- Email: [email protected]
Fast genetic identification of the Beluga sturgeon and its sought-after caviar to stem illegal trade
Accepted Manuscript Fast genetic identification of the Beluga sturgeon and its sought-after caviar to stem illegal trade Elisa Boscari, Nicola Vitulo, Arne Ludwig, Chiara Caruso, Nikolai S. Mugue, Radu Suciu, Dalia F. Onara, Chiara Papetti, Ilaria A.M. Marino, Lorenzo Zane, Leonardo Congiu PII:
S0956-7135(16)30673-9
DOI:
10.1016/j.foodcont.2016.11.039
Reference:
JFCO 5369
To appear in:
Food Control
Please cite this article as: Elisa Boscari, Nicola Vitulo, Arne Ludwig, Chiara Caruso, Nikolai S. Mugue, Radu Suciu, Dalia F. Onara, Chiara Papetti, Ilaria A.M. Marino, Lorenzo Zane, Leonardo Congiu, Fast genetic identification of the Beluga sturgeon and its sought-after caviar to stem illegal trade, Food Control (2016), doi: 10.1016/j.foodcont.2016.11.039 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT
Highlights
The first nuclear marker for the identification of the Beluga sturgeon is proposed.
The marker application is fast, inexpensive, reliable and reproducible .
RI PT
The Marker was identified in the second intron of the Ribosomal Protein S6.
AC C
EP
TE D
M AN U
SC
The tool can be used for the identification of Beluga also in interspecific hybrids.
ACCEPTED MANUSCRIPT
1
Fast genetic identification of the Beluga sturgeon and its sought-after caviar to stem illegal trade.
2 3
Elisa Boscaria, Nicola Vitulob, Arne Ludwigc, Chiara Carusoa, Nikolai S. Mugued,e, Radu Suciuf,
4
Dalia F. Onaraf, Chiara Papettia, Ilaria A.M. Marinoa, Lorenzo Zanea, Leonardo Congiua*. a
Department of Biology, University of Padova, I-35131 Padova, Italy Department of Biotechnology, University of Verona, Verona 37134, Italy.
c
Leibniz-Institute for Zoo and Wildlife Research, 10252 Berlin, Germany.
d
Russian Federal Research Institute of Fisheries and Oceanography, Moscow 107140, Russia
e
Institute of Developmental Biology RAS, Moscow 117808, Russia
f
Danube Delta National Institute for Research and Development, Tulcea 820112, Romania
SC
b
Corresponding author: Leonardo Congiu Email: [email protected] Tel: +39 049 8276218 Fax: +30 049 8276209
18
M AN U
6 7 8 9 10 11 12 13 14 15 16 17
RI PT
5
19
Abstract
20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37
Sturgeons are well known for the delicacy of their eggs, the caviar, one of the most valuable products on the food
TE D
market. The high price of caviar led in the past to a severe overharvest of wild sturgeon species and to an increase in trade of counterfeit products sold with impunity in spite of the strict trade limitations. A priority in the effort to reduce illegal trading is the development of genetic tools in order to identify the species of traded products using a standardized, cheap and rapid approach. We developed the first genetic nuclear marker for the identification of the Beluga sturgeon (Huso huso), the most sought-after caviar producer. We explored the interspecific variability at the
EP
second intron of the nuclear S6 Ribosomal Protein (RP2S6), selected among 1867 introns, predicted by aligning the transcriptome of 3 sturgeon species with 3 complete fish genomes. The Beluga-specific SNP was identified by cloning and sequencing RP2S6 in 65 individuals of 11 species, validated on 341 additional individuals and tested on 18 caviar
AC C
samples. Diagnostic primers designed on the SNP successfully amplified the expected band in all Beluga specimens while no PCR product was obtained from other pure species. The marker can also contribute to the identification of interspecific hybrids in which the Beluga is one of the parent species, such as in the case of the Bester, which produces one of the most mislabeled caviars in trade. The complete identification power on this highly relevant species and the proved efficacy on caviar samples represent an essential progress towards a standardized panel of nuclear markers for the control of illegal poaching, smuggling and mislabeling of sturgeons and their products.
Keywords (4 to 6) Sturgeon, Huso huso, RP2S6, Bester, species identification, hybrids
38 39 40 1
ACCEPTED MANUSCRIPT
41
1. Introduction
42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81
Sturgeons are an archaic group of fish known, for centuries, as producers of caviar, one of the most valuable food delicacies on the world’s market (Fain et al., 2013). Overfishing of wild stocks, encouraged by high profits from illegal markets, is the major cause that has led all sturgeon species to the brink of extinction, inducing the International Union for Conservation of Nature (IUCN) to list them as one of the most imperiled group of animals worldwide (IUCN press
RI PT
release of 18, Mar, 2010, https://www.iucn.org/press/news-releases). Despite protection measures, a significant illegal trade still exists, in which caviar from unsustainable natural sources is sold under false labels (Ogden et al., 2013; Van Uhm & Siegel, 2016). In the last decades, the demographic collapse of sturgeon natural populations and the high demand for caviar on the international market have stimulated a rapid increase of commercial aquaculture programs, mainly aimed at caviar production. The most recent published census of sturgeon aquaculture plants, conducted in 2013
SC
(Bronzi & Rosenthal, 2014), listed 640 sturgeon farms worldwide. This number has more than tripled in four years and over than 2.100 farms are now counted (Paolo Bronzi, personal communication), mostly due to an exponential increase in Chinese production and in part to the more exhaustive census recently conducted by this country. In parallel, the high performances of interspecific hybrids in terms of growth rate (Jahnichen et al., 1999) and early gonad maturation
M AN U
(Omoto et al., 2001) prompted a massive increase in their aquaculture production. More than 10 pure sturgeon species and several interspecific hybrids are reared for their caviar, with different yields in terms of production efficiency and product quality. Consequently, mislabeling of caviar is common and often, caviar obtained from less valuable species or hybrids is sold as top quality (Ludwig et al. 2015). The most popular brands used to counterfeit commercial caviar are, in order of importance, Beluga, Osietra and Sevruga, respectively produced by Huso huso, Acipenser gueldenstaedtii/persicus and A. stellatus.
In this context, the availability of reliable methods for the validation of the declared species is urgently needed to
TE D
effectively control illegal trade and commercial fraud in one of the most expensive foods of animal origin (Ludwig, 2008; Ogden et al., 2013). Since 1997, when all sturgeon species were included in the Appendices of the Convention on International Trade in Endangered Species (CITES) (Raymakers, 2006), a broad variety of genetic methods have been explored for their applicability to sturgeon species identification (Ludwig, 2008). Currently, mitochondrial regions such as the Cytochrome b and the Control Region are used in routine analyses (Krieger et al., 2008; Mugue et al., 2008;
EP
Johnson & Iyengar, 2015, Ludwig, 2008). Mitochondrial genes, however, are usually analyzed by sequencing, making them suboptimal for routine controls in which a cheap and immediate response is required (Ogden et al., 2013); moreover, these markers have incomplete discrimination power for some closely related species (Ludwig, 2008; Ogden
AC C
et al., 2013) and are not useful for the identification of interspecific hybrids. In fact, mitochondrial markers are maternally inherited and cannot detect paternal contribution, leading to the misclassification of hybrids as belonging to their maternal species. In this way, hybrids can be easily commercialized under the false label of a pure species (Mugue et al., 2008; Bronzi et al., 2011). Only in the last few decades have genetic investigations begun to assess the suitability of different nuclear markers for sturgeon species and hybrid identification (Ludwig, 2008). The suitability of these approaches for routine analyses, however, is limited by low reproducibility, high costs, complexity of the protocol or low cross-applicability of isolated markers (Congiu et al., 2001, 2002; Rozhkovan et al., 2008; Yarmohammadi et al., 2012; Barmintseva & Mugue, 2013; Boscari et al., 2015). Recently, Boscari et al. (2014a) developed a Single Nucleotide Polymorphism (SNP)-based method of caviar identification, which looks promising due to its simplicity of application and its applicability across several sturgeon species. The method is based on the application of a panel of primers specifically designed to target species-specific SNPs, identified by the authors within the first intron (RP1) of the nuclear encoded S7 Ribosomal Protein (RP1S7). At
2
ACCEPTED MANUSCRIPT
82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97
present, the method allows for the identification of 7 species (Acipenser naccarii, A. fulvescens, A. stellatus, A. sinensis,
98
2. Materials and Methods
the RPS7 gene, no diagnostic marker was identified for the most valuable sturgeon species, the Beluga sturgeon (H. huso), currently detectable only by the mitochondrial DNA analysis. H. huso is also used for the production of the Bester, one of the most known and commercialized hybrids, widely
RI PT
farmed in Russia, Germany, Hungary, Japan and Italy and sold worldwide (Bronzi et al., 2011; Yarmohammadi et al., 2012; Omoto et al., 2001). The Bester hybrid is obtained by crossing a Beluga female (H. huso) with a Sterlet (A. ruthenus) male and it is easily misidentified as pure Beluga by mitochondrial DNA analysis.
In the present study, taking advantage of the available transcriptomes of three sturgeon species, A. fulvescens, A. naccarii and A. stellatus (Hale et al., 2009, Vidotto et al., 2013, 2015), we explored the potential of intronic regions, as suitable markers for species identification in tissue and caviar samples. In particular, we present the results obtained by
SC
the analyses at a Single Nucleotide Polymorphism (SNP) located in the second intron (RP2) of the nuclear encoded S6 Ribosomal Protein (RP2S6). This marker complements the RP1S7 tool and represents an important step towards the
sturgeon species and hybrids.
2.1. Sampling and DNA extraction
M AN U
creation of a standardized and cheap protocol suitable in routine analysis for trade controls for fast identification of
A total of 406 tissue samples belonging to 11 pure species and 2 interspecific hybrids were analyzed in the present study (Table 1). Individuals of the different species were opportunely selected from different geographical origins or,
TE D
when possible, based on pedigree information in order to avoid the selection of related specimens. Sixty-five individuals were used for the characterization of the intronic region RP2S6, while a subsequent validation phase was implemented on 341 additional animals. For all tissue samples, genomic DNA was purified from fin clips using the EuroGOLD Tissue DNA Mini Kit (Euroclone) and stored at -20°C. In addition, 18 caviar samples (Table 1) were used in a sensitivity test. For each caviar, up to three eggs were independently processed and DNA purified using the
EP
DNeasy Blood & Tissue extraction kit (Qiagen).
