FAT1 cadherin controls neuritogenesis during NTera2 cell differentiation

Biochemical and Biophysical Research Communications 514 (2019) 625e631

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc

FAT1 cadherin controls neuritogenesis during NTera2 cell differentiation Abdulrzag F. Ahmed a, b, Charles E. de Bock c, Estelle Sontag b, d, Hubert Hondermarck b, d, Lisa F. Lincz b, d, e, Rick F. Thorne f, g, * a

Department of Pharmacology, Faculty of Pharmacy, Elmergib University, Alkhoms, Libya School of Biomedical Sciences and Pharmacy, University of Newcastle, Callaghan, NSW, 2308, Australia Children's Cancer Institute, Lowy Cancer Research Centre, UNSW Australia, Randwick, NSW 2031, Australia d Hunter Medical Research Institute, New Lambton, New South Wales, 2305, Australia e Hunter Haematology Research Group, Calvary Mater Newcastle Hospital, Waratah, NSW, 2298, Australia f Translational Research Institute, Henan Provincial People's Hospital, Zhengzhou University, 450053, Zhengzhou, China g School of Environmental and Life Sciences, University of Newcastle, NSW, 2258, Australia b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 18 April 2019 Accepted 29 April 2019 Available online 7 May 2019

Fat1 cadherin is broadly expressed throughout the nervous system and has been implicated in neuronal differentiation. Here we examined the functional contribution of FAT1 during neuronal differentiation of the Ntera2 cell line model. FAT1 expression was increased during the retinoic acid (RA)-induced differentiation of NTera2 cells. Depletion of FAT1 with siRNA decreased the number of neurites produced after RA treatment. Moreover, FAT1 silencing also led to decreased Ser127-phosphorylation of YAP along with transcriptional increases in the Hippo target genes CTGF and ANKRD1, suggesting FAT1 alters Hippo signalling during differentiation. In the context of the Ntera2 model, FAT1 is required for efficient neuritogenesis, acting as a regulator of neurite formation during the early stages of differentiation. © 2019 Elsevier Inc. All rights reserved.

Keywords: FAT1 cadherin Hippo pathway Neurite outgrowth Neuronal differentiation YAP NTera2

1. Introduction Neuronal differentiation is a multistep process, involving the initial proliferation of precursor cells and ending in migration of the neurons to their target regions, neurite outgrowth, and maturation [1,2]. Nervous system development occurs through neural stem cells (NSCs), which can either differentiate to glial cells or to other types of neuronal cells. Distinct forms of cell division ensure an equilibrium between the pool of NSCs and differentiated cells and this balance is key to tissue homeostasis. Signalling pathways refereeing these events are critical for controlling the size, composition and functioning of the nervous system [3]. The neuroscience field is hampered by the lack of relevant models resembling functionally mature neurons [4] and systems that faithfully reproduce neuronal differentiation [4]. The NTera2 clone D1 is a human teratocarcinoma cell line clone that can be

* Corresponding author. Translational Research Institute, Henan Provincial People's Hospital, Zhengzhou University, 450053, Zhengzhou, China. E-mail address: [email protected] (R.F. Thorne). https://doi.org/10.1016/j.bbrc.2019.04.197 0006-291X/© 2019 Elsevier Inc. All rights reserved.

differentiated in vitro by retinoic acid into fully functional, postmitotic neuronal-like cells [5]. The differentiated cells display a variety of neurotransmitter phenotypes neurons and exhibit preand post-synaptic activity [6,7]. This model has been widely used [8e10]. Hippo signalling is an evolutionarily conserved kinase cascade that controls cellular proliferation, differentiation and survival [11]. This is considered to be achieved by integrating stimuli for tissue context-dependent development including cellular density, tissue tension and stiffness as well as metabolic cues [12e14]. High levels of Hippo (MST1/2) signalling lead to phosphorylation of the downstream factors YAP or TAZ, promoting their cytoplasmic retention [15,16]. At low cell densities, the core kinase cascade is less active, allowing YAP/TAZ to enter the nucleus and function as transcriptional co-activators [17]. In our prior study, we demonstrated that FAT1 functions during the SH-SY5Y model of neuronal differentiation to engage Hippo signalling by antagonising TAZ [18]. Suppressing FAT1 expression maintained cells in a proliferative state and inhibited neurite formation. Here we now supplement these finding by establishing that FAT1 fulfils a similar role during the differentiation of NTera2 clone D1 cells.

