy (DD14 and DD16) contained the same 10-mer primer sequence at either end, similar to the single-primer display products described elsewhere (Guimaraes et al. 1995; Joshua and Hsieh 1995). However, until the full-length cDNAs corresponding to DD14 and DD16 are identified, it is difficult to assign an orientation to these fragments due to the presence of a number of possible open reading frames, none of which extend to the ends of the cloned fragments. From their sequences, it is likely that both the clones contain at least a small portion of either 58 or 38 untranslated sequence. cDNA library screening and RACE-PCR (Frohman et al. 1988) protocols are currently underway in order to resolve the orientation of the cDNA fragments cloned in this study and in an attempt to identify these differentially expressed novel sequences. Aside from the disadvantages outlined above, differential display has numerous technical advantages over other strategies for identifying differentially expressed genes. Techniques such as subtractive or differential hybridization (Sargent 1987; Lee et al. 1991; Myers 1993) are quite difficult to establish, require large amounts of starting materials (about 200 mg total RNA from each of the cell populations being studied), and are used to identify genes expressed differentially in only one of two cell populations used for the study. Differential display, on the other hand, can be carried out using as little as 0.02 mg total RNA per cDNA reaction (Liang et al. 1993) and the displays are able to be generated within 2 days of RNA isolation. Perhaps most importantly, differential display allows multiple sources of

178 RNA (e.g., purified from F. hepatica parasites collected each week during infection) to be examined simultaneously such that unique display fragments are able to be identified from each of the input RNA populations. Together with an essentially limitless array of primer combinations that are able to be used, it can be seen that large amounts of data regarding differential gene expression can rapidly be generated. When it is considered that PCR reactions employing one, two, or three arbitrary 10-mer primers are able to be carried out in order to generate distinct display patterns (Sokolov and Prockop 1994), the huge number of potential primer combinations able to be utilized becomes apparent. As with a recent paper describing the application of differential display to the protozoan parasite Eimeria bovis (Abrahamsen et al. 1995), our display patterns consistently contain fewer fragments than those obtained using mammalian RNA samples (Bauer et al. 1993, Liang and Pardee 1992; Liang et al. 1993). Whether this truly reflects a difference in the complexity of mRNA expression patterns or is due to subtle differences in methodologies is not clear. However, what is clear is that when compared to the relatively few differences observed using differential display to study, for example, human breast cancer versus mammary epithelial cells (Liang et al. 1992; Sager et al. 1993), there are on average 16 and 10 unique display products visible for adult and immature F. hepatica parasites, respectively, for any given primer combination. This level of apparent differential gene expression is consistent with the intense biochemical changes the parasite undergoes as it switches from a predominantly aerobic metabolism to one that is primarily anaerobic/fermentative as the parasite matures. These biochemical changes that occur throughout F. hepatica development reflect both an increase in size of a parasite that possesses no known circulatory or respiratory system, as well as the vastly different physiological environments that the parasite is exposed to during migration (Tielens 1994). In summary, the sensitivity of differential display along with its unique capacity to rapidly identify changes in developmental expression would appear to make it an ideal technique with which to begin a thorough investigation into the biology of F. hepatica development.

ACKNOWLEDGMENTS

This work was supported by CIBA Animal Health Limited (Australia) and Agriculture Victoria. M.B.R. was supported by the Department of Agriculture “Nancy Millis” Postgraduate Scholarship.

REED ET AL.

REFERENCES Abrahamsen, M. S., Johnson, R. R., Hathaway, M., and White, M. W. 1995. Identification of Eimeria bovis merozoite cDNAs using differential mRNA display. Molecular and Biochemical Parasitology 71, 183–191. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. 1990. Basic local alignment search tool. Journal of Molecular Biology 215, 403–410. Bauer, D., Muller, H., Reich, J., Riedel, H., Ahrenkiel, V., Warthoe, P., and Strauss, M. 1993. Identification of differentially expressed mRNA species by an improved display technique (DDRT-PCR). Nucleic Acids Research 21, 4272–4280. Creaney, J., Wijffels, G. L., Sexton, J. L., Sandeman, R. M., Spithill, T. W., and Parsons, J. C. 1995. Fasciola hepatica: Localisation of glutathione S-transferase isoenzymes in adult and juvenile liver fluke. Experimental Parasitology 81, 106–116. Dalton, J. P., and Heffernan, M. 1989. Thiol proteases released in vitro by Fasciola hepatica. Molecular and Biochemical Parasitology 35, 161–166. Frohman, M. A., Dush, M. K., and Martin, G. R. 1988. Rapid production of full-length cDNAs from rare transcripts. Amplification using a single gene-specific oligonucleotide primer. Proceedings of the National Academy of Sciences USA 85, 8998–9002. Guimaraes, M. J., Lee, F., Zlotnik, A., and McClanahan, T. 1995. Differential display by PCR: novel findings and applications. Nucleic Acids Research 23, 1832–1833. Heussler, V. T., and Dobbelaere, D. A. E. 1994. Cloning of a protease gene family of Fasciola hepatica by the polymerase chain reaction. Molecular and Biochemical Parasitiology 64, 11–23. Joshua, G. W. P., and Hsieh, C. Y. 1995. Stage-specifically expressed genes of Angiostrongylus cantonensis: identification by differential display. Molecular and Biochemical Parasitology 71 285–289. Lee, S., Tomasetto, C., and Sager, R. 1991. Positive selection of candidate tumor suppressor genes by subtractive hybridization. Proceedings of the National Academy of Sciences USA 88, 2825–2829. Li, F., Barnathan, E. S., and Kariko, K. 1994. Rapid method for screening and cloning cDNAs generated in differential mRNA display: Application of Northern blot for affinity capturing of cDNAs. Nucleic Acids Research 22, 1764–1765. Liang, P., Averboukh, L., Keyomarsi, K., Sager, R., and Pardee, A. B. 1992. Differential display and cloning of messenger RNAs from human breast cancer versus mammary epithelial cells. Cancer Research 52, 6966–6968. Liang, P., Averboukh, L., and Pardee, A. B. 1993. Distribution and cloning of eukaryotic mRNAs by means of differential display: Refinements and optimization. Nucleic Acids Research 21, 3269– 3275. Liang, P., and Pardee, A. B. 1992. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257, 967–971. Lloyd, G. M. 1986. Energy metabolism and its regulation in the adult liver fluke Fasciola hepatica. Parasitology 93, 217–248.