2.2. Intron characterization, cloning and sequencing The intron RP2S6, characterized in this work, was predicted by aligning assembled transcriptomes of three sturgeon
AC C
99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122
A. transmontanus, A. ruthens and A. baerii) and their hybrids, most of which with 100% accuracy. Unfortunately, using
species (A. fulvescens, A. naccarii and A. stellatus) (Hale et al., 2009; Vidotto et al., 2013, 2015) against three available genomes of teleost fishes (Takifugu rubipres, Latimeria chalumnae and Danio rerio) (Brenner et al., 1993; Amemiya et al., 2006; Howe et al., 2013). Fugu genome sequence (fr3 assembly, October 2011) was downloaded from “UCSC Genome Browser web site” (http://hgdownload.soe.ucsc.edu/goldenPath/fr3/bigZips/); while Latimeria (latCha1 assembly) and Zebrafish (Zv9 assembly) genome sequences were downloaded from ENSEMBL ftp site (ftp://ftp.ensembl.org/pub/release-75/fasta/). The transcriptome assembly sequences were aligned on the reference genomes using the program Exonerate (Slater & Birnay, 2015) setting the model option to “est2genome”. To retrieve intron conservation across multiple genomes we used several homemade perl scripts. The pipeline is composed by different steps. Briefly, Exonerate outputs were parsed, cDNA sequence mapping coordinates as well as teleost genomes introns coordinates were retrieved. In a second step, a comparison within each reference genome was performed. During this step, introns identified by multiple
3
ACCEPTED MANUSCRIPT
transcriptome libraries were retrieved and checked for consistency. Finally, introns shared by all the genomes and confirmed by a high number of sequences were selected for further analysis. Two primers were designed on the exon flanking regions (RP2S6_F 5’-TTCATGGGGAAACCCTGCTT3’ and RP2S6_R 5’-ATCCTCTGGGTGAGGAGTG-3’) to amplify and sequence the predicted RP2S6. Touch Down (TD)PCR conditions were as follows: a preliminary denaturation step at 94°C for 2’, a first phase for 6 touch down cycles
RI PT
with denaturation at 94°C for 30’’, starting annealing temperature of 63°C for 30’’ decreasing half a degree at each cycle, extension at 72°C for 15’’, followed by 35 cycles at 94°C for 30’’, 60°C for 15’’, 72°C for 15’’, and a final elongation at 72°C for 5’. After checking the PCR products on 1.8% agarose gel stained with GelRed (BIOTIUM, GelRedTM Nucleic Acid Stain, 10000X in Water), they were purified using ExoSAP-IT® and directly sequenced at the external service BMR Genomics. Due to the presence of a putative duplicated locus and the high ploidy level of some of the tested species, the resulting chromatograms showed some double or triple peaks after direct sequencing, thus
SC
sequences were often unreadable and PCR products were cloned. In this preliminary phase, the RP2S6 fragment was amplified from a total of 65 individuals belonging to 11 species and PCR products from different individuals of the same species were pooled before cloning in order to increase the detectable variability. Cloning was performed in
M AN U
JM109 competent cells using the P-GEM-T Easy Vector (Promega) following the manufacturer’s recommendations. A total of 70 clones were sequenced (15 of H. huso, 10 of H. dauricus, 10 of A. schrenckii, 9 of A. baerii, 6 of A. ruthenus, 5 of A. naccarii, 4 of A. stellatus, 4 of A. gueldenstaedtii, 3 of A. fulvescens, 3 of A. transmontanus and 1 of A. sinensis).
2.3. Diagnostic primer designing and SNP validation
All cloned sequences were aligned and checked for the presence of species-specific SNP. A cluster analysis was also
TE D
performed using MEGA6 (Tamura et al., 2013).
Once established the presence of two groups of sequences (group A and group B), better illustrated in the results section, and the presence of informative polymorphisms potentially suitable to distinguish Beluga animals from the other species, species-specific primers were designed.
In detail, a forward primer specific for the Beluga species (RP2S6_huso_F 5’-CATAACATTGCACTGAATGTTATA-
EP
3’) was designed using OligoExplorer (Gene Link, www.genelink.com) on one putative diagnostic SNP: the 3’-end of this specific primer is complementary to the diagnostic mutation and the second to last nucleotide is designed as not complementary to its target nucleotide. In this way, when used on a non-Beluga species, a mismatch of two nucleotides ensures
the
failure
of
the
amplification.
A
reverse
primer
(RP2S6_groupA_R
5’-
AC C
123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162
CTTTCGTTGATTTAGGGAAATGGT3’), to be combined with the above RP2S6_huso_F, was designed in order to selectively amplify the variant A of the intron. The species-specific primer pair RP2S6_huso_F - RP2S6_groupA_R was validated on all remnant 341 tissue samples (Table 1) by direct PCR. Amplification conditions were optimized as follows: a denaturation step at 94°C for 2’, 35 cycles at 94°C for 30’’, 61°C for 30’’, 72°C for 15’’, and a final elongation at 72°C for 5’.
In addition, a forward primer, also specific for the group A (RP2S6_groupA_F 5’-GGGTCATAGACAGTCTTTGC-3’) was designed upstream the beluga specific polymorphism. This primer, if paired with RP2S6_groupA_R, allows the amplification of a limited region of RP2S6 (about 230bp depending on the species) that can be directly sequenced and yields chromatograms of acceptable quality. The primer can be used to characterize the beluga diagnostic SNP by sequencing if needed.
4
ACCEPTED MANUSCRIPT
163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178
Finally, all samples were also checked for the amplification of a positive control to confirm the quality of the DNA
179
3. Results
180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203
3.1. Intron characterization
extracts. To this purpose, the same primer pair pc_RP1F – RP1_LocusA_R, developed on the RP1S7 gene as positive control by Boscari et al. (2014a), was used. Two species specific primers for A. ruthenus and for A. naccarii from the same RP1S7 panel were used in combination with the RP2S6 tool here presented to test the 10 hybrid with these two species. The two PCR were separately performed and co-loaded in the agarose gel (Fig 3).
RI PT
All PCR reactions were performed in a total volume of 20 µl with the following final concentrations: 0.5 µM of each primer, 0.1 mM dNTPs, 1X buffer (mM KCl, 15 mM MgCl2, 100 mM Tris-HCl pH 8.3, 1 mg/ml BSA, 100 mM (NH4)2SO4, 0.5 U of Taq DNA polymerase (RBC Bioscience) and 10 ng of extracted DNA template.
2.4. Efficacy test on caviar samples
In order to assess efficacy of the marker on caviar, which is usually the target tissue of forensic genetic identification,
SC
18 samples of commercial caviar were also analyzed, 7 of them from pure Beluga, 10 from Bester hybrids and one from a hybrid in which the Beluga was the paternal species (A. baerii X H. huso) (Table 1). The amplification conditions
M AN U
were the same used for the other samples.
A total of 1867 introns were predicted by the in silico alignment of transcriptomes against available teleost genomes. Among them, a subset of loci detectable in all transcriptomes and genomes was selected. Among these, RP2S6 was selected for sequencing. The RP2S6 length is 326 bp in T. rubipres, 1629 bp in L. chalumnae and 1778 bp in D. rerio.
TE D
In sturgeons, the amplification with RP2S6_F - RP2S6_R primer pair (designed on the flanking exonic regions) produced an approximately 600 bp long fragment. A total of 70 sequences from 65 individuals of 11 species were obtained after cloning (Table 1 and Fig. 1; Accession number XXXXXX-XXXXX). The cluster analysis showed two groups of sequences (A and B in Fig. 1), assumed here to be different loci analogously to what was previously observed for the first intron of RPS7 gene (Boscari et al., 2014a).
EP
Several putatively diagnostic SNPs for the species A. fulvescens, A. stellatus, A. transmontanus, A. naccarii and A. sinensis were observed in both groups A and B (Fig. 2). However, they were not further investigated in the present work since, for the same species, fully efficient diagnostic SNPs are already available (Boscari et al., 2014a) (Fig. 2).
AC C
The search for intra-species fixed mutations was focused on group A, for which a higher number of sequences was available. At this locus, two putatively diagnostic markers for the Beluga sturgeon were detected at positions 96 and 304 of our multi-alignment (Fig. 2). For the SNP in position 304, a specific-primer pair was projected and validated in the present work, while the specificity of the SNP at position 96 was not further validated.
3.2. SNP validation The amplification of the RP1S7 positive control provided a band of the expected size (306bp) in all samples used in this work, thus confirming the quality of our DNA extracts. The amplification of RP2S6 using the Beluga-specific primers, yielded the expected 194 bp fragment in all 170 Beluga samples analyzed, while no PCR products were detected in the non-target species for a total of 341 tested individuals (Table 1). Interestingly, three of the animals provided as Beluga from the Danube River didn’t yield any amplification
5
ACCEPTED MANUSCRIPT
204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222
bands and after checking the mitochondrial Control Region and the RP1S7 specific markers (Boscari et al., 2014a) they
223
4. Discussion
224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244
Species like sturgeons, that have both a relevant commercial interest and are under trade control (CITES), are the
all identified as stellate sturgeons (A. stellatus). These results indicate a 100% identification power. The primer pair RP2S6_huso_F - RP2S6_groupA_R can now be used in combination with the RP1S7 SNPs-panel to also detect sturgeon hybrids such as H. huso x A. ruthenus (Bester), A. gueldenstaedtii x H. huso, A. baerii x H. huso and A. naccarii x H. huso, with an identification power that for each hybrid depends on the single efficiencies of the
RI PT
markers for the two parental species. An example of two hybrid samples tested by combining RP1S7 panel (for A. ruthenus and for A. naccarii) with RP2S6 is reported in Fig. 3: the band patterns of one Bester and one A. naccarii x H. huso hybrids are compared with the band profile of their pure parental species. As expected, all individuals belonging to the above two hybrids presented diagnostic bands of both parental species.
