- Email: [email protected]
Fatal bronchial invasion of Scopulariopsis brevicaulis in an acute monocytic leukemia patient
Diagnostic Microbiology and Infectious Disease 73 (2012) 369–371
Contents lists available at SciVerse ScienceDirect
Diagnostic Microbiology and Infectious Disease j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / d i a g m i c r o b i o
Case Reports
Fatal bronchial invasion of Scopulariopsis brevicaulis in an acute monocytic leukemia patient Qing Yang a, Juying Wei b, Zhenjing Chen c,⁎ a b c
State Key Laboratory for Diagnosis and Treatment of Infectious Disease, First Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, Zhejiang 310003, PR China Department of Hematology, First Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, Zhejiang 310003, PR China Clinical Laboratory Center, First Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, Zhejiang 310003, PR China
a r t i c l e
i n f o
Article history: Received 14 February 2012 Received in revised form 21 April 2012 Accepted 25 April 2012 Available online 25 May 2012 Keywords: Scopulariopsis brevicaulis Bronchus Acute monocytic leukemia
a b s t r a c t A case of fatal invasion of Scopulariopsis brevicaulis to the bronchus in an acute monocytic leukemia (M5) patient is described. This infection leads to mediastinal emphysema, bronchial bleeding, and bronchial obstruction before finally spreading to the entire lung. The patient was initially diagnosed with pulmonary aspergillosis based on clinical signs and morphological examination. However, S. brevicaulis was finally identified by 18S rDNA sequencing. The patient failed lipid amphotericin B therapy and voriconazole plus caspofungin combination therapy. To the best of our knowledge, this is the first report on S. brevicaulis affecting the bronchus and resulting in a fatal prognosis in an M5 patient. © 2012 Elsevier Inc. All rights reserved.
1. Introduction In nature, Scopulariopsis brevicaulis (S. brevicaulis) is a ubiquitous fungus frequently isolated from the air, soil, plant, food, and organic waste. It is rarely pathogenic, but in humans, it has mainly been associated with nail and skin infections. Deep infection caused by S. brevicaulis is an extremely rare but life-threatening infection (Cuenca-Estrella et al., 2003; Steinbach et al., 2004). We describe here a case of fatal invasion of S. brevicaulis to the bronchus in an acute monocytic leukemia (M5) patient. This infection, which leads to mediastinal emphysema, bronchial bleeding, and bronchial obstruction, is rarely documented. 2. Case On 2 September 2010, a 29-year-old woman was admitted to our hospital for salvage chemotherapy. She was diagnosed with minimally differentiated acute myelogenous leukemia (M0) in the Hematology Department of our hospital 4.5 years ago and received several courses of chemotherapy. She achieved complete remission after the first course of chemotherapy and remained in complete remission for the last 4 years. However, for a 2010 visit, bone marrow puncture indicated that the M0 transformed into acute monocytic leukemia (M5). On 8 September 2010, the homoharringtonine, cytarabine, and aclarubicin chemotherapeutic regimen was administered. During the therapy, fever occurred intermittently, with the body temperature fluctuating between 38.2 °C and 38.5 °C. This fever ⁎ Corresponding author. Tel.: + 86-571-87236383; fax: + 86-571-87236383. E-mail address: [email protected] (Z. Chen). 0732-8893/$ – see front matter © 2012 Elsevier Inc. All rights reserved. doi:10.1016/j.diagmicrobio.2012.04.010