626

A.F. Ahmed et al. / Biochemical and Biophysical Research Communications 514 (2019) 625e631

2. Materials and methods

(RPS18, GusB and HMBS).

2.1. Cell culture

2.6. Western blotting

NTera2 clone D1 cells (ATCC) were cultured in DMEM containing 4.5 g/L glucose and L-glutamine (Lonza) supplemented with 10% foetal bovine serum (Sigma) and 25 mM HEPES (Lonza).

Lysates were prepared using NDE lysis buffer [21] and analysed as previously described [18]. GAPDH, Hippo pathway antibodies were from Cell Signalling Technologies (GAPDH; #2118; Hippo Signalling Kit#8579) and Nestin antibodies (GTX39578) from GenTex.

2.2. Differentiation Low density monolayers were treated with 10 mM RA every three days where the cells progressively establish neurites that lengthen over time (adhesion-differentiation protocol). Alternatively, a neurosphere-differentiation protocol [19,20] was used. Cells were cultured with 10 mM RA over a non-adherent surface with the media exchanged every 2e3 days. Cells progressively transform into floating spherical aggregates (neurospheres) and transferring these to an adherent surface results in re-adhesion with the peripheral cells producing a neuronal network. 2.3. Immunofluorescence staining

2.4. Microarray analysis The RMA algorithm was used to transform logarithmic signal intensities (SI) to linear values as previously described [34] from datasets sourced from GEO (http://www.ncbi.nlm.nlm.nih.gov/geo/ ). For GSE44175, six biological replicates were averaged to compare relative mRNA expression [22]. Similar analyses were conducted induced pluripotent stem cells (iPSCs) (GSE25542; [23]) and human embryonic stem cells (hESCs) (GSE40593; [24]). 2.5. Quantitative real time PCR Total RNA was extracted (Illustra RNAspin; GE Healthcare) and cDNA prepared (Transcriptor First Strand cDNA Synthesis; Roche) and reactions performed using SYBR chemistry (iQ™ SYBR® Green Supermix; BioRad) using an Applied Biosystems 7500. Assays were performed in triplicate and analysed using the DDCt method with SDS software (v1.4.0). Target sequences are listed in Table 1 with results normalised against the average of housekeeping genes

Table 1 Primer sequences used in qPCR-based gene expression analyses. Gene

Designation

50 -30 sequence

CTGF

CTGF For CTGF Rev CTGF For CTGF Rev Fat1 For Fat1 Rev Fat2 For Fat2 Rev Fat3 For Fat3 Rev Fat4 For Fat4 Rev RBS18 For RBS18 Rev GusB For GusB Rev HMBS For HMBS Rev

AGGAGTGGGTGTGTGACGA CCAGGCAGTTGGCTCTAATC AGTAGAGGAACTGGTCACTGG TGGGCTAGAAGTGTCTTCAGAT GTGTGATTCGGGTTTTAGGG CTGTACTCGTGGCTGCAGTT GGCCTTCAGTATCGACCTGG AATGTGTAGCCGGACACTGG CAGCCCAACGGACAGATTCA AGGAATGCCACTGTCTACGG AGCGAGAATGGCGTTTTAATCC CCACTTTCCCAGCAATTCCT TAGCCTTTGCCATCACTGCC CATGAGCATATCTTCGGCCC GCCAATGAAACCAGGTATCCC GCTCAAGTAAACAGGCTGTTTTCC GAGAGTGATTCGCGTGGGTA CAGGGTACGAGGCTTTCAAT

FAT1 FAT2 FAT3 FAT4 RPS18 GusB HMBSS

Phase contrast micrographs (AxioCamHR camera; Zeiss) were analysed using Axiovision v4.7 software according to criteria where a neurite is defined as a cellular projection as long or wide as the cell soma [25,26]. Fifteen fields were chosen from three experiments. Differences in the frequency of neurites between conditions were analysed using Fisher's exact test. Neurite length was nonnormally distributed and the ManneWhitney U non-parametric test used. 2.8. siRNA

Was conducted as described against FAT1 [21], synaptophysin (GTX100865) and Tau (GTX100866) (GenTex).