SC
3.3. Efficacy test on caviar samples
All 18 caviar samples analyzed from pure Beluga or from first generation hybrids resulted positive to the amplification. DNA was purified from single eggs, thus confirming that PCR test based nuclear markers have a good sensitivity even
M AN U
from samples purified from a low number of cells and with a potential problems given by the presence of significant amount of lipids which might inhibit PCR amplification (Aranishi, 2006).
TE D
preferred target of commercial fraud. For these species, the possibility of setting up a reliable, fast and cheap method for species identification is of primary importance.
In the present study, we carried out the genetic characterization of the predicted second intron of the nuclear encoded S6 Ribosomal Protein (RP2S6) and we identified the first nuclear marker for the identification of the Beluga sturgeon (H. huso). The simplicity and the flexibility of this approach, simply based on a single locus diagnostic PCR visualized on
EP
agarose gel and highly efficient from both tissue and caviar samples make this marker an ideal tool for commercial controls. On contrary, the standard and widespread application of mitochondrial markers, though working well in this species, usually relies on the sequencing of the amplified region, which is much more expensive and time consuming,
AC C
not conducive to a fast response in a routine analysis. It is worth noting that an alternative approach for analyses of the mitochondrial Control Region was proposed by Mugue et al. (2008), in which species-specific SNPs are used as target sites of primers used for diagnostic PCR. The reason for which sequencing still remains the most used approach for mtDNA analyses is likely the propensity to use already tested and widely validated methods, and in part to the utility of providing solid evidence in support of obtained results, such as the comparison with public GenBanks. Whatever approach is used for the analyses, the inability to trace the paternal species in hybrids remains a major limitation of mitochondrial markers. Our RP2S6 marker, combined with the species-specific primer pairs previously developed for other different sturgeon species on the RP1S7 locus (Boscari et al., 2014a), also ensure the identification of several hybrids having the Beluga as parental species. In our study, this was demonstrated for the Bester on both caviar and meat. A Bester sample is expected to yield a positive amplification with both the Beluga and Sterlet specific bands, respectively 194 and 169 bp long. Theoretically, the same results can be obtained by the inverse hybrid (A. ruthenus female X H. huso male). However, while the Bester is commercially relevant, the inverse hybrid has never been
6
ACCEPTED MANUSCRIPT
245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280
produced to our knowledge, making the analysis of hybrid direction unnecessary. The positive amplification of both the
281
5. Conclusion
282 283 284
The interspecific variability at the second predicted intron of the RPS6 nuclear ribosomal gene was explored with the
Beluga and the Sterlet specific bands is sufficient to classify a sample as Bester. Recently, Dudu et al. (2015) identified three microsatellite loci (LS54, LS68 and Aox45) with distinct allelic ranges in the H. huso and A. ruthenus, and proposed them as tools to distinguish Bester from the two parental species. However, the allelic ranges of the above microsatellites overlap with those of several other sturgeon species, limiting their application to international trade
RI PT
control in which all sturgeon species should be unambiguously distinguished. The RP2S6 marker is also of particular importance to identify hybrid products in which the Beluga is used as paternal species, such as A. naccarii female x H. huso male, A. baerii female and H. huso male and A. gueldenstaedtii female x H. huso male. Indeed, in these cases, the Beluga is untraceable by mtDNA and the availability of this beluga-specific nuclear marker is currently the only way to successfully detect this species, as shown by the positive results obtained on the hybrids with the Adriatic sturgeon (A. naccarii) as maternal species and on the caviar produced by a hybrid female
SC
(A. baerii X H. huso).
One of the relevant aspects of this study is represented by the high heterogeneity of the Beluga specimens used for validation (Table 1). Accordingly, one of the main requirements in setting up a reliable marker for species identification
M AN U
is that the entire genetic variability of the target species must be covered, otherwise the marker cannot be considered as universal. For this reason, we have involved the major research institutions working on the Beluga across the entire geographical range of the species in the validation phase. Given the 100% correct identification rate on such a heterogeneous sample, and the proved efficiency on all caviar samples tested, the probability that our marker fails in detecting natural or aquaculture stocks of beluga is minimized.
For what concerns the detection efficiency of hybrids, this is given by the probability of transmission of the “beluga” chromosome. For this reason, first generation hybrids are always detectable while, in the in the following generations
TE D
(F2 or F3), the detection efficiency progressively decreases following the Mendelian inheritance model. The only way to unambiguously detect F2 and F3 hybrids is to increase the number of unlinked diagnostic nuclear markers, thus increasing the probability that at least one of them is successfully transmitted along the multigenerational genealogy. Like the already cited RP1S7 (Boscari et al., 2014a), the marker here presented was isolated within an intronic region of a ribosomal protein, the RPS6, suggesting the high potential of these regions for species identification purposes. Several
EP
other introns were predicted through the in silico analysis, raising the possibility that to future studies will find additional diagnostic markers for those species that are not detectable so far, such as Kaluga and Amur sturgeons (H. dauricus and A. schrenckii). These two species are highly hybridized in both directions in aquaculture and no diagnostic
AC C
marker is yet available. Their importance has recently increased in the international market as a consequence of the exponential increase of sturgeon production in China (Bronzi & Rosenthal, 2014). The identification of interspecific hybrids also has high conservation relevance in the management of captive broodstocks used for the production of fingerlings for release programs. Hybrids are often accidentally mixed into captive stocks of pure origin, (Congiu et al., 2011; Boscari & Congiu 2014; Boscari et al., 2014b) as the hatcheries that provide animals for restocking often produce sturgeon also for commercial purposes (Chebanov et al., 2011).
aim of finding a suitable marker for the identification of the Beluga species, the name of which is preferentially used to mislabel less valuable caviars in commercial fraud. The diagnostic nuclear marker characterized in this study, and
7
ACCEPTED MANUSCRIPT
suitable for the analyses of both tissue and caviar, allows the identification of pure Beluga and remarkably, of its first generation hybrids, which are massively produced and commercialized worldwide. The marker presented here enhances the panel of sturgeon species identification tools of fast and efficient applicability. This can be considered a further step towards effective control of the international trade of these critically endangered and highly valuable species. The isolation of this marker will benefit not only the enforcement of trade controls but also
RI PT
the management of residual genetic diversity in many sturgeon species, by enabling the detection of hybrids accidentally mixed into captive broodstocks used for ex situ conservation.
Acknowledgements
The authors thank the students Stefano Rossi, Marco Macatrozzo and Valentina Borgato for their assistance in the laboratory procedures. Thanks to the producers Agroittica Lombarda and Caviar Giaveri for providing caviar samples
SC
used for the sensitivity test. Many thanks also to our colleague Prof. QiWei Wei for providing part of the samples of Amur and Kaluga sturgeons used during the validation of the primer. The study was in part funded by the Po River Delta Park (Veneto Region), which co-financed a post-doctoral position at the University of Padova (E.B.) and by a
References
M AN U
PRID-SEED project of the Department of Biology-University of Padova.
Amemiya, C. T., Lander, E. S., & Myers, R. M. (2006). A white paper for sequencing the genome of a living fossil: the coelacanth, Latimeria chalumnae.
http://www.genome.gov/pages/research/sequencing/seqproposals/coelacanthgenomewhitepaper.pdf
TE D
Aranishi, F. (2006). Single fish egg DNA extraction for PCR amplification. Conservation Genetics, 7, 153-156. Barmintseva, A. E., & Mugue, N. S. (2013). The use of microsatellite loci for identification of sturgeon species (Acipenseridae) and hybrid forms. Russian Journal of Genetics, 49, 950-961.
Boscari, E., Barbisan, F., & Congiu, L. (2011). Inheritance pattern of microsatellite loci in the polyploidy Adriatic
EP
sturgeon (Acipenser naccarii). Aquaculture, 321, 223-229.
Boscari, E., Barminsteva, A., Pujolar, J. M., Doukakis, P., Mugue, N., & Congiu, L. (2014a). Species and hybrid identification of sturgeon caviar: a new molecular approach to detect illegal trade. Molecular Ecology Resources, 14,
AC C
285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323
489-498.
Boscari, E., & Congiu, L. (2014). The need for genetic support in restocking activities and ex situ conservation programmes: the case of the Adriatic sturgeon (Acipenser naccarii Bonaparte, 1836) in the Ticino River Park. Journal of Applied Ichthyiology, 30, 1416–1422.
Boscari, E., Pujolar, J. M., Dupanloup, I., Corradin, R., & Congiu, L. (2014b). Captive breeding programs on family groups in polyploidy sturgeons. PLos ONE, 9(10), e110951. doi: 10.1371/journal.pone.0110951.
8
ACCEPTED MANUSCRIPT
324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352
Boscari, E., Vidotto, M., Martin, D., Papetti, C., Ogden, R., & Congiu, L. (2015). Microsatellites from the genome and
353
parental species (♀ Huyso huso Linnaes, 1758 and ♂ Acipenser ruthenus Linnaeus, 1758) by nuclear markers. Animal
354 355 356 357 358 359 360 361 362
Science and Biotechnologies, 48, 81-85.
the transcriptome of the tetraploid Adriatic sturgeon, Acipenser naccarii (Bonaparte, 1836) and cross-species applicability to the diploid beluga sturgeon, Huso huso (Linnaeus, 1758). Journal of Applied Ichthyiology, 31, 977-983.
Brenner, S., Elgar, G., Sanford, R., Macrae, A., Venkatesh, B., & Aparicio, S. (1993). Characterization of the pufferfish
RI PT
(Fugu) genome as a compact model vertebrate genome. Nature, 366, 265-268.
Bronzi, P., & Rosenthal, H. (2014). Present and future sturgeon and caviar production and marketing: a global market overview. Journal of Applied Ichthyology, 30, 1536-1546.
Bronzi, P., Rosenthal, H., & Gessner, J. (2011). Global sturgeon production: an overview. Journal of Applied
SC
Ichthyology, 27, 169-175.
Chebanov, M., Rosenthal, H., Gessner, J., Van Anrooy, R., Doukakis, P., Pourkazemi, M., & Williot, P. (2011).
No. 570. Ankara, FAO. 2011. 110pp.
M AN U
Sturgeon hatchery practices and management for release–Guidelines. FAO Fisheries and Aquaculture Technical Paper.
Congiu, L., Dupanloup, I., Patarnello, T., Fontana, F., Rossi, R., Arlati, G., & Zane, L. (2001). Identification of interspecific hybrids by amplification fragment length polymorphism: the case of sturgeon. Molecular Ecology, 10, 2255-2359.