was alleviated after administering meropenem (1.0 g intravenously, twice daily) as anti-inflammatory treatment. On 28 September 2010, the body temperature of the patient was normal, but there were coughing, expectoration, chest distress, as well as breathlessness and sporadic wheezes on the right lung. A computed tomography (CT) scan of the lung indicated inflammation of the right lung hilus and partial obstruction of the right bronchus (Fig. 1). The clinician considered that the bronchial obstruction caused the wheezing. Small amounts of Aspergillus flavus were identified twice from the sputum; thus, voriconazole (0.2 g intravenously, twice daily) was administered. On 22 October 2010, the patient complained of pain at the bottom of the neck on the right side. Physical examination revealed that the subcutaneous crepitus of the right side of her neck and breath sound was decreased in the left lung and exaggerated in the right lung. Bedside chest radiographs indicated cervical subcutaneous emphysema and mediastinal emphysema (Fig. 2). Due to these unclear and discrepant reasons, clinicians considered the potential existence of tracheal damage or the possible infection of Bacillus gasoformans or mold fungi. Linezolid (0.6 g intravenously, twice daily), panipenem and betamipron (0.5 g intravenously, 3 times daily), amphotericin B (0.1 mg/kg per day loading dose followed by 1 mg/kg per day), as well as voriconazole (0.2 g intravenously, twice daily) were administered. Persistent neutropenia was also observed from 21 October 2010. Given the slow recovery of the marrow suppression, combined anti-infection and blood transfusion treatments were administered. However, the symptoms of dyspnea, coughing, and expectoration were much more serious. On 29 October 2010, a CT scan of the lung indicated multiple infectious changes in both lungs, obstruction of the left bronchus, and left pulmonary atelectasis (Fig. 3). Bronchoscopy was suggested for further diagnosis
370
Q. Yang et al. / Diagnostic Microbiology and Infectious Disease 73 (2012) 369–371
Fig. 1. CT scan of the lung indicating inflammation on the right side of the lung hilus and partial obstruction of the right bronchus.
Fig. 3. CT scan of the lung indicating multiple infectious changes in both lungs, obstruction of the left bronchus, and left pulmonary atelectasis.
by molecular identification. The primer pairs EF3 (TCCTCTAAATGACCAAGTTTG) and EF4 (GGAAGGGRTGTATTTATTAG) (Smit et al., 1999) were used to obtain fungal DNA fragments about 1500 bp long from the lung tissue culture. Finally, the molecular identification of S. brevicaulis was based on 18S rDNA sequence analysis. The obtained 18S rDNA sequence was submitted to NCBI and assigned the accession number JN157617. Susceptibility testing was carried out by an Etest, and the MIC values were as follows: fluconazole, itraconazole, and voriconazole, N32 mg/L; amphotericin B, 1.5 mg/L.
because the condition of the patient continued to deteriorate. Fiberoptic bronchoscopy was conducted on 2 November 2010 and showed old blood stains in the total airway, whitish sphacelus, and mucosal swelling in the right lung. Blood clots blocked the left lower lobe, resulting in partial obstruction of the left main stem bronchus. In the Department of Pathology, pathological examination of the lung tissue by standard staining (periodic acid-Schiff) (Fig. 4) suggested aspergillosis. In the Clinical Laboratory Center, microscopic examination of the culture of lung tissue revealed fungal hypha and hyaline annelloconidia (Fig. 5). Therefore, we suspected that the infection may have been caused by Scopulariopsis species. However, physicians presumed that it was aspergillosis; thus, the treatment was changed to voriconazole (0.2 g intravenously, twice daily) plus caspofungin (70 mg intravenously loading dose followed by 50 mg intravenously, daily). The fever hovered at around 38 °C in the following days, there was no further radiographic improvement, and neutropenia showed no obvious sign of recovery. After 20 days, despite experiencing dyspnea and persistent hyperpyrexia, the patient left the hospital against medical advice. One week later, the exacerbation of these symptoms was still not controlled and the patient died. To determine the source of pulmonary infection, the fungal culture was reexamined
3. Discussion
Fig. 2. Bedside chest radiographs indicating cervical subcutaneous emphysema and mediastinal emphysema.
Fig. 4. Pathological examination of the lung tissue by standard staining (periodic acid-Schiff, 1000 × original magnification) suggesting aspergillosis.