ANKRD1

2.7. Neurite outgrowth

Cells were seeded into six well plates at 500,000 cells/well before transfection. The media was replaced with Opti-MEM® before addition of 50 nM siRNA duplexes prepared using RNAiMAX (#13778; Invitrogen). Cells were trypsinized the next day and recultured at 100,000 cells/well. Thereafter, cells were subjected to 10 mM RA treatment, replacing the media every three days. siRNA transfections were repeated on Day 6. 3. Results 3.1. Fat1 expression is selectively increased during NTera2 differentiation NTera2 clone D1 cells (hereafter NTera2) were subjected to the adhesion-differentiation protocol. QPCR measurements showed FAT1 mRNA increased after RA treatment whereas the levels of others FAT family cadherins remained low (Fig. 1A). Blotting confirmed that FAT1 protein levels increased throughout culture (Fig. 1B) and this corresponded with loss of Nestin, a neuronal precursor marker, and increased synaptophysin, a marker of differentiation [5]. Furthermore, in situ staining confirmed that FAT1 levels were progressively increased during differentiation. At day 16, FAT1 was observed in a punctate membranous pattern with some staining concentrated in cell peripheries where neurites are being initiated, whereas after 32 days FAT1 reactivity decorated longer axonal processes (Fig. 1C). Alternative assessment using neurosphere differentiation (refer Methods) showed low detectable FAT1 protein levels present in non-adherent cells (Day 0) and neurospheres formed after 7 and 14 days whereas FAT1 increased once the neurospheres were replated (Fig. 1D and E, top). Similarly, FAT1 was also observed in neurites along with staining for neuronal differentiation markers Tau, an axon protein, and synaptophysin (Fig. 1E, bottom). These results suggest that FAT1 is induced during neuronal differentiation in NTera2 cells. 3.2. FAT1 knockdown decreases neurite initiation during NTera2 differentiation We employed validated siRNA duplexes [27] (Table 2) to examine the role of FAT1 during differentiation. Transfected NTera2 cells were collected at 0, 6 and 12 days and the expression of FAT1

A.F. Ahmed et al. / Biochemical and Biophysical Research Communications 514 (2019) 625e631

627

Fig. 1. FAT1 expression is selectively induced in NTera2 cells following neuronal differentiation. A. FAT cadherin expressing by qPCR following differentiation of NTera2 cells (Day 6 of RA-treatment). B. Western blot of differentiated NTera2 cells following the adhesion-differentiation protocol. C. NTera2 cells differentiated for 16 and 32 days using the adhesion-differentiation protocol were stained with anti-FAT1 antibodies (red) and DAPI (blue). D. Western blot of differentiated NTera2 cells using the neurosphere-differentiation protocol. E. NTera2 cells subjected to the neurosphere-differentiation. Representative images of cells seeded onto non-adherent culture surface on Day 0, neurospheres formed after Day 14, and the neuronal network produced on Day 21 after transferring neurospheres to an adherent substrate (top). Day 21 cells stained with anti-FAT1 antibodies together with neuronal differentiation markers Tau and synaptophysin (bottom). DAPI (blue). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Table 2 Oligonucleotide sequences of siRNA duplexes. 50 -30 sequence

Designation FAT1#1 FAT1#2 FAT1#3 Negative control

SENSE ANTISENSE SENSE ANTISENSE SENSE ANTISENSE SENSE ANTISENSE

CCAGUUCUCUUCUGUUAAAUU UUUAACAGAAGAGAACUGGUU AUAGUUGCUUCAUGAUUGAUU UCAAUCAUGAAGCAACUAUUU GACGACGGCCACUUCGAAGAGUU CUCUUCGAAGUGGCCGUCGUCUU UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT

determined using Western blotting. FAT1 induction after exposure to RA was almost completely diminished in cells treated with FAT1targeting siRNAs but not with controls (Fig. 2A). RA treatment induced neurite outgrowth in control cells but notably, suppressing FAT1 reduced neurite outgrowth (Fig. 2B). Quantitative analyses of neurites [28] comparing both length and number of cell projections showed that FAT1 suppression decreased the number of cells with neurites from 98% in NC controls to 49% in FAT1 siRNA-treated cells (p < 0.0001, Fig. 2C). Although neurite numbers decreased (Fig. 2D), their median length was unchanged (Fig. 2E).