TE D
Congiu, L., Fontana, F., Patarnello, T., Rossi, R., & Zane, L. (2002). The use of AFLP in sturgeon identification. Journal of Applied Ichthyology, 18, 286-289.
Congiu, L., Pujolar, J.M., Forlani, A., Cenadelli, S., Dupanloup, I., Barbisan, F., Galli, A., & Fontana, F. (2011). Managing polyploidy in ex situ conservation genetics: the case of the critically endangered Adriatic sturgeon
EP
(Acipenser naccarii). PLoS ONE, 6(3), e18249. doi: 10.1371/journal.pone.0018249.
AC C
Dudu, A., Macarie, R. D., Burcea, A., Georgescu, S. E., & Costache, M. (2015). Identification of Bester hybrids and its
Fain, S. R., Straughan, D. J., Hamlin, B. C., Hoesch, R. M., & LeMay, J. P. (2013). Forensic genetic identification of sturgeon caviars traveling in world trade, Conservation Genetics, 14, 855-874.
Hale, M. C., McCormick, C. R., Jackson, J. R., & DeWoody, J. A. (2009). Next-generation pyrosequencing of gonad transcriptomes in the polyploidy lake sturgeon (Acipenser fulvescens): the relative merits of normalization and rarefaction in gene discovery. BMC Genomics, 10, 203.
9
ACCEPTED MANUSCRIPT
Howe, K., Clark, M. D., Torroja, C. F., Torrance, J., Berthelot, C., Muffato, M., Collins, J. E., & Humphray, S. et al. (2013). The zebrafish reference genome sequence and its relationship to the human genome. Nature, 496(7446), 498503.
Jahnichen, H., Kohlmann, K., & Renner, B. (1999). Juvenile growth of Acipenser ruthenus and 4 different sturgeon
RI PT
hybrids. Journal of Applied Ichthyology, 15, 248-249.
Johnson, T. A., & Iyengar, A. (2015). Phylogenetic evidence for a case of misleading rather than mislabeling in caviar in the United Kingdom. Journal of Forensic Science, 60 Suppl 1, S248-53.
Acipenseriformes revisited. Journal of Applied Ichthyology, 24, 36–45.
SC
Krieger, J., Hett, A. K., Fuerst, P. A., Artyukhin, E., & Ludwig, A. (2008). The molecular phylogeny of the order
M AN U
Ludwig, A. (2008). Identification of Acipenseriformes in trade. Journal of Applied Ichthyology, 24(Sulppl. 1), 2-19.
Ludwig, A., Lieckfeldt, D., & Jahrl, J. (2015). Mislabeled and counterfeit sturgeon caviar from Bulgaria and Romania. Journal of Applied Ichthyology 31, 587-591.
Mugue, N. S., Barmintseva, A. E., Rastorguev, S. M., Mugue, V. N., & Barminsev, V. A. (2008). Polymorphism of the mitochondrial DNA control region in eight sturgeon species and development of a system for DNA-based species
TE D
identification. Russian Journal of Genetics, 44, 793-798.
Ogden, R., Gharbi, K., Mugue, N., Martinsohn, J., Senn, H., Davey, J.W., Pourkazemi, M., Mcewing, R., Eland, C., Vidotto, M., Sergeev, A., & Congiu, L. (2013). Sturgeon conservation genomics: SNP discovery and validation using RAD sequencing. Molecular Ecology, 22, 3112-3123.
EP
Omoto, N., Maebayashi, M., Mitsuhashi, E., Yoshitomi, K., Adachi, S., & Yamauchi, K. (2001), Histological observations of gonadal sex differentiation in the F2 hybrid sturgeon, the bester. Fisheries Science, 67, 1104–1110.
Raymakers, C. (2006). CITES, the Convention on International Trade in Endangered Species of Wild Fauna and Flora:
AC C
363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402
its role in the conservation of Acipenseriformes. Journal of Applied Ichthyology, 22(Suppl. 1), 52-65.
Rozhkovan, K. V., Chelomina, G. N., & Rachelek, E. I. (2008). Molecular identification and the features of genetic diversity in interspecific hybrids of Amur sturgeon (Acipenser schrenckii x A. baerii, A. baerii x A. schrenckii, A. schrenckii x A. ruthenus, and A. ruthenus x A. schrensckii) based on variability of multilocus RAPD markers. Genetika, 44, 1453-1460.
Slater, G.S., & Birney, E. (2005). Automated generation of heuristics for biological sequence comparison. BMC Bioinformatics, 15, 6-31.
10
ACCEPTED MANUSCRIPT
Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6: Molecular Evolutionary Genetics AnalysisVersion 6.0. Molecular Ecology, 30, 2725-2729.
Van Uhm, D., & Siegel, D. (2016). The illegal trade in black caviar. Trends in Organzed Crime, 19, 67-87.
RI PT
Vidotto, M., Grapputo, A., Boscari, E., Barbisan, F., Coppe, A., Grandi, G., Kumar, A., & Congiu, L. (2013). Transcriptome sequencing and de novo annotation of the critically endangered Adriatic sturgeon. BMC Genomics, 14, 407.
Vidotto, M., Grapputo, A., Boscari, E., Zane, L., & Congiu, L. (2015). Transcriptomic resources for the critically endangered starlet sturgeon Acipenser stellatus. Molecular Ecology Resources, 15, 1256-1257. doi: 10.1111/1755-
SC
0998.12439. In Genomic Resources Development Consortium, Almieda-Val, V. M. F., Boscari, E., Coelho, M. M., et al. (2015) Genomic Resources Notes accepted 1 April 2015 - 31 May 2015. http://dx.doi.org/10.5061/dryad.kj4mh.
M AN U
Yarmohammadi, M., Shabani, A., Pourkazemi, M., & Baradaran Noveiri, S. (2012). Identification of bester hybrids (female Huso huso Linnaeus, 1758 and male starlet Acipenser ruthenus Linnaeus, 1758) using AFLP molecular
EP
TE D
technique. Iranian Journal of Fisheries Science, 11, 415-423.
AC C
403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419
11
ACCEPTED MANUSCRIPT
Table 1. Sampling information about all individuals and species used for the RP2S6 characterization and SNP validation. Results of the marker efficiency are reported as percentage on the total number of analyzed individuals of each species (in brackets in the last column). Caviar samples are indicated, all other samples were provided as fin clips N. samples
Sample origin
5 21 20 19 17 83 5 6
H. huso
A. baerii
14 7
10 9 6
A. naccarii
23
3 (3 + 0)
10
0% (14)
3
1 (0 + 1)
11
0% (14)
12
6 (3 + 3)
29
0% (41)
3
4 (4 + 0)
16
0% (19)
3
10 (8 + 2)
22
0% (25)
3
10 (7 + 3)
18
0% (21)
-
5
100% (5)
-
-
5
100% (5)
-
-
1
100% (1)
6
University of Padova VIP (Northern Italy fish farm) Agroittica Lombarda (producer) IZW Berlin Collection
-
-
-
6
100% (6)
1
Caviar Giaveri (producer)
-
-
1
100% (1)
10
IZW Berlin Collection
-
-
10
100% (10)
65
70
EP
11 1 1 1 5 22
TE D
8
3
21
AC C
5 5 1
H. huso x A. ruthenus (CAVIAR) Total
0% (27)
4
A. baerii x H. huso (CAVIAR)
20
0% (15)
A. sinensis
H. huso (CAVIAR)
4 (0 + 4)
12
9 14 33
A. naccarii x H. huso
0% (27)
3 (2 + 1)
5
H. huso x A. ruthenus
7
20
3
3
A. trasnmontanus
H. dauricus
9 (4 + 5)
100% (170)
0% (23)
3
A. schrenckii
7
153
20
3
A. stellatus
15 (12 + 3)
% positive amplifications RP2S6 (n)
5 (5 + 0)
3
A. ruthenus
17
VIP (Northern Italy fish farm) – U.G.O. Caspian Sea Black Sea Ural River (Russia) Azov Sea Danube River (Romania) IZW Berlin Collection Lena River (Russia) Lake Baikal (Siberia, Russia) Ob’ River (Siberia, Russia) VIP (Northern Italy fish farm) – U.G.O. Azov Sea Caspian Sea Volga River (Russia) VIP (Northern Italy fish farm) Embarras River (Wisconsin) Lake Winnebago (Wisconsin) Wolf River (Wisconsin) Upper Fox River (Wisconsin) Bad River (Wisconsin) VIP (Northern Italy fish farm) – U.G.O. North America Yangtze River (China) Danube River (Romania) VIP (Northern Italy fish farm) – U.G.O. Danube River (Romania) USSR Kazakhstan Iran IZW Berlin Collection Amur River (China) Yangtze River Fisheries Research Institute (China) Amur River (China)
N. samples validated by PCR
3
3 A. fulvescens
N. sequenced clones (group A + group B)
M AN U
2 A. gueldenstaedtii
N. sequenced samples
RI PT
Species
SC
420 421 422
406 (+ 18 caviars)
423
12
341 (+ 18 caviars)
ACCEPTED MANUSCRIPT
Figure Captions
Fig.1 Cluster analysis including all INT166 cloned sequences of the RPS6 obtained from 65 individuals of 11 species. The Neighbor Joining was based on the number of nucleotide differences among sequences applying the pairwise deletion option and the bootstrap test for phylogeny with 10000 replications. The two putative loci are named as group
RI PT
A and group B.
Fig. 2 Multi-species alignment of the second intron of the ribosomal protein S6 (RP2S6, group A and B) including one consensus sequence per species. Shaded regions correspond to primers used in this work (the name of each primer is reported below the corresponding region and the original sequence is reported in the text, paragraphs 2.2 and 2.3). The two SNPs detected for H. huso are framed; only the second one has been validated as a diagnostic marker. Additional
SC
putatively diagnostic positions for different species, though not validated in the present work, are underlined.
Fig. 3. Expected band pattern of two sturgeon hybrids (H. huso x A. ruthenus and A. naccarii x H. huso) and their pure
M AN U
parental species on agarose gel obtained by combining independent amplification products of the RP2S6 and RP1S7 tools. The sample order is: (1) A. ruthenus, (2) Bester (H. huso x A. ruthenus), (3) H. huso, (4) A. naccarii x H. huso,
EP
TE D
(5) A. naccarii. The specific-band sizes are reported for pure species. Positive controls are not shown.