Scopulariopsis species are widely distributed fungi in nature, and 8 have been reported to be associated with human diseases (S. acremonium, S. asperula, S. flava, S. fusca, S. koningii, S. brevicaulis, S. brumptii, and S. candida). The majority of human cases of Scopulariopsis infection have been due to S. brevicaulis (Bonifaz et al., 2007; Summerbell et al., 1989). They have mainly been associated with superficial mycotic infections, such as onychomycosis. Deeper infections caused by Scopulariopsis are rarely reported. S. brevicaulis rapidly grows on Sabouraud's dextrose agar media. Initially, its colonies are white, then become buff and powdery to granular at maturity. On the opposite side of Sabouraud's dextrose
Q. Yang et al. / Diagnostic Microbiology and Infectious Disease 73 (2012) 369–371
371
S. brevicaulis infections are almost universally fatal and very difficult to treat. This hyphomycete species is resistant to available broad-spectrum antifungal agents; thus, surgical debridement, antifungal agent use, and other possible methods are recommended to be combined in clinical practice. For example, an ulcerative subcutaneous lesion due to S. brevicaulis in a liver transplant recipient has been completely cured after combined surgery and long-term oral therapy with terbinafine (250 mg daily) (Sellier et al., 2000). A 17-year-old adolescent boy with acute myelocytic leukemia and S. brevicaulis sinonasal infection has also been successfully treated after combined extensive surgical debridement and liposomal amphotericin B administration (Gluck et al., 2011). However, in daily clinical practice, very few deep S. brevicaulis infections can be treated satisfactorily with surgical indication; thus, other therapeutic interventions such as new agents, combined antifungal therapy, and immunotherapy need to be developed.
Fig. 5. Microscopic examination of the culture of the lung tissue revealed fungal hypha and hyaline annelloconidia (1000 × original magnification).
agar media, S. brevicaulis gradually turns from honey-colored to brownish. Microscopically, the fungi appear as hyaline annelloconidia and septated hyphae (Migrino et al., 1995). Histopathologic findings show hyphal morphology indistinguishable from species of Aspergillus, Fusarium, and Pseudallescheria under microscopy. Therefore, the exact identification of its species and genus is quite difficult using conventional laboratory testing methods. In several cases, S. brevicaulis is initially diagnosed as other fungi (Jain et al., 2010; Neglia et al., 1987; Salmon et al., 2010). In the present study, the patient was thought to have respiratory aspergillosis infection and the optimal treatment was delayed. After the patient died from infection, S. brevicaulis was finally identified by 18S rDNA sequencing. Although sometimes indistinguishable in clinical cases, invasive Aspergillus- and Scopulariopsis-related diseases need to be accurately differentiated. Amphotericin B and voriconazole have shown efficacy for invasive aspergillosis, but was inactive against S. brevicaulis. Therefore, fungus identification using both culture morphology and molecular identification is very necessary. S. brevicaulis is resistant to amphotericin B, flucytosine, and azoles (Cuenca-Estrella et al., 2006). A study has shown that S. brevicaulis is resistant to flucytosine and itraconazole in vitro, and the MIC values of amphotericin B, voriconazole, and terbinafine for S. brevicaulis are high (Cuenca-Estrella et al., 2003). Another study has shown that Terbinafine exhibits activity against S. brevicaulis (Clayton, 1994). In the present study, S. brevicaulis was also resistant to fluconazole, itraconazole, voriconazole, and amphotericin B. The patient suffered from prolonged neutropenia and immune deficiency, rendering treatment much more difficult and worsening the lung infection.