3.3. Effects of FAT1 on Hippo pathway activation during NTera2 differentiation Previous work in SH-SY5Y cells showed FAT1 engages the Hippo

pathway through influencing the activities of the transcriptional cofactor TAZ [18]. Examining the expression of the Hippo effectors showed YAP and TAZ protein levels increased after RA treatment with YAP being barely detectable in untreated cells but readily detected after differentiation (Fig. 3A). Moreover, the levels of phosphorylated YAP (pSer 127) increased in control cells during differentiation but in contrast, FAT1-siRNA attenuated the increase in p-YAP levels (Fig. 3B). To determine if Hippo activation was affected, the levels of Hippo target genes were measured, the analysis showing that suppressing FAT1 during differentiation was associated with increased levels of CTGF and ANKRD1 (Fig. 3C). Together this suggests that FAT1 acts to suppress Hippo activation during the differentiation of NTera2 cells. 3.4. In-silico analyses invoke a role for YAP at the neuroprogenitor stage In the context of neuronal differentiation of SH-SY5Y cells, FAT1 functions by antagonising the actions of TAZ [18], a phenomena that appears to be invoked during NTera2 differentiation. The changes in Hippo signalling in NTera2 cells appear consistent although YAP itself is not strongly expressed by SHSY-5Y cells [18]. We sought to establish evidence that might corroborate a role for YAP in neuronal differentiation by in silico analyses of different neuronal differentiation models. Examination of mouse NSCs showed that YAP was highly expressed (98th percentile rank; Fig. 4A) (Deng et al. ([29];

628

A.F. Ahmed et al. / Biochemical and Biophysical Research Communications 514 (2019) 625e631

Fig. 2. Suppression of FAT1 during retinoic acid-induced differentiation of NTera2 cells inhibits neurite outgrowth. A. Western blot of NTera2 cells transfected with negative control or FAT1 siRNA duplexes before the adhesion-differentiation protocol out to 12 days. B. Photomicrographs of siRNA-transfected NTera2 cells after 10 days of RA treatment. C. Analyses of neurites presented as a frequency distribution categorised for length (800 cells analysed per group). D. Percentage of cells from C displaying one or more neurites (****p  0.0001, 2-sided Fisher's exact test). E. Box-Whisker plot of median neurite length from data in C. Box limits indicate the 25th and 75th percentiles with the median values. Whiskers extend 1.5x the interquartile range.

GSE44175). During early differentiation to NPCs, the levels of YAP were increased and thereafter were diminished after neuron formation (Fig. 4A). We then looked at data from iPSCs using specific protocols promoting their differentiation towards neurons ([23]; GSE25542). Here the relative expression of YAP was moderately high and increased from iPSCs to neurospheres while decreasing in

the neuron-derived samples (Fig. 4B). Examination of data involving a third differentiation protocol using hESCs ([24]; GSE40593) provided global gene expression data on ESCs, neural rosettes, neurons, astrocytes and oligodendrocytes (Fig. 4C). One additional feature of note was that the samples for neurons involved an additional sorting procedure that produced highly

A.F. Ahmed et al. / Biochemical and Biophysical Research Communications 514 (2019) 625e631

629

Fig. 3. Silencing of FAT1 during NTera2-D1 cell differentiation affects Hippo effectors. A. Western blot using a dual specificity polyclonal antibody against YAP and TAZ comparing untreated or RA-treated NTera2 cells. B. Western blotting for p-YAP (Ser127) was conducted on NTera2 cells. C. mRNA levels of CTGF and ANKRD1 measured in NTera2 cells after 6 days of RA treatment (**p < 0.01; ****p < 0. 0001; Students t-test).

purified neurons. This showed that the levels of YAP mRNA were relatively high with expression values in the ~90th percentile of all genes expressed and during differentiation towards neurons the levels in neural rosettes increased [30] before a significant reduction at the neuron stage. 4. Discussion We utilised NTera2 cells to derive neuron-like cells and observed that the expression of FAT1, amongst all FAT family cadherins, was markedly upregulated. These findings appeared similar to the changes observed in SY-SY5Y cells [18] and moreover, match the expression of Fat1 reported in the developing mouse embryo. Here Fat1 expression was detected in neural precursors in the ventricular zone along the dorsoventral axis. High Fat1 expression was also recorded in the spinal cord along with a prominent column of ventral neurons at the thoracic level [31]. Thus the increase in FAT1 expression accompanying the loss of neural progenitor markers and expression of neuronal markers appear fully consistent with a role for FAT1 during neuronal differentiation. Depletion of FAT1 also resulted in a significant reduction in the frequency of neurites expressed by differentiated NTera2 cells. Thus there is concordance between the regulation and function of FAT1 between SH-SY5Y [18] and NTera2 cells. However there were also differences as although FAT1 knockdown resulted in the decreased frequency of neurites in both cells, the reduced length of neurites reported in SH-SY5Y cells did not occur in NTera2 cells. It was inferred that FAT1 was involved in both the initiation and extension of neurites [18], and the role of Fat1 in engaging the cytoskeleton [32,33] may provide a mechanistic explanation. Certainty the data obtained with NTera2 cells reinforces the notion that FAT1 is required for efficient neurite formation. Indeed, FAT1 protein was found to be localised at the cell periphery during the early stage of differentiation in regions reminiscent of neurite growth cones. Later after neurites had formed and lengthened into axon-like structures, strong FAT1 expression could be observed in a near identical manner to the axonal proteins Tau and synaptophysin.