AC C
424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442
13
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT
S0956-7135(16)30673-9
DOI:
10.1016/j.foodcont.2016.11.039
Reference:
JFCO 5369
To appear in:
Food Control
Please cite this article as: Elisa Boscari, Nicola Vitulo, Arne Ludwig, Chiara Caruso, Nikolai S. Mugue, Radu Suciu, Dalia F. Onara, Chiara Papetti, Ilaria A.M. Marino, Lorenzo Zane, Leonardo Congiu, Fast genetic identification of the Beluga sturgeon and its sought-after caviar to stem illegal trade, Food Control (2016), doi: 10.1016/j.foodcont.2016.11.039 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT
Highlights
The first nuclear marker for the identification of the Beluga sturgeon is proposed.
The marker application is fast, inexpensive, reliable and reproducible .
RI PT
The Marker was identified in the second intron of the Ribosomal Protein S6.
AC C
EP
TE D
M AN U
SC
The tool can be used for the identification of Beluga also in interspecific hybrids.
ACCEPTED MANUSCRIPT
1
Fast genetic identification of the Beluga sturgeon and its sought-after caviar to stem illegal trade.
2 3
Elisa Boscaria, Nicola Vitulob, Arne Ludwigc, Chiara Carusoa, Nikolai S. Mugued,e, Radu Suciuf,
4
Dalia F. Onaraf, Chiara Papettia, Ilaria A.M. Marinoa, Lorenzo Zanea, Leonardo Congiua*. a
Department of Biology, University of Padova, I-35131 Padova, Italy Department of Biotechnology, University of Verona, Verona 37134, Italy.
c
Leibniz-Institute for Zoo and Wildlife Research, 10252 Berlin, Germany.
d
Russian Federal Research Institute of Fisheries and Oceanography, Moscow 107140, Russia
e
Institute of Developmental Biology RAS, Moscow 117808, Russia
f
Danube Delta National Institute for Research and Development, Tulcea 820112, Romania
SC
b
Corresponding author: Leonardo Congiu Email: [email protected] Tel: +39 049 8276218 Fax: +30 049 8276209
18
M AN U
6 7 8 9 10 11 12 13 14 15 16 17
RI PT
5
19
Abstract
20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37
Sturgeons are well known for the delicacy of their eggs, the caviar, one of the most valuable products on the food
TE D
market. The high price of caviar led in the past to a severe overharvest of wild sturgeon species and to an increase in trade of counterfeit products sold with impunity in spite of the strict trade limitations. A priority in the effort to reduce illegal trading is the development of genetic tools in order to identify the species of traded products using a standardized, cheap and rapid approach. We developed the first genetic nuclear marker for the identification of the Beluga sturgeon (Huso huso), the most sought-after caviar producer. We explored the interspecific variability at the
EP
second intron of the nuclear S6 Ribosomal Protein (RP2S6), selected among 1867 introns, predicted by aligning the transcriptome of 3 sturgeon species with 3 complete fish genomes. The Beluga-specific SNP was identified by cloning and sequencing RP2S6 in 65 individuals of 11 species, validated on 341 additional individuals and tested on 18 caviar
AC C
samples. Diagnostic primers designed on the SNP successfully amplified the expected band in all Beluga specimens while no PCR product was obtained from other pure species. The marker can also contribute to the identification of interspecific hybrids in which the Beluga is one of the parent species, such as in the case of the Bester, which produces one of the most mislabeled caviars in trade. The complete identification power on this highly relevant species and the proved efficacy on caviar samples represent an essential progress towards a standardized panel of nuclear markers for the control of illegal poaching, smuggling and mislabeling of sturgeons and their products.
Keywords (4 to 6) Sturgeon, Huso huso, RP2S6, Bester, species identification, hybrids
38 39 40 1
ACCEPTED MANUSCRIPT
41
1. Introduction
42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81
Sturgeons are an archaic group of fish known, for centuries, as producers of caviar, one of the most valuable food delicacies on the world’s market (Fain et al., 2013). Overfishing of wild stocks, encouraged by high profits from illegal markets, is the major cause that has led all sturgeon species to the brink of extinction, inducing the International Union for Conservation of Nature (IUCN) to list them as one of the most imperiled group of animals worldwide (IUCN press
RI PT
release of 18, Mar, 2010, https://www.iucn.org/press/news-releases). Despite protection measures, a significant illegal trade still exists, in which caviar from unsustainable natural sources is sold under false labels (Ogden et al., 2013; Van Uhm & Siegel, 2016). In the last decades, the demographic collapse of sturgeon natural populations and the high demand for caviar on the international market have stimulated a rapid increase of commercial aquaculture programs, mainly aimed at caviar production. The most recent published census of sturgeon aquaculture plants, conducted in 2013
SC
(Bronzi & Rosenthal, 2014), listed 640 sturgeon farms worldwide. This number has more than tripled in four years and over than 2.100 farms are now counted (Paolo Bronzi, personal communication), mostly due to an exponential increase in Chinese production and in part to the more exhaustive census recently conducted by this country. In parallel, the high performances of interspecific hybrids in terms of growth rate (Jahnichen et al., 1999) and early gonad maturation
M AN U
(Omoto et al., 2001) prompted a massive increase in their aquaculture production. More than 10 pure sturgeon species and several interspecific hybrids are reared for their caviar, with different yields in terms of production efficiency and product quality. Consequently, mislabeling of caviar is common and often, caviar obtained from less valuable species or hybrids is sold as top quality (Ludwig et al. 2015). The most popular brands used to counterfeit commercial caviar are, in order of importance, Beluga, Osietra and Sevruga, respectively produced by Huso huso, Acipenser gueldenstaedtii/persicus and A. stellatus.
In this context, the availability of reliable methods for the validation of the declared species is urgently needed to
TE D
effectively control illegal trade and commercial fraud in one of the most expensive foods of animal origin (Ludwig, 2008; Ogden et al., 2013). Since 1997, when all sturgeon species were included in the Appendices of the Convention on International Trade in Endangered Species (CITES) (Raymakers, 2006), a broad variety of genetic methods have been explored for their applicability to sturgeon species identification (Ludwig, 2008). Currently, mitochondrial regions such as the Cytochrome b and the Control Region are used in routine analyses (Krieger et al., 2008; Mugue et al., 2008;
EP
Johnson & Iyengar, 2015, Ludwig, 2008). Mitochondrial genes, however, are usually analyzed by sequencing, making them suboptimal for routine controls in which a cheap and immediate response is required (Ogden et al., 2013); moreover, these markers have incomplete discrimination power for some closely related species (Ludwig, 2008; Ogden
AC C
et al., 2013) and are not useful for the identification of interspecific hybrids. In fact, mitochondrial markers are maternally inherited and cannot detect paternal contribution, leading to the misclassification of hybrids as belonging to their maternal species. In this way, hybrids can be easily commercialized under the false label of a pure species (Mugue et al., 2008; Bronzi et al., 2011). Only in the last few decades have genetic investigations begun to assess the suitability of different nuclear markers for sturgeon species and hybrid identification (Ludwig, 2008). The suitability of these approaches for routine analyses, however, is limited by low reproducibility, high costs, complexity of the protocol or low cross-applicability of isolated markers (Congiu et al., 2001, 2002; Rozhkovan et al., 2008; Yarmohammadi et al., 2012; Barmintseva & Mugue, 2013; Boscari et al., 2015). Recently, Boscari et al. (2014a) developed a Single Nucleotide Polymorphism (SNP)-based method of caviar identification, which looks promising due to its simplicity of application and its applicability across several sturgeon species. The method is based on the application of a panel of primers specifically designed to target species-specific SNPs, identified by the authors within the first intron (RP1) of the nuclear encoded S7 Ribosomal Protein (RP1S7). At
2
ACCEPTED MANUSCRIPT
82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97
present, the method allows for the identification of 7 species (Acipenser naccarii, A. fulvescens, A. stellatus, A. sinensis,
98
2. Materials and Methods
the RPS7 gene, no diagnostic marker was identified for the most valuable sturgeon species, the Beluga sturgeon (H. huso), currently detectable only by the mitochondrial DNA analysis. H. huso is also used for the production of the Bester, one of the most known and commercialized hybrids, widely
RI PT
farmed in Russia, Germany, Hungary, Japan and Italy and sold worldwide (Bronzi et al., 2011; Yarmohammadi et al., 2012; Omoto et al., 2001). The Bester hybrid is obtained by crossing a Beluga female (H. huso) with a Sterlet (A. ruthenus) male and it is easily misidentified as pure Beluga by mitochondrial DNA analysis.
In the present study, taking advantage of the available transcriptomes of three sturgeon species, A. fulvescens, A. naccarii and A. stellatus (Hale et al., 2009, Vidotto et al., 2013, 2015), we explored the potential of intronic regions, as suitable markers for species identification in tissue and caviar samples. In particular, we present the results obtained by
SC
the analyses at a Single Nucleotide Polymorphism (SNP) located in the second intron (RP2) of the nuclear encoded S6 Ribosomal Protein (RP2S6). This marker complements the RP1S7 tool and represents an important step towards the
sturgeon species and hybrids.
2.1. Sampling and DNA extraction
M AN U
creation of a standardized and cheap protocol suitable in routine analysis for trade controls for fast identification of
A total of 406 tissue samples belonging to 11 pure species and 2 interspecific hybrids were analyzed in the present study (Table 1). Individuals of the different species were opportunely selected from different geographical origins or,
TE D
when possible, based on pedigree information in order to avoid the selection of related specimens. Sixty-five individuals were used for the characterization of the intronic region RP2S6, while a subsequent validation phase was implemented on 341 additional animals. For all tissue samples, genomic DNA was purified from fin clips using the EuroGOLD Tissue DNA Mini Kit (Euroclone) and stored at -20°C. In addition, 18 caviar samples (Table 1) were used in a sensitivity test. For each caviar, up to three eggs were independently processed and DNA purified using the
EP
DNeasy Blood & Tissue extraction kit (Qiagen).