References Bonifaz A, Cruz-Aguilar P, Ponce RM. Onychomycosis by molds. Report of 78 cases. Eur J Dermatol 2007;17:70–2. Clayton YM. Relevance of broad-spectrum and fungicidal activity of antifungals in the treatment of dermatomycoses. Br J Dermatol 1994;130(Suppl. 43):7–8. Cuenca-Estrella M, Gomez-Lopez A, Buitrago MJ, Mellado E, Garcia-Effron G, RodriguezTudela JL. In vitro activities of 10 combinations of antifungal agents against the multiresistant pathogen Scopulariopsis brevicaulis. Antimicrob Agents Chemother 2006;50:2248–50. Cuenca-Estrella M, Gomez-Lopez A, Mellado E, Buitrago MJ, Monzon A, RodriguezTudela JL. Scopulariopsis brevicaulis, a fungal pathogen resistant to broad-spectrum antifungal agents. Antimicrob Agents Chemother 2003;47:2339–41. Gluck O, Segal N, Yariv F, Polacheck I, Puterman M, Greenberg D, et al. Pediatric invasive sinonasal Scopulariopsis brevicaulis—A case report and literature review. Int J Pediatr Otorhinolaryngol 2011;75:891–3. Jain D, Oberoi JK, Shahi SK, Shivnani G, Wattal C. Scopulariopsis brevicaulis infection of prosthetic valve resembling aspergilloma on histopathology. Cardiovasc Pathol 2010. Migrino RQ, Hall GS, Longworth DL. Deep tissue infections caused by Scopulariopsis brevicaulis: report of a case of prosthetic valve endocarditis and review. Clin Infect Dis 1995;21:672–4. Neglia JP, Hurd DD, Ferrieri P, Snover DC. Invasive Scopulariopsis in the immunocompromised host. Am J Med 1987;83:1163–6. Salmon A, Debourgogne A, Vasbien M, Clement L, Collomb J, Plenat F, et al. Disseminated Scopulariopsis brevicaulis infection in an allogeneic stem cell recipient: case report and review of the literature. Clin Microbiol Infect 2010;16: 508–12. Sellier P, Monsuez JJ, Lacroix C, Feray C, Evans J, Minozzi C, et al. Recurrent subcutaneous infection due to Scopulariopsis brevicaulis in a liver transplant recipient. Clin Infect Dis 2000;30:820–3. Smit E, Leeflang P, Glandorf B, van Elsas JD, Wernars K. Analysis of fungal diversity in the wheat rhizosphere by sequencing of cloned PCR-amplified genes encoding 18S rRNA and temperature gradient gel electrophoresis. Appl Environ Microbiol 1999;65:2614–21. Steinbach WJ, Schell WA, Miller JL, Perfect JR, Martin PL. Fatal Scopulariopsis brevicaulis infection in a paediatric stem-cell transplant patient treated with voriconazole and caspofungin and a review of Scopulariopsis infections in immunocompromised patients. J Infect 2004;48:112–6. Summerbell RC, Kane J, Krajden S. Onychomycosis, tinea pedis and tinea manuum caused by non-dermatophytic filamentous fungi. Mycoses 1989;32:609–19.
Contents lists available at SciVerse ScienceDirect
Diagnostic Microbiology and Infectious Disease j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / d i a g m i c r o b i o
Case Reports
Fatal bronchial invasion of Scopulariopsis brevicaulis in an acute monocytic leukemia patient Qing Yang a, Juying Wei b, Zhenjing Chen c,⁎ a b c
State Key Laboratory for Diagnosis and Treatment of Infectious Disease, First Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, Zhejiang 310003, PR China Department of Hematology, First Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, Zhejiang 310003, PR China Clinical Laboratory Center, First Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, Zhejiang 310003, PR China
a r t i c l e
i n f o
Article history: Received 14 February 2012 Received in revised form 21 April 2012 Accepted 25 April 2012 Available online 25 May 2012 Keywords: Scopulariopsis brevicaulis Bronchus Acute monocytic leukemia
a b s t r a c t A case of fatal invasion of Scopulariopsis brevicaulis to the bronchus in an acute monocytic leukemia (M5) patient is described. This infection leads to mediastinal emphysema, bronchial bleeding, and bronchial obstruction before finally spreading to the entire lung. The patient was initially diagnosed with pulmonary aspergillosis based on clinical signs and morphological examination. However, S. brevicaulis was finally identified by 18S rDNA sequencing. The patient failed lipid amphotericin B therapy and voriconazole plus caspofungin combination therapy. To the best of our knowledge, this is the first report on S. brevicaulis affecting the bronchus and resulting in a fatal prognosis in an M5 patient. © 2012 Elsevier Inc. All rights reserved.