This also appears consistent with previous findings in Helmbacher et al. [31] which reported the action of Fat1 in motor neurons was to modulate axonal growth and neuronal specification. The distribution of FAT1 on these axons certainly fits the idea that it may be involved in neurite-axonal maturation. However, why FAT1 depletion did not reduce neurite length in NTera2 neurons is not clear. Notwithstanding this, FAT1-dependent effects on Hippo signalling were observed. Suppressing FAT1 during differentiation upregulated Hippo gene targets in NTera2 cells consistent with SHSY5Y differentiation [18] but unlike SH-SY5Y cells, FAT1 also affected the levels of YAP. The two models utilise different agents for differentiation with NTera2 generally induced by RA and not TPA as used for the SH-SY5Y cells [34,35]. Interestingly, a possible link between RA signalling and YAP has been has been suggested during the differentiation of developing hepatic tissue [36]. Additionally a recent report on neuronal development [37] suggested crosstalk between YAP and RA signalling in the enhancement of neural crest cells fate and migration. Thus on this basis we might anticipate a connection between FAT1 as upstream regulator of not only TAZ but also YAP as we observed. Compared to SH-SY5Y cells, YAP was prominently expressed in NTera2 cells and its phosphorylation increased during differentiation. Since p-YAP is a proxy measure of inactivation (and therefore Hippo activation [38]) this suggests that FAT1 can influence YAP activity. Most recently it was established that FAT1 acts as a platform to assemble the Hippo signalling complex that consequently inactivates YAP1 [39]. Thus the decreased expression of p-YAP and the increase on Hippo target gene expression after FAT1 knockdown are fully consistent with this modality. Nevertheless a caveat is that both SH-SY5Y and NTera2 systems are transformed cells, raising the question as how close these models are to the normal stem cells they are purported to represent? Differentiated NTera2 cells do display the dramatic polarized morphology of neurons with distinct axons and dendrites and express neuronal markers [40]. Other comparisons made on the basis of global gene expression show that undifferentiated NTera2 cells

630

A.F. Ahmed et al. / Biochemical and Biophysical Research Communications 514 (2019) 625e631

highly concordant expression changes. Since FAT1 and YAP expression appear to peak at the intermediate stages of neuronal differentiation, this aligns their role with initiating events rather than with maturation. In support, the high YAP levels at the neuroprogenitor stage are markedly diminished in neurons. Thus we classify YAP as a regulator of neural stemness, a finding supported by others showing its expression to be negatively correlated with neuronal differentiation in neural cell systems [37]. This study now builds upon previous work involving FAT1 and TAZ during SH-SY5Y differentiation [18], and it will be of interest to define how YAP and TAZ act jointly in the regulation of neuronal differentiation. Disclosure The authors declare no conflicts of interest. Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.04.197 References

Fig. 4. Expression of YAP during neuronal differentiation. A. Mouse NSC differentiation to neurons. Relative mRNA expression in three different stages (GSE44175). B. iPSC neuronal differentiation (GSE25542). C. Neuronal differentiation of ESCs (GSE40593). (ns, not significant; a, p < 0.05; b, p < 0.01; c, p < 0.001; d, p < 0.0001; students t-test).

are highly similar to human ESCs [41]. Indeed, the matching global gene expression between NTera2 and hESCs was higher than that between the undifferentiated NTera2 cells and their differentiated neurons or between hESCs and their derived embryoid bodies [41]. However, regardless of how similar these models are, proof that FAT1 constitutes a novel regulator of neurogenesis requires confirmation in more physiological systems. Prior analysis of the datasets in Fig. 4 showed that FAT1 was induced during neuronal differentiation, peaking during mouse brain development at the NPC stage, in neurospheres during the differentiation of iPSCs and in neural rosettes derived from hESCs [18]. Comparing FAT1 with YAP in these models demonstrated

[1] A.G. Jacobson, R. Gordon, Changes in the shape of the developing vertebrate nervous system analyzed experimentally, mathematically and by computer simulation, J. Exp. Zool. 197 (1976) 191e246. [2] N.C. Spitzer, Electrical activity in early neuronal development, Nature 444 (2006) 707e712. [3] N. Dahmane, P. Sanchez, Y. Gitton, V. Palma, T. Sun, M. Beyna, H. Weiner, A. Ruiz i Altaba, The Sonic Hedgehog-Gli pathway regulates dorsal brain growth and tumorigenesis, Development 128 (2001) 5201e5212. [4] L. Agholme, T. Lindstrom, K. Kagedal, J. Marcusson, M. Hallbeck, An in vitro model for neuroscience: differentiation of SH-SY5Y cells into cells with morphological and biochemical characteristics of mature neurons, J. Alzheimer's Dis. : JAD 20 (2010) 1069e1082. [5] G. Podrygajlo, M.A. Tegenge, A. Gierse, F. Paquet-Durand, S. Tan, G. Bicker, M. Stern, Cellular phenotypes of human model neurons (NT2) after differentiation in aggregate culture, Cell Tissue Res. 336 (2009) 439e452. [6] G. Podrygajlo, Y. Song, F. Schlesinger, K. Krampfl, G. Bicker, Synaptic currents and transmitter responses in human NT2 neurons differentiated in aggregate culture, Neurosci. Lett. 468 (2010) 207e210. [7] M.A. Tegenge, M. Stern, G. Bicker, Nitric oxide and cyclic nucleotide signal transduction modulates synaptic vesicle turnover in human model neurons, J. Neurochem. 111 (2009) 1434e1446. [8] F. Paquet-Durand, G. Bicker, Human model neurons in studies of brain cell damage and neural repair, Curr. Mol. Med. 7 (2007) 541e554. [9] I. Guillemain, G. Alonso, G. Patey, A. Privat, I. Chaudieu, Human NT2 neurons express a large variety of neurotransmission phenotypes in vitro, J. Comp. Neurol. 422 (2000) 380e395. [10] P.T. Nelson, D. Kondziolka, L. Wechsler, S. Goldstein, J. Gebel, S. DeCesare, E.M. Elder, P.J. Zhang, A. Jacobs, M. McGrogan, V.M. Lee, J.Q. Trojanowski, Clonal human (hNT) neuron grafts for stroke therapy: neuropathology in a patient 27 months after implantation, Am. J. Pathol. 160 (2002) 1201e1206. [11] J.S. Mo, H.W. Park, K.L. Guan, The Hippo signaling pathway in stem cell biology and cancer, EMBO Rep. 15 (2014) 642e656. [12] B. Zhao, L. Li, Q. Lei, K.L. Guan, The Hippo-YAP pathway in organ size control and tumorigenesis: an updated version, Genes Dev. 24 (2010) 862e874. [13] M. Aragona, T. Panciera, A. Manfrin, S. Giulitti, F. Michielin, N. Elvassore, S. Dupont, S. Piccolo, A mechanical checkpoint controls multicellular growth through YAP/TAZ regulation by actin-processing factors, Cell 154 (2013) 1047e1059. [14] S. Dupont, L. Morsut, M. Aragona, E. Enzo, S. Giulitti, M. Cordenonsi, F. Zanconato, J. Le Digabel, M. Forcato, S. Bicciato, N. Elvassore, S. Piccolo, Role of YAP/TAZ in mechanotransduction, Nature 474 (2011) 179e183. [15] H. Zhou, S. Wu, J.Y. Joo, S. Zhu, D.W. Han, T. Lin, S. Trauger, G. Bien, S. Yao, Y. Zhu, G. Siuzdak, H.R. Scholer, L. Duan, S. Ding, Generation of induced pluripotent stem cells using recombinant proteins, Cell Stem Cell 4 (2009) 381e384. [16] D. Kim, C.H. Kim, J.I. Moon, Y.G. Chung, M.Y. Chang, B.S. Han, S. Ko, E. Yang, K.Y. Cha, R. Lanza, K.S. Kim, Generation of human induced pluripotent stem cells by direct delivery of reprogramming proteins, Cell Stem Cell 4 (2009) 472e476. [17] B. Zhao, X. Wei, W. Li, R.S. Udan, Q. Yang, J. Kim, J. Xie, T. Ikenoue, J. Yu, L. Li, P. Zheng, K. Ye, A. Chinnaiyan, G. Halder, Z.C. Lai, K.L. Guan, Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control, Genes Dev. 21 (2007) 2747e2761. [18] A.F. Ahmed, C.E. de Bock, L.F. Lincz, J. Pundavela, I. Zouikr, E. Sontag, H. Hondermarck, R.F. Thorne, FAT1 cadherin acts upstream of Hippo signalling