2.2. Intron characterization, cloning and sequencing The intron RP2S6, characterized in this work, was predicted by aligning assembled transcriptomes of three sturgeon
AC C
99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122
A. transmontanus, A. ruthens and A. baerii) and their hybrids, most of which with 100% accuracy. Unfortunately, using
species (A. fulvescens, A. naccarii and A. stellatus) (Hale et al., 2009; Vidotto et al., 2013, 2015) against three available genomes of teleost fishes (Takifugu rubipres, Latimeria chalumnae and Danio rerio) (Brenner et al., 1993; Amemiya et al., 2006; Howe et al., 2013). Fugu genome sequence (fr3 assembly, October 2011) was downloaded from “UCSC Genome Browser web site” (http://hgdownload.soe.ucsc.edu/goldenPath/fr3/bigZips/); while Latimeria (latCha1 assembly) and Zebrafish (Zv9 assembly) genome sequences were downloaded from ENSEMBL ftp site (ftp://ftp.ensembl.org/pub/release-75/fasta/). The transcriptome assembly sequences were aligned on the reference genomes using the program Exonerate (Slater & Birnay, 2015) setting the model option to “est2genome”. To retrieve intron conservation across multiple genomes we used several homemade perl scripts. The pipeline is composed by different steps. Briefly, Exonerate outputs were parsed, cDNA sequence mapping coordinates as well as teleost genomes introns coordinates were retrieved. In a second step, a comparison within each reference genome was performed. During this step, introns identified by multiple
3
ACCEPTED MANUSCRIPT
transcriptome libraries were retrieved and checked for consistency. Finally, introns shared by all the genomes and confirmed by a high number of sequences were selected for further analysis. Two primers were designed on the exon flanking regions (RP2S6_F 5’-TTCATGGGGAAACCCTGCTT3’ and RP2S6_R 5’-ATCCTCTGGGTGAGGAGTG-3’) to amplify and sequence the predicted RP2S6. Touch Down (TD)PCR conditions were as follows: a preliminary denaturation step at 94°C for 2’, a first phase for 6 touch down cycles
RI PT
with denaturation at 94°C for 30’’, starting annealing temperature of 63°C for 30’’ decreasing half a degree at each cycle, extension at 72°C for 15’’, followed by 35 cycles at 94°C for 30’’, 60°C for 15’’, 72°C for 15’’, and a final elongation at 72°C for 5’. After checking the PCR products on 1.8% agarose gel stained with GelRed (BIOTIUM, GelRedTM Nucleic Acid Stain, 10000X in Water), they were purified using ExoSAP-IT® and directly sequenced at the external service BMR Genomics. Due to the presence of a putative duplicated locus and the high ploidy level of some of the tested species, the resulting chromatograms showed some double or triple peaks after direct sequencing, thus
SC
sequences were often unreadable and PCR products were cloned. In this preliminary phase, the RP2S6 fragment was amplified from a total of 65 individuals belonging to 11 species and PCR products from different individuals of the same species were pooled before cloning in order to increase the detectable variability. Cloning was performed in
M AN U
JM109 competent cells using the P-GEM-T Easy Vector (Promega) following the manufacturer’s recommendations. A total of 70 clones were sequenced (15 of H. huso, 10 of H. dauricus, 10 of A. schrenckii, 9 of A. baerii, 6 of A. ruthenus, 5 of A. naccarii, 4 of A. stellatus, 4 of A. gueldenstaedtii, 3 of A. fulvescens, 3 of A. transmontanus and 1 of A. sinensis).
2.3. Diagnostic primer designing and SNP validation
All cloned sequences were aligned and checked for the presence of species-specific SNP. A cluster analysis was also
TE D
performed using MEGA6 (Tamura et al., 2013).
Once established the presence of two groups of sequences (group A and group B), better illustrated in the results section, and the presence of informative polymorphisms potentially suitable to distinguish Beluga animals from the other species, species-specific primers were designed.
In detail, a forward primer specific for the Beluga species (RP2S6_huso_F 5’-CATAACATTGCACTGAATGTTATA-
EP
3’) was designed using OligoExplorer (Gene Link, www.genelink.com) on one putative diagnostic SNP: the 3’-end of this specific primer is complementary to the diagnostic mutation and the second to last nucleotide is designed as not complementary to its target nucleotide. In this way, when used on a non-Beluga species, a mismatch of two nucleotides ensures
the
failure
of
the
amplification.
A
reverse
primer
(RP2S6_groupA_R
5’-
AC C
123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162
CTTTCGTTGATTTAGGGAAATGGT3’), to be combined with the above RP2S6_huso_F, was designed in order to selectively amplify the variant A of the intron. The species-specific primer pair RP2S6_huso_F - RP2S6_groupA_R was validated on all remnant 341 tissue samples (Table 1) by direct PCR. Amplification conditions were optimized as follows: a denaturation step at 94°C for 2’, 35 cycles at 94°C for 30’’, 61°C for 30’’, 72°C for 15’’, and a final elongation at 72°C for 5’.
In addition, a forward primer, also specific for the group A (RP2S6_groupA_F 5’-GGGTCATAGACAGTCTTTGC-3’) was designed upstream the beluga specific polymorphism. This primer, if paired with RP2S6_groupA_R, allows the amplification of a limited region of RP2S6 (about 230bp depending on the species) that can be directly sequenced and yields chromatograms of acceptable quality. The primer can be used to characterize the beluga diagnostic SNP by sequencing if needed.
4
ACCEPTED MANUSCRIPT
163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178
Finally, all samples were also checked for the amplification of a positive control to confirm the quality of the DNA
179
3. Results
180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203
3.1. Intron characterization
extracts. To this purpose, the same primer pair pc_RP1F – RP1_LocusA_R, developed on the RP1S7 gene as positive control by Boscari et al. (2014a), was used. Two species specific primers for A. ruthenus and for A. naccarii from the same RP1S7 panel were used in combination with the RP2S6 tool here presented to test the 10 hybrid with these two species. The two PCR were separately performed and co-loaded in the agarose gel (Fig 3).
RI PT
All PCR reactions were performed in a total volume of 20 µl with the following final concentrations: 0.5 µM of each primer, 0.1 mM dNTPs, 1X buffer (mM KCl, 15 mM MgCl2, 100 mM Tris-HCl pH 8.3, 1 mg/ml BSA, 100 mM (NH4)2SO4, 0.5 U of Taq DNA polymerase (RBC Bioscience) and 10 ng of extracted DNA template.
2.4. Efficacy test on caviar samples
In order to assess efficacy of the marker on caviar, which is usually the target tissue of forensic genetic identification,
SC
18 samples of commercial caviar were also analyzed, 7 of them from pure Beluga, 10 from Bester hybrids and one from a hybrid in which the Beluga was the paternal species (A. baerii X H. huso) (Table 1). The amplification conditions
M AN U
were the same used for the other samples.
A total of 1867 introns were predicted by the in silico alignment of transcriptomes against available teleost genomes. Among them, a subset of loci detectable in all transcriptomes and genomes was selected. Among these, RP2S6 was selected for sequencing. The RP2S6 length is 326 bp in T. rubipres, 1629 bp in L. chalumnae and 1778 bp in D. rerio.
TE D
In sturgeons, the amplification with RP2S6_F - RP2S6_R primer pair (designed on the flanking exonic regions) produced an approximately 600 bp long fragment. A total of 70 sequences from 65 individuals of 11 species were obtained after cloning (Table 1 and Fig. 1; Accession number XXXXXX-XXXXX). The cluster analysis showed two groups of sequences (A and B in Fig. 1), assumed here to be different loci analogously to what was previously observed for the first intron of RPS7 gene (Boscari et al., 2014a).
EP
Several putatively diagnostic SNPs for the species A. fulvescens, A. stellatus, A. transmontanus, A. naccarii and A. sinensis were observed in both groups A and B (Fig. 2). However, they were not further investigated in the present work since, for the same species, fully efficient diagnostic SNPs are already available (Boscari et al., 2014a) (Fig. 2).
AC C
The search for intra-species fixed mutations was focused on group A, for which a higher number of sequences was available. At this locus, two putatively diagnostic markers for the Beluga sturgeon were detected at positions 96 and 304 of our multi-alignment (Fig. 2). For the SNP in position 304, a specific-primer pair was projected and validated in the present work, while the specificity of the SNP at position 96 was not further validated.
3.2. SNP validation The amplification of the RP1S7 positive control provided a band of the expected size (306bp) in all samples used in this work, thus confirming the quality of our DNA extracts. The amplification of RP2S6 using the Beluga-specific primers, yielded the expected 194 bp fragment in all 170 Beluga samples analyzed, while no PCR products were detected in the non-target species for a total of 341 tested individuals (Table 1). Interestingly, three of the animals provided as Beluga from the Danube River didn’t yield any amplification
5
ACCEPTED MANUSCRIPT
204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222
bands and after checking the mitochondrial Control Region and the RP1S7 specific markers (Boscari et al., 2014a) they
223
4. Discussion
224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244
Species like sturgeons, that have both a relevant commercial interest and are under trade control (CITES), are the
all identified as stellate sturgeons (A. stellatus). These results indicate a 100% identification power. The primer pair RP2S6_huso_F - RP2S6_groupA_R can now be used in combination with the RP1S7 SNPs-panel to also detect sturgeon hybrids such as H. huso x A. ruthenus (Bester), A. gueldenstaedtii x H. huso, A. baerii x H. huso and A. naccarii x H. huso, with an identification power that for each hybrid depends on the single efficiencies of the
RI PT
markers for the two parental species. An example of two hybrid samples tested by combining RP1S7 panel (for A. ruthenus and for A. naccarii) with RP2S6 is reported in Fig. 3: the band patterns of one Bester and one A. naccarii x H. huso hybrids are compared with the band profile of their pure parental species. As expected, all individuals belonging to the above two hybrids presented diagnostic bands of both parental species.
SC
3.3. Efficacy test on caviar samples
All 18 caviar samples analyzed from pure Beluga or from first generation hybrids resulted positive to the amplification. DNA was purified from single eggs, thus confirming that PCR test based nuclear markers have a good sensitivity even
M AN U
from samples purified from a low number of cells and with a potential problems given by the presence of significant amount of lipids which might inhibit PCR amplification (Aranishi, 2006).