1. Introduction In nature, Scopulariopsis brevicaulis (S. brevicaulis) is a ubiquitous fungus frequently isolated from the air, soil, plant, food, and organic waste. It is rarely pathogenic, but in humans, it has mainly been associated with nail and skin infections. Deep infection caused by S. brevicaulis is an extremely rare but life-threatening infection (Cuenca-Estrella et al., 2003; Steinbach et al., 2004). We describe here a case of fatal invasion of S. brevicaulis to the bronchus in an acute monocytic leukemia (M5) patient. This infection, which leads to mediastinal emphysema, bronchial bleeding, and bronchial obstruction, is rarely documented. 2. Case On 2 September 2010, a 29-year-old woman was admitted to our hospital for salvage chemotherapy. She was diagnosed with minimally differentiated acute myelogenous leukemia (M0) in the Hematology Department of our hospital 4.5 years ago and received several courses of chemotherapy. She achieved complete remission after the first course of chemotherapy and remained in complete remission for the last 4 years. However, for a 2010 visit, bone marrow puncture indicated that the M0 transformed into acute monocytic leukemia (M5). On 8 September 2010, the homoharringtonine, cytarabine, and aclarubicin chemotherapeutic regimen was administered. During the therapy, fever occurred intermittently, with the body temperature fluctuating between 38.2 °C and 38.5 °C. This fever ⁎ Corresponding author. Tel.: + 86-571-87236383; fax: + 86-571-87236383. E-mail address: [email protected] (Z. Chen). 0732-8893/$ – see front matter © 2012 Elsevier Inc. All rights reserved. doi:10.1016/j.diagmicrobio.2012.04.010
was alleviated after administering meropenem (1.0 g intravenously, twice daily) as anti-inflammatory treatment. On 28 September 2010, the body temperature of the patient was normal, but there were coughing, expectoration, chest distress, as well as breathlessness and sporadic wheezes on the right lung. A computed tomography (CT) scan of the lung indicated inflammation of the right lung hilus and partial obstruction of the right bronchus (Fig. 1). The clinician considered that the bronchial obstruction caused the wheezing. Small amounts of Aspergillus flavus were identified twice from the sputum; thus, voriconazole (0.2 g intravenously, twice daily) was administered. On 22 October 2010, the patient complained of pain at the bottom of the neck on the right side. Physical examination revealed that the subcutaneous crepitus of the right side of her neck and breath sound was decreased in the left lung and exaggerated in the right lung. Bedside chest radiographs indicated cervical subcutaneous emphysema and mediastinal emphysema (Fig. 2). Due to these unclear and discrepant reasons, clinicians considered the potential existence of tracheal damage or the possible infection of Bacillus gasoformans or mold fungi. Linezolid (0.6 g intravenously, twice daily), panipenem and betamipron (0.5 g intravenously, 3 times daily), amphotericin B (0.1 mg/kg per day loading dose followed by 1 mg/kg per day), as well as voriconazole (0.2 g intravenously, twice daily) were administered. Persistent neutropenia was also observed from 21 October 2010. Given the slow recovery of the marrow suppression, combined anti-infection and blood transfusion treatments were administered. However, the symptoms of dyspnea, coughing, and expectoration were much more serious. On 29 October 2010, a CT scan of the lung indicated multiple infectious changes in both lungs, obstruction of the left bronchus, and left pulmonary atelectasis (Fig. 3). Bronchoscopy was suggested for further diagnosis
370
Q. Yang et al. / Diagnostic Microbiology and Infectious Disease 73 (2012) 369–371
Fig. 1. CT scan of the lung indicating inflammation on the right side of the lung hilus and partial obstruction of the right bronchus.
Fig. 3. CT scan of the lung indicating multiple infectious changes in both lungs, obstruction of the left bronchus, and left pulmonary atelectasis.
by molecular identification. The primer pairs EF3 (TCCTCTAAATGACCAAGTTTG) and EF4 (GGAAGGGRTGTATTTATTAG) (Smit et al., 1999) were used to obtain fungal DNA fragments about 1500 bp long from the lung tissue culture. Finally, the molecular identification of S. brevicaulis was based on 18S rDNA sequence analysis. The obtained 18S rDNA sequence was submitted to NCBI and assigned the accession number JN157617. Susceptibility testing was carried out by an Etest, and the MIC values were as follows: fluconazole, itraconazole, and voriconazole, N32 mg/L; amphotericin B, 1.5 mg/L.
because the condition of the patient continued to deteriorate. Fiberoptic bronchoscopy was conducted on 2 November 2010 and showed old blood stains in the total airway, whitish sphacelus, and mucosal swelling in the right lung. Blood clots blocked the left lower lobe, resulting in partial obstruction of the left main stem bronchus. In the Department of Pathology, pathological examination of the lung tissue by standard staining (periodic acid-Schiff) (Fig. 4) suggested aspergillosis. In the Clinical Laboratory Center, microscopic examination of the culture of lung tissue revealed fungal hypha and hyaline annelloconidia (Fig. 5). Therefore, we suspected that the infection may have been caused by Scopulariopsis species. However, physicians presumed that it was aspergillosis; thus, the treatment was changed to voriconazole (0.2 g intravenously, twice daily) plus caspofungin (70 mg intravenously loading dose followed by 50 mg intravenously, daily). The fever hovered at around 38 °C in the following days, there was no further radiographic improvement, and neutropenia showed no obvious sign of recovery. After 20 days, despite experiencing dyspnea and persistent hyperpyrexia, the patient left the hospital against medical advice. One week later, the exacerbation of these symptoms was still not controlled and the patient died. To determine the source of pulmonary infection, the fungal culture was reexamined
3. Discussion
Fig. 2. Bedside chest radiographs indicating cervical subcutaneous emphysema and mediastinal emphysema.
Fig. 4. Pathological examination of the lung tissue by standard staining (periodic acid-Schiff, 1000 × original magnification) suggesting aspergillosis.
Scopulariopsis species are widely distributed fungi in nature, and 8 have been reported to be associated with human diseases (S. acremonium, S. asperula, S. flava, S. fusca, S. koningii, S. brevicaulis, S. brumptii, and S. candida). The majority of human cases of Scopulariopsis infection have been due to S. brevicaulis (Bonifaz et al., 2007; Summerbell et al., 1989). They have mainly been associated with superficial mycotic infections, such as onychomycosis. Deeper infections caused by Scopulariopsis are rarely reported. S. brevicaulis rapidly grows on Sabouraud's dextrose agar media. Initially, its colonies are white, then become buff and powdery to granular at maturity. On the opposite side of Sabouraud's dextrose
Q. Yang et al. / Diagnostic Microbiology and Infectious Disease 73 (2012) 369–371
371
S. brevicaulis infections are almost universally fatal and very difficult to treat. This hyphomycete species is resistant to available broad-spectrum antifungal agents; thus, surgical debridement, antifungal agent use, and other possible methods are recommended to be combined in clinical practice. For example, an ulcerative subcutaneous lesion due to S. brevicaulis in a liver transplant recipient has been completely cured after combined surgery and long-term oral therapy with terbinafine (250 mg daily) (Sellier et al., 2000). A 17-year-old adolescent boy with acute myelocytic leukemia and S. brevicaulis sinonasal infection has also been successfully treated after combined extensive surgical debridement and liposomal amphotericin B administration (Gluck et al., 2011). However, in daily clinical practice, very few deep S. brevicaulis infections can be treated satisfactorily with surgical indication; thus, other therapeutic interventions such as new agents, combined antifungal therapy, and immunotherapy need to be developed.
Fig. 5. Microscopic examination of the culture of the lung tissue revealed fungal hypha and hyaline annelloconidia (1000 × original magnification).
agar media, S. brevicaulis gradually turns from honey-colored to brownish. Microscopically, the fungi appear as hyaline annelloconidia and septated hyphae (Migrino et al., 1995). Histopathologic findings show hyphal morphology indistinguishable from species of Aspergillus, Fusarium, and Pseudallescheria under microscopy. Therefore, the exact identification of its species and genus is quite difficult using conventional laboratory testing methods. In several cases, S. brevicaulis is initially diagnosed as other fungi (Jain et al., 2010; Neglia et al., 1987; Salmon et al., 2010). In the present study, the patient was thought to have respiratory aspergillosis infection and the optimal treatment was delayed. After the patient died from infection, S. brevicaulis was finally identified by 18S rDNA sequencing. Although sometimes indistinguishable in clinical cases, invasive Aspergillus- and Scopulariopsis-related diseases need to be accurately differentiated. Amphotericin B and voriconazole have shown efficacy for invasive aspergillosis, but was inactive against S. brevicaulis. Therefore, fungus identification using both culture morphology and molecular identification is very necessary. S. brevicaulis is resistant to amphotericin B, flucytosine, and azoles (Cuenca-Estrella et al., 2006). A study has shown that S. brevicaulis is resistant to flucytosine and itraconazole in vitro, and the MIC values of amphotericin B, voriconazole, and terbinafine for S. brevicaulis are high (Cuenca-Estrella et al., 2003). Another study has shown that Terbinafine exhibits activity against S. brevicaulis (Clayton, 1994). In the present study, S. brevicaulis was also resistant to fluconazole, itraconazole, voriconazole, and amphotericin B. The patient suffered from prolonged neutropenia and immune deficiency, rendering treatment much more difficult and worsening the lung infection.
References Bonifaz A, Cruz-Aguilar P, Ponce RM. Onychomycosis by molds. Report of 78 cases. Eur J Dermatol 2007;17:70–2. Clayton YM. Relevance of broad-spectrum and fungicidal activity of antifungals in the treatment of dermatomycoses. Br J Dermatol 1994;130(Suppl. 43):7–8. Cuenca-Estrella M, Gomez-Lopez A, Buitrago MJ, Mellado E, Garcia-Effron G, RodriguezTudela JL. In vitro activities of 10 combinations of antifungal agents against the multiresistant pathogen Scopulariopsis brevicaulis. Antimicrob Agents Chemother 2006;50:2248–50. Cuenca-Estrella M, Gomez-Lopez A, Mellado E, Buitrago MJ, Monzon A, RodriguezTudela JL. Scopulariopsis brevicaulis, a fungal pathogen resistant to broad-spectrum antifungal agents. Antimicrob Agents Chemother 2003;47:2339–41. Gluck O, Segal N, Yariv F, Polacheck I, Puterman M, Greenberg D, et al. Pediatric invasive sinonasal Scopulariopsis brevicaulis—A case report and literature review. Int J Pediatr Otorhinolaryngol 2011;75:891–3. Jain D, Oberoi JK, Shahi SK, Shivnani G, Wattal C. Scopulariopsis brevicaulis infection of prosthetic valve resembling aspergilloma on histopathology. Cardiovasc Pathol 2010. Migrino RQ, Hall GS, Longworth DL. Deep tissue infections caused by Scopulariopsis brevicaulis: report of a case of prosthetic valve endocarditis and review. Clin Infect Dis 1995;21:672–4. Neglia JP, Hurd DD, Ferrieri P, Snover DC. Invasive Scopulariopsis in the immunocompromised host. Am J Med 1987;83:1163–6. Salmon A, Debourgogne A, Vasbien M, Clement L, Collomb J, Plenat F, et al. Disseminated Scopulariopsis brevicaulis infection in an allogeneic stem cell recipient: case report and review of the literature. Clin Microbiol Infect 2010;16: 508–12. Sellier P, Monsuez JJ, Lacroix C, Feray C, Evans J, Minozzi C, et al. Recurrent subcutaneous infection due to Scopulariopsis brevicaulis in a liver transplant recipient. Clin Infect Dis 2000;30:820–3. Smit E, Leeflang P, Glandorf B, van Elsas JD, Wernars K. Analysis of fungal diversity in the wheat rhizosphere by sequencing of cloned PCR-amplified genes encoding 18S rRNA and temperature gradient gel electrophoresis. Appl Environ Microbiol 1999;65:2614–21. Steinbach WJ, Schell WA, Miller JL, Perfect JR, Martin PL. Fatal Scopulariopsis brevicaulis infection in a paediatric stem-cell transplant patient treated with voriconazole and caspofungin and a review of Scopulariopsis infections in immunocompromised patients. J Infect 2004;48:112–6. Summerbell RC, Kane J, Krajden S. Onychomycosis, tinea pedis and tinea manuum caused by non-dermatophytic filamentous fungi. Mycoses 1989;32:609–19.