A.F. Ahmed et al. / Biochemical and Biophysical Research Communications 514 (2019) 625e631

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

through TAZ to regulate neuronal differentiation, Cell. Mol. Life Sci. 72 (2015) 4653e4669. S.J. Pleasure, C. Page, V.M. Lee, Pure, postmitotic, polarized human neurons derived from NTera 2 cells provide a system for expressing exogenous proteins in terminally differentiated neurons, J. Neurosci. : Off. J. Soc. Neurosci. 12 (1992) 1802e1815. F. Paquet-Durand, S. Tan, G. Bicker, Turning teratocarcinoma cells into neurons: rapid differentiation of NT-2 cells in floating spheres, Brain research, Dev. Brain Res. 142 (2003) 161e167. E. Sadeqzadeh, C.E. de Bock, X.D. Zhang, K.L. Shipman, N.M. Scott, C. Song, T. Yeadon, C.S. Oliveira, B. Jin, P. Hersey, A.W. Boyd, G.F. Burns, R.F. Thorne, Dual processing of FAT1 cadherin protein by human melanoma cells generates distinct protein products, J. Biol. Chem. 286 (2011) 28181e28191. T. Deng, Z.I. Zhu, S. Zhang, F. Leng, S. Cherukuri, L. Hansen, L. Marino-Ramirez, E. Meshorer, D. Landsman, M. Bustin, HMGN1 modulates nucleosome occupancy and DNase I hypersensitivity at the CpG island promoters of embryonic stem cells, Mol. Cell Biol. 33 (2013) 3377e3389. S.P. Pasca, T. Portmann, I. Voineagu, M. Yazawa, A. Shcheglovitov, A.M. Pasca, B. Cord, T.D. Palmer, S. Chikahisa, S. Nishino, J.A. Bernstein, J. Hallmayer, D.H. Geschwind, R.E. Dolmetsch, Using iPSC-derived neurons to uncover cellular phenotypes associated with Timothy syndrome, Nat. Med. 17 (2011) 1657e1662. F.G. Lafaille, I.M. Pessach, S.Y. Zhang, M.J. Ciancanelli, M. Herman, A. Abhyankar, S.W. Ying, S. Keros, P.A. Goldstein, G. Mostoslavsky, J. OrdovasMontanes, E. Jouanguy, S. Plancoulaine, E. Tu, Y. Elkabetz, S. Al-Muhsen, M. Tardieu, T.M. Schlaeger, G.Q. Daley, L. Abel, J.L. Casanova, L. Studer, L.D. Notarangelo, Impaired intrinsic immunity to HSV-1 in human iPSCderived TLR3-deficient CNS cells, Nature 491 (2012) 769e773. J.M. Sontag, V. Nunbhakdi-Craig, M. Mitterhuber, E. Ogris, E. Sontag, Regulation of protein phosphatase 2A methylation by LCMT1 and PME-1 plays a critical role in differentiation of neuroblastoma cells, J. Neurochem. 115 (2010) 1455e1465. L. Dehmelt, F.M. Smart, R.S. Ozer, S. Halpain, The role of microtubuleassociated protein 2c in the reorganization of microtubules and lamellipodia during neurite initiation, J. Neurosci. : Off. J. Soc. Neurosci. 23 (2003) 9479e9490. E. Sadeqzadeh, C.E. de Bock, X.D. Zhang, K.L. Shipman, N.M. Scott, C. Song, T. Yeadon, C.S. Oliveira, B. Jin, P. Hersey, A.W. Boyd, G.F. Burns, R.F. Thorne, Dual processing of FAT1 cadherin protein by human melanoma cells generates distinct protein products, J. Biol. Chem. 286 (2011) 28181e28191. G. Baldassarre, A. Boccia, P. Bruni, C. Sandomenico, M.V. Barone, S. Pepe, T. Angrisano, B. Belletti, M.L. Motti, A. Fusco, G. Viglietto, Retinoic acid induces neuronal differentiation of embryonal carcinoma cells by reducing proteasome-dependent proteolysis of the cyclin-dependent inhibitor p27, Cell

631

Growth Differ. : Mol. Biol. J. Am. Assoc. Canc. Res. 11 (2000) 517e526. [29] D. Hartl, M. Irmler, I. Romer, M.T. Mader, L. Mao, C. Zabel, M.H. de Angelis, J. Beckers, J. Klose, Transcriptome and proteome analysis of early embryonic mouse brain development, Proteomics 8 (2008) 1257e1265. [30] A.S. Yap, W.M. Brieher, B.M. Gumbiner, Molecular and functional analysis of cadherin-based adherens junctions, Annu. Rev. Cell Dev. Biol. 13 (1997) 119e146. [31] F. Helmbacher, Tissue-specific activities of the Fat1 cadherin cooperate to control neuromuscular morphogenesis, PLoS Biol. 16 (2018), e2004734. [32] D. Schreiner, K. Muller, H.W. Hofer, The intracellular domain of the human protocadherin hFat1 interacts with Homer signalling scaffolding proteins, FEBS Lett. 580 (2006) 5295e5300. [33] M.J. Moeller, A. Soofi, G.S. Braun, X. Li, C. Watzl, W. Kriz, L.B. Holzman, Protocadherin FAT1 binds Ena/VASP proteins and is necessary for actin dynamics and cell polarization, EMBO J. 23 (2004) 3769e3779. [34] P.W. Andrews, I. Damjanov, D. Simon, G.S. Banting, C. Carlin, N.C. Dracopoli, J. Fogh, Pluripotent embryonal carcinoma clones derived from the human teratocarcinoma cell line Tera-2. Differentiation in vivo and in vitro, Lab. Invest. J. Tech. Methods Pathol. 50 (1984) 147e162. [35] F. Mavilio, A. Simeone, E. Boncinelli, P.W. Andrews, Activation of four homeobox gene clusters in human embryonal carcinoma cells induced to differentiate by retinoic acid, Differentiation Res. Biol. Div. 37 (1988) 73e79. [36] S. Septer, G. Edwards, S. Gunewardena, A. Wolfe, H. Li, J. Daniel, U. Apte, Yesassociated protein is involved in proliferation and differentiation during postnatal liver development, Am. J. Physiol. Gastrointest. Liver Physiol. 302 (2012) G493eG503. [37] C.J. Hindley, A.L. Condurat, V. Menon, R. Thomas, L.M. Azmitia, J.A. Davis, J. Pruszak, The Hippo pathway member YAP enhances human neural crest cell fate and migration, Sci. Rep. 6 (2016) 23208. [38] H. Liu, D. Jiang, F. Chi, B. Zhao, The Hippo pathway regulates stem cell proliferation, self-renewal, and differentiation, Protein Cell 3 (2012) 291e304. [39] D. Martin, M.S. Degese, L. Vitale-Cross, R. Iglesias-Bartolome, J.L.C. Valera, Z. Wang, X. Feng, H. Yeerna, V. Vadmal, T. Moroishi, R.F. Thorne, M. Zaida, B. Siegele, S.C. Cheong, A.A. Molinolo, Y. Samuels, P. Tamayo, K.L. Guan, S.M. Lippman, J.G. Lyons, J.S. Gutkind, Assembly and activation of the Hippo signalome by FAT1 tumor suppressor, Nat. Commun. 9 (2018) 2372. [40] S.R. Kleppner, K.A. Robinson, J.Q. Trojanowski, V.M. Lee, Transplanted human neurons derived from a teratocarcinoma cell line (NTera-2) mature, integrate, and survive for over 1 year in the nude mouse brain, J. Comp. Neurol. 357 (1995) 618e632. [41] C.M. Schwartz, C.E. Spivak, S.C. Baker, T.K. McDaniel, J.F. Loring, C. Nguyen, F.J. Chrest, R. Wersto, E. Arenas, X. Zeng, W.J. Freed, M.S. Rao, NTera2: a model system to study dopaminergic differentiation of human embryonic stem cells, Stem Cell. Dev. 14 (2005) 517e534.