TE D
preferred target of commercial fraud. For these species, the possibility of setting up a reliable, fast and cheap method for species identification is of primary importance.
In the present study, we carried out the genetic characterization of the predicted second intron of the nuclear encoded S6 Ribosomal Protein (RP2S6) and we identified the first nuclear marker for the identification of the Beluga sturgeon (H. huso). The simplicity and the flexibility of this approach, simply based on a single locus diagnostic PCR visualized on
EP
agarose gel and highly efficient from both tissue and caviar samples make this marker an ideal tool for commercial controls. On contrary, the standard and widespread application of mitochondrial markers, though working well in this species, usually relies on the sequencing of the amplified region, which is much more expensive and time consuming,
AC C
not conducive to a fast response in a routine analysis. It is worth noting that an alternative approach for analyses of the mitochondrial Control Region was proposed by Mugue et al. (2008), in which species-specific SNPs are used as target sites of primers used for diagnostic PCR. The reason for which sequencing still remains the most used approach for mtDNA analyses is likely the propensity to use already tested and widely validated methods, and in part to the utility of providing solid evidence in support of obtained results, such as the comparison with public GenBanks. Whatever approach is used for the analyses, the inability to trace the paternal species in hybrids remains a major limitation of mitochondrial markers. Our RP2S6 marker, combined with the species-specific primer pairs previously developed for other different sturgeon species on the RP1S7 locus (Boscari et al., 2014a), also ensure the identification of several hybrids having the Beluga as parental species. In our study, this was demonstrated for the Bester on both caviar and meat. A Bester sample is expected to yield a positive amplification with both the Beluga and Sterlet specific bands, respectively 194 and 169 bp long. Theoretically, the same results can be obtained by the inverse hybrid (A. ruthenus female X H. huso male). However, while the Bester is commercially relevant, the inverse hybrid has never been
6
ACCEPTED MANUSCRIPT
245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280
produced to our knowledge, making the analysis of hybrid direction unnecessary. The positive amplification of both the
281
5. Conclusion
282 283 284
The interspecific variability at the second predicted intron of the RPS6 nuclear ribosomal gene was explored with the
Beluga and the Sterlet specific bands is sufficient to classify a sample as Bester. Recently, Dudu et al. (2015) identified three microsatellite loci (LS54, LS68 and Aox45) with distinct allelic ranges in the H. huso and A. ruthenus, and proposed them as tools to distinguish Bester from the two parental species. However, the allelic ranges of the above microsatellites overlap with those of several other sturgeon species, limiting their application to international trade
RI PT
control in which all sturgeon species should be unambiguously distinguished. The RP2S6 marker is also of particular importance to identify hybrid products in which the Beluga is used as paternal species, such as A. naccarii female x H. huso male, A. baerii female and H. huso male and A. gueldenstaedtii female x H. huso male. Indeed, in these cases, the Beluga is untraceable by mtDNA and the availability of this beluga-specific nuclear marker is currently the only way to successfully detect this species, as shown by the positive results obtained on the hybrids with the Adriatic sturgeon (A. naccarii) as maternal species and on the caviar produced by a hybrid female
SC
(A. baerii X H. huso).
One of the relevant aspects of this study is represented by the high heterogeneity of the Beluga specimens used for validation (Table 1). Accordingly, one of the main requirements in setting up a reliable marker for species identification
M AN U
is that the entire genetic variability of the target species must be covered, otherwise the marker cannot be considered as universal. For this reason, we have involved the major research institutions working on the Beluga across the entire geographical range of the species in the validation phase. Given the 100% correct identification rate on such a heterogeneous sample, and the proved efficiency on all caviar samples tested, the probability that our marker fails in detecting natural or aquaculture stocks of beluga is minimized.
For what concerns the detection efficiency of hybrids, this is given by the probability of transmission of the “beluga” chromosome. For this reason, first generation hybrids are always detectable while, in the in the following generations
TE D
(F2 or F3), the detection efficiency progressively decreases following the Mendelian inheritance model. The only way to unambiguously detect F2 and F3 hybrids is to increase the number of unlinked diagnostic nuclear markers, thus increasing the probability that at least one of them is successfully transmitted along the multigenerational genealogy. Like the already cited RP1S7 (Boscari et al., 2014a), the marker here presented was isolated within an intronic region of a ribosomal protein, the RPS6, suggesting the high potential of these regions for species identification purposes. Several
EP
other introns were predicted through the in silico analysis, raising the possibility that to future studies will find additional diagnostic markers for those species that are not detectable so far, such as Kaluga and Amur sturgeons (H. dauricus and A. schrenckii). These two species are highly hybridized in both directions in aquaculture and no diagnostic
AC C
marker is yet available. Their importance has recently increased in the international market as a consequence of the exponential increase of sturgeon production in China (Bronzi & Rosenthal, 2014). The identification of interspecific hybrids also has high conservation relevance in the management of captive broodstocks used for the production of fingerlings for release programs. Hybrids are often accidentally mixed into captive stocks of pure origin, (Congiu et al., 2011; Boscari & Congiu 2014; Boscari et al., 2014b) as the hatcheries that provide animals for restocking often produce sturgeon also for commercial purposes (Chebanov et al., 2011).
aim of finding a suitable marker for the identification of the Beluga species, the name of which is preferentially used to mislabel less valuable caviars in commercial fraud. The diagnostic nuclear marker characterized in this study, and
7
ACCEPTED MANUSCRIPT
suitable for the analyses of both tissue and caviar, allows the identification of pure Beluga and remarkably, of its first generation hybrids, which are massively produced and commercialized worldwide. The marker presented here enhances the panel of sturgeon species identification tools of fast and efficient applicability. This can be considered a further step towards effective control of the international trade of these critically endangered and highly valuable species. The isolation of this marker will benefit not only the enforcement of trade controls but also
RI PT
the management of residual genetic diversity in many sturgeon species, by enabling the detection of hybrids accidentally mixed into captive broodstocks used for ex situ conservation.
Acknowledgements
The authors thank the students Stefano Rossi, Marco Macatrozzo and Valentina Borgato for their assistance in the laboratory procedures. Thanks to the producers Agroittica Lombarda and Caviar Giaveri for providing caviar samples
SC
used for the sensitivity test. Many thanks also to our colleague Prof. QiWei Wei for providing part of the samples of Amur and Kaluga sturgeons used during the validation of the primer. The study was in part funded by the Po River Delta Park (Veneto Region), which co-financed a post-doctoral position at the University of Padova (E.B.) and by a
References
M AN U
PRID-SEED project of the Department of Biology-University of Padova.
Amemiya, C. T., Lander, E. S., & Myers, R. M. (2006). A white paper for sequencing the genome of a living fossil: the coelacanth, Latimeria chalumnae.
http://www.genome.gov/pages/research/sequencing/seqproposals/coelacanthgenomewhitepaper.pdf
TE D
Aranishi, F. (2006). Single fish egg DNA extraction for PCR amplification. Conservation Genetics, 7, 153-156. Barmintseva, A. E., & Mugue, N. S. (2013). The use of microsatellite loci for identification of sturgeon species (Acipenseridae) and hybrid forms. Russian Journal of Genetics, 49, 950-961.
Boscari, E., Barbisan, F., & Congiu, L. (2011). Inheritance pattern of microsatellite loci in the polyploidy Adriatic
EP
sturgeon (Acipenser naccarii). Aquaculture, 321, 223-229.
Boscari, E., Barminsteva, A., Pujolar, J. M., Doukakis, P., Mugue, N., & Congiu, L. (2014a). Species and hybrid identification of sturgeon caviar: a new molecular approach to detect illegal trade. Molecular Ecology Resources, 14,
AC C
285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323
489-498.
Boscari, E., & Congiu, L. (2014). The need for genetic support in restocking activities and ex situ conservation programmes: the case of the Adriatic sturgeon (Acipenser naccarii Bonaparte, 1836) in the Ticino River Park. Journal of Applied Ichthyiology, 30, 1416–1422.
Boscari, E., Pujolar, J. M., Dupanloup, I., Corradin, R., & Congiu, L. (2014b). Captive breeding programs on family groups in polyploidy sturgeons. PLos ONE, 9(10), e110951. doi: 10.1371/journal.pone.0110951.
8
ACCEPTED MANUSCRIPT
324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352
Boscari, E., Vidotto, M., Martin, D., Papetti, C., Ogden, R., & Congiu, L. (2015). Microsatellites from the genome and
353
parental species (♀ Huyso huso Linnaes, 1758 and ♂ Acipenser ruthenus Linnaeus, 1758) by nuclear markers. Animal
354 355 356 357 358 359 360 361 362
Science and Biotechnologies, 48, 81-85.
the transcriptome of the tetraploid Adriatic sturgeon, Acipenser naccarii (Bonaparte, 1836) and cross-species applicability to the diploid beluga sturgeon, Huso huso (Linnaeus, 1758). Journal of Applied Ichthyiology, 31, 977-983.
Brenner, S., Elgar, G., Sanford, R., Macrae, A., Venkatesh, B., & Aparicio, S. (1993). Characterization of the pufferfish
RI PT
(Fugu) genome as a compact model vertebrate genome. Nature, 366, 265-268.
Bronzi, P., & Rosenthal, H. (2014). Present and future sturgeon and caviar production and marketing: a global market overview. Journal of Applied Ichthyology, 30, 1536-1546.
Bronzi, P., Rosenthal, H., & Gessner, J. (2011). Global sturgeon production: an overview. Journal of Applied
SC
Ichthyology, 27, 169-175.
Chebanov, M., Rosenthal, H., Gessner, J., Van Anrooy, R., Doukakis, P., Pourkazemi, M., & Williot, P. (2011).
No. 570. Ankara, FAO. 2011. 110pp.
M AN U
Sturgeon hatchery practices and management for release–Guidelines. FAO Fisheries and Aquaculture Technical Paper.
Congiu, L., Dupanloup, I., Patarnello, T., Fontana, F., Rossi, R., Arlati, G., & Zane, L. (2001). Identification of interspecific hybrids by amplification fragment length polymorphism: the case of sturgeon. Molecular Ecology, 10, 2255-2359.
TE D
Congiu, L., Fontana, F., Patarnello, T., Rossi, R., & Zane, L. (2002). The use of AFLP in sturgeon identification. Journal of Applied Ichthyology, 18, 286-289.