STAGE-SPECIFIC EXPRESSION OF NOVEL GENE SEQUENCES OF F. hepatica

Mc Ginty, A., Moore, M., Halton, D. W., and Walker, B. 1993. Characterization of the cysteine proteinases of the common liver fluke Fasciola hepatica using novel, active-site directed affinity labels. Parasitology 106, 487–493. Myers, R. M. 1993. The pluses of subtraction. Science 259, 942–943. Panaccio, M., Wilson, L. R., Crameri, S. L., Wijffels, G. L., and Spithill, T. W. 1992. Molecular characterization of cDNA sequences encoding glutathione S-transferases of Fasciola hepatica. Experimental Parasitology 74, 232–237. Rice-Ficht, A. C., Dusek, K. A., Kochevar, G. J., and Waite, J. H. 1992. Egshell precursor proteins of Fasciola hepatica, I. Structure and expression of vitelline protein B. Molecular and Biochemical Parasitology 54, 129–141. Rim, H-J., Farag, H. F., Sornmani, S., and Cross, J. H. 1994. Food-borne trematodes: Ignored or emerging?. Parasitology Today 10, 207–209. Rodriguez-Perez, J., Rodriguez-Medina, J. R., Garcia-Blanco, M. A., and Hillyer, G. V. 1992. Fasciola hepatica: Molecular cloning, nucleotide sequence, and expression of a gene encoding a polypeptide homologous to a Schistosoma mansoni fatty acid-binding protein. Experimental Parasitology 74, 400–407. Sager, R., Anisowicz, A., Neveu, M., Liang, P., and Sotiropoulou, G. 1993. Identification by differential display of alpha 6 integrin as a candidate tumor suppressor gene. FASEB Journal 7, 964–970. Saiki, R. J., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. 1988. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487–491. Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989. “Molecular Cloning: A Laboratory Manual,” Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

179

G., Trudgett, A., and Dalton, J. P. 1993. Purification of a cathepsin L-like proteinase secreted by adult Fasciola hepatica. Molecular and Biochemical Parasitology 62, 1–18. Sokolov, B. P., and Prockop, D. J. 1994. A rapid and simple PCRbased method for isolation of cDNAs from differentially expressed genes. Nucleic Acids Research 22, 4009–4015. Tielens, A. G. M. 1994. Energy generation in parasitic helminths. Parasitology Today 10, 346–352. Tielens, A. G. M., van den Heuvel, J. M., and van den Bergh, S. G. 1984. The energy metabolism of Fasciola hepatica during its development in the final host. Molecular and Biochemical Parasitology 13, 301–301. Tielens, A. G. M., van den Heuvel, J. M., and van den Bergh, S. G. 1987. Differences in intermediary energy metabolism between juvenile and adult Fasciola hepatica. Molecular and Biochemical Parasitology 24, 273–281. Waite, J. H., and Rice-Ficht, A. C. 1992. Egshell precursor proteins of Fasciola hepatica, II. Microheterogeneity in vitelline protein B. Molecular and Biochemical Parasitology 54, 143–151. WHO. 1995. Control of foodborne trematode infections. WHO Technical Report Series, No. 849. Wijffels, G. L., Panaccio, M., Salvatore, L., Wilson, L., Walker, I. D., and Spithill, T. W. 1994. The secreted cathepsin L-like proteinases of the trematode, Fasciola hepatica, contain 3-hydroxyproline residues. The Biochemical Journal 299, 781–790. Yamasaki, H., and Aoki, T. 1993. Cloning and sequence analysis of the major cysteine protease expressed in the trematode parasite Fasciola sp. Biochemistry and Molecular Biology International 31, 537–542.

Sargent, T. D. 1987. Isolation of differentially expressed genes. Methods in Enzymology 152, 423–432.

Zimmermann, J. W., and Schultz, R. M. 1994. Analysis of gene expression in the preimplantation mouse embryo: use of mRNA differential display. Proceedings of the National Academy of Sciences USA 91, 5456–5460.

Skelly, P. J., Stein, L. D., and Shoemaker, C. B. 1993. Expression of Schistosoma mansoni genes involved in anaerobic and oxidative glucose metabolism during the cercaria to adult transformation. Molecular and Biochemical Parasitology 60, 93–104.

Zurita, M., Bieber, D., Ringold, G., and Mansour, T. E. 1987. Cloning and characterization of a female genital complex cDNA from the liver fluke Fasciola hepatica. Proceedings of the National Academy of Sciences USA 84, 2340–2344.

Smith, A. M., Dowd, A. J., McGonigle, S., Keegan, P. S., Brennan,

Received 23 June 1997; accepted 8 January 1998