Congiu, L., Pujolar, J.M., Forlani, A., Cenadelli, S., Dupanloup, I., Barbisan, F., Galli, A., & Fontana, F. (2011). Managing polyploidy in ex situ conservation genetics: the case of the critically endangered Adriatic sturgeon
EP
(Acipenser naccarii). PLoS ONE, 6(3), e18249. doi: 10.1371/journal.pone.0018249.
AC C
Dudu, A., Macarie, R. D., Burcea, A., Georgescu, S. E., & Costache, M. (2015). Identification of Bester hybrids and its
Fain, S. R., Straughan, D. J., Hamlin, B. C., Hoesch, R. M., & LeMay, J. P. (2013). Forensic genetic identification of sturgeon caviars traveling in world trade, Conservation Genetics, 14, 855-874.
Hale, M. C., McCormick, C. R., Jackson, J. R., & DeWoody, J. A. (2009). Next-generation pyrosequencing of gonad transcriptomes in the polyploidy lake sturgeon (Acipenser fulvescens): the relative merits of normalization and rarefaction in gene discovery. BMC Genomics, 10, 203.
9
ACCEPTED MANUSCRIPT
Howe, K., Clark, M. D., Torroja, C. F., Torrance, J., Berthelot, C., Muffato, M., Collins, J. E., & Humphray, S. et al. (2013). The zebrafish reference genome sequence and its relationship to the human genome. Nature, 496(7446), 498503.
Jahnichen, H., Kohlmann, K., & Renner, B. (1999). Juvenile growth of Acipenser ruthenus and 4 different sturgeon
RI PT
hybrids. Journal of Applied Ichthyology, 15, 248-249.
Johnson, T. A., & Iyengar, A. (2015). Phylogenetic evidence for a case of misleading rather than mislabeling in caviar in the United Kingdom. Journal of Forensic Science, 60 Suppl 1, S248-53.
Acipenseriformes revisited. Journal of Applied Ichthyology, 24, 36–45.
SC
Krieger, J., Hett, A. K., Fuerst, P. A., Artyukhin, E., & Ludwig, A. (2008). The molecular phylogeny of the order
M AN U
Ludwig, A. (2008). Identification of Acipenseriformes in trade. Journal of Applied Ichthyology, 24(Sulppl. 1), 2-19.
Ludwig, A., Lieckfeldt, D., & Jahrl, J. (2015). Mislabeled and counterfeit sturgeon caviar from Bulgaria and Romania. Journal of Applied Ichthyology 31, 587-591.
Mugue, N. S., Barmintseva, A. E., Rastorguev, S. M., Mugue, V. N., & Barminsev, V. A. (2008). Polymorphism of the mitochondrial DNA control region in eight sturgeon species and development of a system for DNA-based species
TE D
identification. Russian Journal of Genetics, 44, 793-798.
Ogden, R., Gharbi, K., Mugue, N., Martinsohn, J., Senn, H., Davey, J.W., Pourkazemi, M., Mcewing, R., Eland, C., Vidotto, M., Sergeev, A., & Congiu, L. (2013). Sturgeon conservation genomics: SNP discovery and validation using RAD sequencing. Molecular Ecology, 22, 3112-3123.
EP
Omoto, N., Maebayashi, M., Mitsuhashi, E., Yoshitomi, K., Adachi, S., & Yamauchi, K. (2001), Histological observations of gonadal sex differentiation in the F2 hybrid sturgeon, the bester. Fisheries Science, 67, 1104–1110.
Raymakers, C. (2006). CITES, the Convention on International Trade in Endangered Species of Wild Fauna and Flora:
AC C
363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402
its role in the conservation of Acipenseriformes. Journal of Applied Ichthyology, 22(Suppl. 1), 52-65.
Rozhkovan, K. V., Chelomina, G. N., & Rachelek, E. I. (2008). Molecular identification and the features of genetic diversity in interspecific hybrids of Amur sturgeon (Acipenser schrenckii x A. baerii, A. baerii x A. schrenckii, A. schrenckii x A. ruthenus, and A. ruthenus x A. schrensckii) based on variability of multilocus RAPD markers. Genetika, 44, 1453-1460.
Slater, G.S., & Birney, E. (2005). Automated generation of heuristics for biological sequence comparison. BMC Bioinformatics, 15, 6-31.
10
ACCEPTED MANUSCRIPT
Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6: Molecular Evolutionary Genetics AnalysisVersion 6.0. Molecular Ecology, 30, 2725-2729.
Van Uhm, D., & Siegel, D. (2016). The illegal trade in black caviar. Trends in Organzed Crime, 19, 67-87.
RI PT
Vidotto, M., Grapputo, A., Boscari, E., Barbisan, F., Coppe, A., Grandi, G., Kumar, A., & Congiu, L. (2013). Transcriptome sequencing and de novo annotation of the critically endangered Adriatic sturgeon. BMC Genomics, 14, 407.
Vidotto, M., Grapputo, A., Boscari, E., Zane, L., & Congiu, L. (2015). Transcriptomic resources for the critically endangered starlet sturgeon Acipenser stellatus. Molecular Ecology Resources, 15, 1256-1257. doi: 10.1111/1755-
SC
0998.12439. In Genomic Resources Development Consortium, Almieda-Val, V. M. F., Boscari, E., Coelho, M. M., et al. (2015) Genomic Resources Notes accepted 1 April 2015 - 31 May 2015. http://dx.doi.org/10.5061/dryad.kj4mh.
M AN U
Yarmohammadi, M., Shabani, A., Pourkazemi, M., & Baradaran Noveiri, S. (2012). Identification of bester hybrids (female Huso huso Linnaeus, 1758 and male starlet Acipenser ruthenus Linnaeus, 1758) using AFLP molecular
EP
TE D
technique. Iranian Journal of Fisheries Science, 11, 415-423.
AC C
403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419
11
ACCEPTED MANUSCRIPT
Table 1. Sampling information about all individuals and species used for the RP2S6 characterization and SNP validation. Results of the marker efficiency are reported as percentage on the total number of analyzed individuals of each species (in brackets in the last column). Caviar samples are indicated, all other samples were provided as fin clips N. samples
Sample origin
5 21 20 19 17 83 5 6
H. huso
A. baerii
14 7
10 9 6
A. naccarii
23
3 (3 + 0)
10
0% (14)
3
1 (0 + 1)
11
0% (14)
12
6 (3 + 3)
29
0% (41)
3
4 (4 + 0)
16
0% (19)
3
10 (8 + 2)
22
0% (25)
3
10 (7 + 3)
18
0% (21)
-
5
100% (5)
-
-
5
100% (5)
-
-
1
100% (1)
6
University of Padova VIP (Northern Italy fish farm) Agroittica Lombarda (producer) IZW Berlin Collection
-
-
-
6
100% (6)
1
Caviar Giaveri (producer)
-
-
1
100% (1)
10
IZW Berlin Collection
-
-
10
100% (10)
65
70
EP
11 1 1 1 5 22
TE D
8
3
21
AC C
5 5 1
H. huso x A. ruthenus (CAVIAR) Total
0% (27)
4
A. baerii x H. huso (CAVIAR)
20
0% (15)
A. sinensis
H. huso (CAVIAR)
4 (0 + 4)
12
9 14 33
A. naccarii x H. huso
0% (27)
3 (2 + 1)
5
H. huso x A. ruthenus
7
20
3
3
A. trasnmontanus
H. dauricus
9 (4 + 5)
100% (170)
0% (23)
3
A. schrenckii
7
153
20
3
A. stellatus
15 (12 + 3)
% positive amplifications RP2S6 (n)
5 (5 + 0)
3
A. ruthenus
17
VIP (Northern Italy fish farm) – U.G.O. Caspian Sea Black Sea Ural River (Russia) Azov Sea Danube River (Romania) IZW Berlin Collection Lena River (Russia) Lake Baikal (Siberia, Russia) Ob’ River (Siberia, Russia) VIP (Northern Italy fish farm) – U.G.O. Azov Sea Caspian Sea Volga River (Russia) VIP (Northern Italy fish farm) Embarras River (Wisconsin) Lake Winnebago (Wisconsin) Wolf River (Wisconsin) Upper Fox River (Wisconsin) Bad River (Wisconsin) VIP (Northern Italy fish farm) – U.G.O. North America Yangtze River (China) Danube River (Romania) VIP (Northern Italy fish farm) – U.G.O. Danube River (Romania) USSR Kazakhstan Iran IZW Berlin Collection Amur River (China) Yangtze River Fisheries Research Institute (China) Amur River (China)
N. samples validated by PCR
3
3 A. fulvescens
N. sequenced clones (group A + group B)
M AN U
2 A. gueldenstaedtii
N. sequenced samples
RI PT
Species
SC
420 421 422
406 (+ 18 caviars)
423
12
341 (+ 18 caviars)
ACCEPTED MANUSCRIPT
Figure Captions
Fig.1 Cluster analysis including all INT166 cloned sequences of the RPS6 obtained from 65 individuals of 11 species. The Neighbor Joining was based on the number of nucleotide differences among sequences applying the pairwise deletion option and the bootstrap test for phylogeny with 10000 replications. The two putative loci are named as group
RI PT
A and group B.
Fig. 2 Multi-species alignment of the second intron of the ribosomal protein S6 (RP2S6, group A and B) including one consensus sequence per species. Shaded regions correspond to primers used in this work (the name of each primer is reported below the corresponding region and the original sequence is reported in the text, paragraphs 2.2 and 2.3). The two SNPs detected for H. huso are framed; only the second one has been validated as a diagnostic marker. Additional
SC
putatively diagnostic positions for different species, though not validated in the present work, are underlined.
Fig. 3. Expected band pattern of two sturgeon hybrids (H. huso x A. ruthenus and A. naccarii x H. huso) and their pure
M AN U
parental species on agarose gel obtained by combining independent amplification products of the RP2S6 and RP1S7 tools. The sample order is: (1) A. ruthenus, (2) Bester (H. huso x A. ruthenus), (3) H. huso, (4) A. naccarii x H. huso,
EP
TE D
(5) A. naccarii. The specific-band sizes are reported for pure species. Positive controls are not shown.
AC C
424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442
13
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT