Fate of tetracycline, sulfonamide and fluoroquinolone resistance genes and the changes in bacterial diversity during composting of swine manure

Bioresource Technology 126 (2012) 383–390

Contents lists available at SciVerse ScienceDirect

Bioresource Technology journal homepage: www.elsevier.com/locate/biortech

Fate of tetracycline, sulfonamide and fluoroquinolone resistance genes and the changes in bacterial diversity during composting of swine manure Ammaiyappan Selvam, Delin Xu, Zhenyong Zhao, Jonathan W.C. Wong ⇑ Sino-Forest Applied Research Centre for Pearl River Delta Environment, Hong Kong Baptist University, Kowloon Tong, Hong Kong

a r t i c l e

i n f o

Article history: Available online 20 March 2012 Keywords: Composting Swine manure Antibiotic resistance Real-time PCR DGGE

a b s t r a c t This study monitored the abundance of antibiotic resistant genes (ARGs) and the bacterial diversity during composting of swine manure spiked with chlortetracycline, sulfadiazine and ciprofloxacin at two different levels and a control without antibiotics. Resistance genes of tetracycline (tetQ, tetW, tetC, tetG, tetZ and tetY), sulfonamide (sul1, sul2, dfrA1 and dfrA7) and fluoroquinolone (gyrA and parC) represented 0.02–1.91%, 0.67–10.28% and 0.00005–0.0002%, respectively, of the total 16S rDNA copies in the initial composting mass. After 28–42 days of composting, these ARGs, except parC, were undetectable in the composting mass indicating that composting is a potential method of manure management. Polymerase chain reaction-denaturing gradient gel electrophoresis analysis of bacterial 16S rDNA of the composting mass indicated that the addition of antibiotics up to 100, 20 and 20 mg/kg of chlortetracycline, sulfadiazine and ciprofloxacin, respectively, elicited only a transient perturbation and the bacterial diversity was restored in due course of composting. Ó 2012 Elsevier Ltd. All rights reserved.

1. Introduction Antibiotics are used in animal husbandries for both prophylactic and therapeutic purposes. However, 30–90% of the administered antibiotics are excreted through urine and feces as non-metabolized parent compounds and these non-metabolized antibiotics in the animal manure become a significant source of antibiotics and cause the development of antibiotic resistant microbes in the environment (Heuer et al., 2011). Consequently, there are concerns about the transfer of antibiotic resistance determinants to pathogens that may reduce the efficiency of antibiotic therapy to both human and animals (Barton, 2000). Development of resistance to antibiotics in microbes is a highly complex process and yet not completely understood even in clinical environments. But it was demonstrated that antibiotics even at sub-inhibitory concentrations affect cell functions and change the genetic expression of virulence factors or the transfer of antibiotic resistance (Salyers, 2002). The frequency of bacteria carrying antimicrobial resistance genes seems to be especially high for pigs as compared to cattle or sheep which correlates with the amounts of antibiotics used in the husbandry of these animal species (Enne et al., 2008; McKinney et al., 2010; Schwaiger et al., 2009). High usage of antibiotics put a pressure on the thriving microbes to evolve resistance for the specific environment. Besides, continuous prophylactic use of antibiotics would also facilitate the development of antibiotic resistant bacteria in animals that in turn act as a potential source ⇑ Corresponding author. Tel.: +852 34117056; fax: +852 34112355. E-mail address: [email protected] (J.W.C. Wong). 0960-8524/$ - see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.biortech.2012.03.045

of antibiotic resistance genes in the environment. Furthermore, animal manure promoted horizontal transfer of antibiotic resistance genes in soil were reported previously (Smalla et al., 2000). More details on the source of antibiotic resistance genes (ARGs) in soils and related impacts on the microbial dynamics can be found from the recent review by Heuer et al. (2011). Despite the neumerous reports on the presence and dissemination of manure-driven ARGs, their fate during the composting was never reported, although composting was demonstrated to reduce the levels of antibiotics significantly (Arikan et al., 2009; Dolliver et al., 2008; Hu et al., 2011; Selvam et al., 2012; Wu et al., 2011). As a promising bioremediation technology, composting has been applied to remove antibiotics from animal manures recently. During composting, the presence of a wide variety of complex organic compounds will encourage the development of a wide diversity and high population of microorganisms (Díaz et al., 1993). Usually, microorganisms dominating within the contaminated environment are those capable of utilizing and/or surviving toxic contamination. For their survival, they must possess appropriate mechanism for the tolerance; in case of antibiotics, presence of antibiotic resistance genes (ARGs) was implicated. On one hand removal of antibiotics from the animal manures is important; while, on the other hand the ARGs must also be eliminated to prevent their accumulation in soil. DNA-based method, like real-time PCR (polymerase chain reaction), is being used increasingly in microbial ecology to quantify the functional gene markers within the environment (Smith and Osborn, 2009), owing to the feasibility of quantifying both culturable and non-culturable bacteria. There are studies concerning the

384

A. Selvam et al. / Bioresource Technology 126 (2012) 383–390

abundance of certain ARGs in bovine feces (Alexander et al., 2011), groundwater near the concentrated animal feeding operations (Aminov et al., 2001,2002; Chee-Sanford et al., 2001) and swine manure (Agersø et al., 2006). Further, prevalence of tet and erm genes in swine manure compost were quantified in a couple of previous studies (Chen et al., 2007; Yu et al., 2005). The tet genes belonging to RPP (ribosomal protection protein) group were undetectable in two-thirds of the swine manure compost samples; whereas the tet genes belonging to ‘efflux’ group were reduced up to 6 logs (Yu et al., 2005); and erm gene abundances were reduced by up to 7.3 logs (Chen et al., 2007). These results indicate that the composting can reduce the ARGs significantly; however, the detailed information regarding the ARGs distribution during manure composting as well as the microbial diversity changes upon antibiotic presence is still lacking. Tetracyclines and sulfonamides were the most used antibiotics in high quantities in swine farms. Further, compared with cattle and poultry, swine manures were reported to have higher tet and sul resistance genes in the effluent as well as in the solid phase (McKinney et al., 2010) that requires suitable mitigation. Therefore, this study aimed at monitoring the selected ARGs responsible for the tetracyclines, sulfonamides and fluoroquinolones during composting of swine manure spiked with chlortetracycline (CTC), sulfadiazine (SDZ) and ciprofloxacin (CIP). Additionally, changes in the bacterial community profile with the aim to understand how antibiotics affect the bacterial diversity were investigated using PCR-DGGE (denaturing gradient gel electrophoresis). 2. Methods 2.1. Reactor and operation The swine manure was collected from the farm in the new territories, Hong Kong and the selected physicochemical properties were as follows: pH 7.13, moisture content 74%, bulk density 1.04 t/m3, total organic carbon 30.69%, total Kjeldahl nitrogen (TKN) 4.03%, organic matter 72.1% and carbon/nitrogen (C/N) ratio 7.6. The swine manure was spiked with SDZ, CTC and CIP at two levels: high (H- level; 100 mg/kg CTC + 20 mg/kg SDZ + 20 mg/kg CIP) or low (L- level; 10 mg/kg CTC + 2 mg/kg SDZ + 2 mg/kg CIP). A control treatment was also prepared without the addition of antibiotics. Saw dust (<4 mm) was mixed with swine manure (1: 1 DW) to adjust the C/N ratio to 29 and moisture content to 55%; and the mixing with the saw dust reduced the concentration of the antibiotics in the composting mass half of the concentration mentioned above. Therefore the final antibiotic spiked concentrations of the H- level treatment were 50 mg/kg CTC + 10 mg/kg SDZ + 10 mg/kg CIP; and low level (L- level) treatments were 5 mg/kg CTC + 1 mg/kg SDZ + 1 mg/kg CIP). Composting of swine manure was conducted for 56 days with an aeration rate of 0.5 L/kg DW/min. Details of the composting process, organic decomposition, antibiotic degradation and the methods of analyses were presented in a previous report (Selvam et al., 2012). 2.2. DNA isolation and polymerase chain reaction amplification On predetermined days, the genomic DNA of the composting mass from different treatments were isolated from about 200 mg fresh sample using QIAamp DNA stool Mini kit (Cat.# 51504, QIAGEN) according to the manufacturer’s protocol and used as templates for the subsequent PCR. For each sample, DNA extraction was performed with two replicate samples (whole sample that includes the manure and the saw dust) to compensate for the heterogeneity. Quantity of the extracted DNA was determined using Nanodrop ND-100 spectrophotometer. Further, the A260/A280 and

A260/A230 ratios were also checked to assess the contamination of protein and humic acids, respectively. Total bacterial 16S rDNA, tetracycline resistance genes, sulfonamide resistance genes and fluoroquinolone resistance genes were amplified from the total genomic DNA isolated from compost samples by PCR using the primer pairs listed in Table 1. For the RT-PCR analysis, replicate DNA extracts were individually analyzed and the results are mean of two replicate samples. The PCR master mix (Promega) was used for 25-ll reaction mix and the reactions were performed using Thermal Cycler PTC0200G (Biorad) with the following reaction conditions: 95 °C for 5 min, followed by 34 cycles at 95 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min, and a final extension step at 72 °C for 10 min. For the PCR amplification of gyrA genes, an annealing temperature of 45 °C with an additional 1.5 mM MgCl2 in the reaction mix was used. The PCR products were analyzed by electrophoresis on 2% (w/v) agarose gel with 100 bp DNA ladder (Promega) to confirm the size and the approximate quantity of the amplicons. 2.3. Plasmid construction The PCR products of the V3 region of the bacterial 16S rDNA and the individual antibiotic resistant genes were purified by WizardÒ SV Gel and PCR Clean-Up System (Cat.# A9281, Promega), and then cloned into pGEM-T vector (Promega). The ligation reactions were performed according to the manufacturer’s instructions, and 2 ll of each ligation product was transformed into E. coli DH5a competent cells. Plasmid DNA of selected transformants was purified by PureYield Plasmid Miniprep System (Cat. # A1222, Promega), sequenced for the confirmation, concentration of the DNA was measured using Nanodrop spectrophotometer, and used as standards for subsequent real-time (RT)-PCR reactions. 2.4. Real-time PCR Normal PCR was performed to preliminarily screen the existence of 13 tetracycline genes (RPP class: tetM, tetO, tetQ, tetS, tetT, tetW and tetB/P; Efflux class: tetC, tetE, tetG, tetH, tetYand tetZ, refer Levy et al., 1999 for the details on nomenclature), 6 sulfonamide resistance genes (sul1, sul2, sul3, dfrA1, drfA2 and drfA7) and 2 fluoroquinolone resistance genes (gyrA and parC) from all the genomic DNA samples isolated from composting mass. The tet genes were selected based on the prevalence data of the previous reports (Aminov et al., 2001,2002; Chee-Sanford et al., 2001; Mackie et al., 2006). For the sulfonamides and the fluoroquinolones, the most common genes were included in the screening. Six tetracycline resistance genes (RPP class: tetW and tetQ; Efflux class: tetC, tetG, tetY and tetZ), four sulfonamide resistance genes (sul1, sul2, drfA1 and drfA7) and two fluoroquinolone resistance genes (gyrA and parC) were positively detected in the screening (data not shown); therefore they were quantified using RT-PCR. The absolute copy number of each ARG was quantified by referring to the corresponding standard curve obtained by plotting copy number of the constructed ARG-carrying pGEM-T plasmid versus threshold cycles. The concentrations of the tested ARGs were presented as percentage of ‘‘copy number of an ARG/copy number of 16S rDNA’’ for each sample in order to emphasize the relative abundance of the resistance genes. Although the copy number of 16S rDNA per bacterial genome can vary among the bacteria (Case et al., 2007), its quantification has previously been used to estimate the overall bacterial abundance and to normalize resistance genes to the bacterial population in environmental samples (Alexander et al., 2011; Mackie et al., 2006; McKinney et al., 2010). The plasmid DNA of 16S rDNA as well as ARGs were serially diluted for making standard curve. A master mix for each primer set was prepared such that each well contained the following:

385

A. Selvam et al. / Bioresource Technology 126 (2012) 383–390 Table 1 Synthetic oligonucleotides used in this study. Primer

50 ?30 sequence

Target

Reference

V3-FW V3-RV TetW-FW TetW-RV TetQ-FW TetQ-RV TetC-FW TetC-RV TetG-FW TetG-RV TetY-FW TetY-RV TetZ-FW TetZ-RV Sul1-FW Sul1-RV Sul2-FW Sul2-RV dfrA1-FW dfrA1-RV dfrA7-FW dfrA7-RV gyrAF gyrAR PARC5-1 PARC3-1 GC341F

CCTACGGGAGGCAGCAG ATTACCGCGGCTGCTGG GAGAGCCTGCTATATGCCAGC GGGCGTATCCACAATGTTAAC AGAATCTGCTGTTTGCCAGTG CGGAGTGTCAATGATATTGCA GCGGGATATCGTCCATTCCG GCGTAGAGGATCCACAGGACG GCAGAGCAGGTCGCTGG CCYGCAAGAGAAGCCAGAAG ATTTGTACCGGCAGAGCAAAC GGCGCTGCCGCCATTATGC CCTTCTCGACCAGGTCGG ACCCACAGCGTGTCCGTC CGGCGTGGGCTACCTGAACG GCCGATCGCGTGAAGTTCCG GCGCTCAAGGCAGATGGCATT GCGTTTGATACCGGCACCCGT AGCATTACCCAACCGAAAGT TGTCAGCAAGATAGCCAGAT AAATGGCGTAATCGGTAATG GTGAACAGTAGACAAATGAAT GA(T/C)GGN(C/T)TNAA(G/A)CCNGTNCA GCCATNCCNACNGC(G/A/T)ATNCC GCGAATAAGTTGAGGAATCAG AGCTCGGAATATTTCGACAAC CGCCCGCCGCGCGCGGCGGGCGGGGCGG GGGCACGGGGGGCCTACGGGAGGCAGCAG CAGGAAACAGCTATGACGGGCGGGGCGGGG GCACGGGGGGCCTACGGGAGGCAGCAG GTAAAACGACGGCCAGTAAATAAAATAAAA ATGTAAAAAAATTACCGCGGCTGCTGG

Bacterial 16S rDNA V3 region

Muyzer et al. (1993)

tetW gene

Aminov et al. (2001)

tetQ gene

Aminov et al. (2001)

tetC gene

Aminov et al. (2001)

tetG gene

Aminov et al. (2001)

tetY gene

Aminov et al. (2001)

tetZ gene

Aminov et al. (2001)

sul1 gene

Aminov et al. (2001)

sul2 gene

Kerrn et al. (2002)

dfrA1 gene

Frank et al. (2007)

dfrA7 gene

Frank et al. (2007)

gyrA gene

Maurin et al. 2001

parC gene

Heisig (1996)

357F-GCM13R 518R-ATM13F

2 SYBR Green Master Mix (Applied Biosystems) that contained all the nucleotides, polymerase, reaction buffer and SYBR green dye; forward and reverse primers; and nuclease-free water to a total of 49 ll. Each sample or standard, 1 ll, was added to the master mix, followed by gentle pipetting before placing in the thermal cycler. Real time quantitative PCR was performed using the Applied Biosystems with fluorescence detection of SYBR green dye. Amplification consisted of an initial hold for 10 min at 95 °C, followed by 40 cycles of 95 °C for 30 s, 55 °C for 30 s (45 °C for gyrA gene) and 72 °C for 1 min. A temperature melting curve profile was obtained by programming the Light cycler at 95 °C for 60 s, 55 °C for 30 s followed by 95 °C for 30 s. 2.5. PCR-DGGE The total DNA isolated from composting mass collected at different time points during composting was normalized to identical concentration and was subsequently used as template to amplify the total bacterial 16S rDNA as described by Muyzer et al. (1993) using primer pair GC341F and V3-RV (Table 1). The duplicate DNA extractions were pooled together and used as the template for the PCR amplification. The PCR products, 50 ll, were separated in a vertical denaturing gradient gel at 60 °C. The polyacrylamide gel (6%) with gradients of 40%75% denaturants (where 100% denaturants contains 7 M urea and 40% formamide) and a running time of 14 h at 75 V were selected, as these conditions optimally separated a maximal number of bands. After electrophoresis, gels were stained with SYBR gold, and photographed under ultraviolet (UV) light. The distinct bands were excised from the gel, and crushed into sterile water. The DNA liberated into the water was used as template to perform PCR for the amplification of the DGGE band, using modified linker PCR primers: 357F-GC-M13R and 518R-AT-M13F (Table 1) and sequenced as described previously (O’Sullivan et al., 2008).

GC-clamp - 16S rDNA V3 region Linker primer for DGGE band sequencing

O’Sullivan et al. (2008)

3. Results and discussion 3.1. Degradation of antibiotics The CTC levels rapidly decreased and more than 80% of the CTC were degraded during the thermophilic period, that is, within the first 14 days. Thereafter, the CTC was completely degraded within 21 days of the composting mass receiving both H- level and L- level of antibiotics. SDZ was removed completely within 3 days of the composting. In contrast, about 0.31 and 1.71 mg/kg of CIP, representing 31% and 17.1% of the spiked concentrations, were extractable from the composting masses of L- level and for H- level treatments, respectively, after 56 days of composting. The interaction of CIP with the high organic content of the composting mass might have denied the access for the degradation that resulted in higher percentage of residual CIP in the L- level treatment. Presence of these antibiotics affected the organic decomposition during the initial stages of composting; however, during the later stages there was no difference among the treatments. Details of the changes in antibiotic concentrations along the composting were presented in a previous report (Selvam et al., 2012).

3.2. Quantification of the total bacteria The initial copy number of the 16S rDNA genes were 3.7  1011/g in the initial composting mass that decreased sharply until day 3, increased marginally at day 7, and declined gradually thereafter (Fig. 1). The initial rapid reduction could be attributed to the thermophilic temperature. Majority of the bacterial population in the pig manure might be coliforms, which did not tolerate the high temperature. Additionally, sudden changes of the living environment might prohibit the growth of a variety of the sensitive microbes, while selectively enrich the tolerant ones that could

386

A. Selvam et al. / Bioresource Technology 126 (2012) 383–390

3x1011

centrations indeed reduced the microbial activity that resulted in comparatively lower temperature in H- level treatments. Despite the similar copy number of 16S rDNA, if the organic decomposition was inhibited during the thermophilic phase, it may be assumed that the bacteria with the H- level treatment were strained in terms of activity although they survived.

2x1011

3.3. Quantification of the tetracycline resistant genes

16S rDNA copies/ g dw

5x1011 Control L - level H - level

4x1011

1011

0

0

1

7

3

14

21

42

28

56

Fig. 1. RT-PCR quantification of 16S rDNA of the composting mass. Treatments were: Control, no antibiotics spiked in the composting mass; L- level, composting mass spiked with 5 mg/kg OTC, 1 mg/kg SDZ and 1 mg/kg CIP; H- level, composting mass spiked with 50 mg/kg OTC, 10 mg/kg SDZ and 10 mg/kg CIP. Error bars are standard deviations (n = 2).

adapt fast and survive along the composting, thus resulted in the sharp decrease followed by a revival in terms of the total population. The gradual decline since day 14 could be due to a decrease of the available nutrient contents owing to microbial consumption. Interestingly, during the initial period in the treatments with low concentrations of antibiotics, the total bacterial population was higher, especially at day 1 and 3, than the high concentrations and the control. This might occurred mainly due to the differences in the highest temperature of the compost masses in individual composter. The compost mass temperatures of the control, Land H- level on day 1 were 65, 61 and 43, respectively. Presence of antibiotics could also affect the bacterial population; however, the slightly higher copies of 16S rDNA indicate that the L- level of antibiotics did not affect the population; whereas higher con-

0.4

3.0

(a) tet C Control L - level H - level

% of 16S rDNA

0.3

The percent ‘‘copy number of ARG/copy number of 16S rDNA’’ of the quantified tetracycline resistance genes is presented in Fig. 2. Previously, tetQ, tetW, tetM, tetT, and tetO were frequently detected in lagoon and groundwater samples under the influence of swine farm in US (Chee-Sanford et al., 2001; Mackie et al., 2006). In the present study, tet genes belonging to Q, W, C, G, Z and Y were positively detected. As shown in Fig. 2, the tetY was the highest, comprising 1.91% of the 16S rDNA copies, in the initial composting mix followed by tetG (1.89%), tetC (0.31%), tetZ (0.29%) tetQ (0.04%) and tetW (0.02%). Previously, tetQ and tetW, belonging to the RPP (ribosomal protection protein) group of tet genes, were reported in very high numbers, i.e., 8–10 log copies/g than the efflux tet genes such as tetC and tetG (5–9 log copies/g) in swine manure (Yu et al., 2005). In this study, the ‘efflux’ tet genes were nearly 1 log (per gram) higher than ‘RPP’ tet genes, indicating either the differences in the intestinal flora as influenced by the type and quantity of the antibiotic used or the geographical variation. However, the levels were almost similar indicating the necessity to address this problem in manure management. Further, the antibiotics CTC and SDZ were not detectable in the raw pig manure that was used in the study, yet considerable populations of tetracycline resistant bacteria were detectable indicating existence of antibiotic resistant bacteria in the digestive track of the pigs. As reviewed by Johnsen et al. (2009), resistance genes could

0.20

(b) tet G

(c) tet Q

0.18 2.5

0.16 0.14

2.0

0.12 0.2

1.5

0.10 0.08

1.0

0.06

0.1

0.04

0.5

0.02 0.0

0.0 0

% of 16S rDNA

2.5

1

3

7

14

21

0.05

(d) tet Z

0.00 0

28

1

3

7

14

21

28

0 2.5

(e) tet W

2.0

0.04

2.0

1.5

0.03

1.5

1.0

0.02

1.0

0.5

0.01

0.5

0.0 1

3

7 Day

14

21

28

3

7

14

21

28

(f) tet Y

0.0

0.00 0

1

0

1

3 Day

7

14

0

1

3

7

14

Day

Fig. 2. RT-PCR quantification of tetracycline resistance genes representing tetC (a), tetG (b), tetQ (c), tetZ (d), tetW (e) and tetY (f). Treatments were: Control, no antibiotics spiked in the composting mass; L- level, composting mass spiked with 5 mg/kg OTC, 1 mg/kg SDZ and 1 mg/kg CIP; H- level, composting mass spiked with 50 mg/kg OTC, 10 mg/kg SDZ and 10 mg/kg CIP. Error bars are standard deviations (n = 2).

387

A. Selvam et al. / Bioresource Technology 126 (2012) 383–390

20

(a) sul 1

Control L - level H - level

% of 16S rDNA

15

10

(b) sul 2

8

6 10 4 5 2

0

0 0

1

3

7

14

21

28

2.5

0

1

3

7

14

21

28

3.5

(d) dfr A7

(c) dfr A1 3.0

% of 16S rDNA

2.0 2.5 1.5

2.0 1.5

1.0

1.0 0.5 0.5 0.0

0.0 0

1

3

7

14

21

Day

0

1

3

7

14

21

Day

Fig. 3. RT-PCR quantification of sufonamide resistance genes representing sul1 (a), sul2 (b), dfrA1 (c) and dfrA7 (d). Treatments were: Control, no antibiotics spiked in the composting mass; L- level, composting mass spiked with 5 mg/kg OTC, 1 mg/kg SDZ and 1 mg/kg CIP; H- level, composting mass spiked with 50 mg/kg OTC, 10 mg/kg SDZ and 10 mg/kg CIP. Error bars are standard deviations (n = 2).

persist for many years in the absence of the corresponding antibiotic compound. Therefore, the presence of ARGs in the pig manure, used in this study, mimic an appropriate system to monitor the changes during the composting. During the composting, tetC, tetG and tetQ gene copy numbers were increased up to day 14 and were detectable until day 28. In this study, after day 28, samples of day 42 were analyzed; thus it is safe to conclude that by day 42 none of the screened tet genes was detectable. The tetW, tetY and tetZ carrying bacteria reached a peak accumulation on day 1, 3 and 21, respectively, and declined afterwards. While the bacteria carrying tetQ, tetC and tetG distributed relatively even in the detected time points. Among the treatments, in most cases, highest gene copies were found in either L- or H- level treatments; however, at some points, gene copies were higher in control treatments compared with antibiotic spiked treatments. Thus, beside the antibiotic pressure, some other factors influence the ARG copy numbers. Generally, during the thermophilic phase of the first two weeks, the gene copies slowly increased and once the mesophilic phase set, the copy number tend to decline rapidly. This trend indicates that a significant population of the tetracycline resistant bacteria may not be thermophilic and the higher degradation of CTC during the thermophilic phase reduced the CTC pressure on the microbes. Previously, Yu et al. (2005) assessed the presence of tet genes in the swine manure compost (1 and 2.5 months after composting) and reported that the ‘RPP’ tet genes were not detectable in two-thirds of the compost samples; whereas, the ‘efflux’ tet genes were significantly reduced representing nearly half of the swine manure samples. In contrast, in this study tet

genes belonging to both efflux and RPP were not detectable after 42 days indicating the effectiveness of the thermophilic composting applied and composting can be a potential treatment method for the reduction of ARGs in manure composts. 3.4. Quantification of the sulfadiazine resistant genes In contrast to the tet genes, a significant population (8–10%) of bacteria did carry sul genes (Fig. 3). Sulfadiazine resistance was reported to be remarkably frequent among the transconjugants (Binh et al., 2008). Futhermore, a long term effect of sulfadiazine containing manure application on the absolute and relative abundance of the sulfonamide resistance gene sul1 was reported previously. In such situation, class 1 integrons, which are typically associated with sul1, were reported to move with bacteria from manure into soil and establish in the soil (Heuer and Smalla, 2007), emphasizing the high frequency of sulfonamide resistance. Despite that very high frequency, in the present study, all the sulfonamide genes tested were not detectable after 28 to 42 days after composting, indicating the effect of composting conditions applied. Generally, after a reduction on day 1, the sulfonamide resistance genes gradually increased up to day 3 or 7 and gradually or rapidly declined thereafter. Similar to the tet genes, sul and dfr genes were also fluctuate among the treatments (control, L- and H- level treatments). It is interesting to note that the SDZ was degraded completely within three days; however, the sulfonamide resistance genes were detectable up to 21–28 days indicating the possible effect of the transformation products or the high mobility of the sul genes among the bacteria, which requires a detailed study.

388

A. Selvam et al. / Bioresource Technology 126 (2012) 383–390

0.0010

(a) gyrA

Control L - level H - level

% of 16S rDNA

0.0008

0.0006

0.0004

0.0002

0.0000 0

3

14

7

21

Day 0.000100

(b) par C

Control L - level H - level

% of 16S rDNA

0.000080 0.000060 0.000040 0.000005

0.000000 0

3

7

14

21

28

42

56

Day Fig. 4. RT-PCR quantification of fluroquinolone resistance genes representing QRDR region of gyrA (a) and parC (b). Treatments were: Control, no antibiotics spiked in the composting mass; L- level, composting mass spiked with 5 mg/kg OTC, 1 mg/kg SDZ and 1 mg/kg CIP; H- level, composting mass spiked with 50 mg/kg OTC, 10 mg/kg SDZ and 10 mg/kg CIP. Error bars are standard deviations (n = 2).

3.5. Quantification of the ciprofloxacin resistant genes To assess the resistance to the CIP, quinolone resistance-determining regions (QRDR) of the gyrA and parC genes were investigated (Heisig, 1996; Maurin et al., 2001) and the copy numbers (% of the 16S r DNA copies) are presented in Fig. 4. Compared to the tet and sul genes, the copy numbers of both the gyrA and the parC genes were too low indicating the reduced resistance of the bacteria exist in the composting mass. Similar to the tetracycline and sulfonamide genes, the QRDR region of the gyrA gene was observed only for about 21 days. The gyrA copy numbers increased along the composting up to 7 days and sharply decreased thereafter and could not be detected after 21 days (Fig. 4a). Further, the gyrA copy numbers were higher in the control treatment than the CIP treated composting mass at all the time points. Since the background concentration of the CIP was below the detectable levels, the reason for higher resistance in the control treatment over the CIP spiked treatment was not clear. Besides, at some of the time points for tet and dfrA genes also, the copy numbers were higher in the control than the antibiotic treatments. Therefore, more studies are required to reveal the reasons for increase in copy numbers despite the absence of corresponding antibiotics although involvement of plasmids carrying multi-drug resistance could be a possible suspect. In contrast, the parC genes were detectable throughout the composting period although the copy numbers were significantly reduced after 42 days. Interestingly, QRDR region of the parC genes decreased rapidly after 3 days and slowly

increased up to 28 days before reduced to very low levels again. It seems that the temperature plays a significant role in reducing the copy numbers during the thermophilic phase; and once the mesophilic phase re-established, the copy numbers marginally increased. The very low copy numbers in the later phase could be attributed to the less dominance of the bacteria possessing the resistance to fluoroquinolones. Considering all the antibiotic resistance genes investigated, the copy numbers of the resistance genes suddenly decreased initially and gradually increased up to 7–14 days, declined thereafter and disappeared after four weeks. Rarely, like the tetZ, the copy numbers gradually increased up to 21 days and disappeared thereafter. Generally, the manure contains high population of Gram-negative bacteria such as coliforms, which use to carry the antibiotic resistant genes but are not thermophiles. Therefore, during the initial thermophilic temperatures, they might be inactivated or killed but the resistance determinants might be transferred to other thermo-tolerant bacteria which resulted in increase of copy numbers. But eventually with the depletion of available nutrients, populations of these bacteria were also reduced that led to the disappearance of resistance determinants. Thus the thermophilic temperature seemed to play a significant role in reducing the concentrations of resistance genes, leading to the conclusion that the antibiotic resistant bacteria in this composting mass were predominantly mesophiles. In such a situation, when the mesophilic phase was re-established in the composting mass, the resistance genes may be expected to appear again. Because persistence of tet genes were observed in the poultry waste compost and the compost applied soil for a long time although a definite trend was not reported previously (Keen and de With, 2012). However, none of the genes investigated in this study re-appeared after their disappearance during the early stages of the composting. Therefore, it is reasonable to assume that the microbes that carried the resistance genes were inactivated or killed during the thermophilic phase that resulted in undetectable levels of the resistance genes at the end of the composting period. Further, based on our results, a thermophilic period of one week would be sufficient to remove the bacteria containing antibiotic resistance genes. Previously, Guan et al. (2007) reported that the survival and conjugative transfer of the multiple antibiotic-resistance plasmids was affected in the poultry manure composting microcosms. Therefore it was possible that in the present study also the plasmids harboring multiple antibiotic-resistance could exist that resulted in disappearance of many antibiotic resistance genes. However, the existence of parC gene after 56 days of composting may be linked to some of the bacteria that still active in the composting mass but at low levels. Besides, Heisig (1996) observed that the topoisomerase IV is a secondary, less sensitive target for quinolone action in E. coli and that the development of high-level fluoroquinolone resistance in E. coli requires at least one parC mutation in addition to the gyrA mutation(s). Therefore, although parC mutations (QRDR of parC) were observed even after eight weeks of composting in the present study, corresponding absence of gyrA mutation would make the bacteria susceptible for the fluoroquinolone antibiotics. Thus composting can be a potential method to reduce the risk of antibiotic resistant genes in the swine manures. 3.6. DGGE profiles of bacterial community during swine manure composting DGGE was performed using the bacterial 16S rDNA V3 region to reveal the community profile of the bacteria along the composting process. As shown in Fig. 5, compared to day 0, the number of the visible bands clearly decreased from day 1 onwards, suggesting that the changes in the environment by the initiation of the composting reduced the microbial diversity in the composted piles, favouring the growth of tolerant microbes. The microbial

A. Selvam et al. / Bioresource Technology 126 (2012) 383–390

389

Fig. 5. Denaturing gradient gel electrophoresis (DGGE) profile of the V3 region of 16S rDNA fragments. Treatments were: C (control), no antibiotics spiked in the composting mass; L (L- level), composting mass spiked with 5 mg/kg OTC, 1 mg/kg SDZ and 1 mg/kg CIP; H (H- level), composting mass spiked with 50 mg/kg OTC, 10 mg/kg SDZ and 10 mg/kg CIP. The dominant bands selected for sequence identification were marked by numbering.

communities were very dynamic at the initial stage (day 1 and 3), exhibiting both temporal and environmental influences, while such effects disappeared in the following days. Sequencing of the dominant DGGE bands showed the predominance of Ruminofilibacter (01), Microbulbife (04), Verrucomicrobium (09) and Lachnospiraceae bacterium (010) on day 0; Bacillus sp. (1 and 2), Pseudomonas sp. (3), Psychrobacter pulmonis (4), Psychrobacter sp. (5 and 6) and Sporosarcina (7 and 8) on day 1; Alicyclobacillus (12), Lachnospiraceae bacterium (14), Rhizobiaceae bacterium (19) as well as Clostridium sp. (20) on day 3, and Proteobacteria (32 and 33), Bacteroidetes sp. (44), Sphingobacterium sp. (51), and Erythrobacter sp. (50) from day 7 onwards. During the initial stages, the two major bands resulted from Bacillus sp. (bands 1 and 2) and Psychrobacter sp. (band 9) in control disappeared in L- and H- level antibiotic treatments, and four bands representing Pseudomonas sp. (band 3), Psychrobacter sp. (bands 4–6) and Sporosarcina sp. (bands 7 and 8) were selectively enriched in antibiotic treatments, indicating the sensitivity of Bacillus to antibiotics addition, and the potential selection of specific bacteria. On day 3 also, Alicyclobacillus sp. (band 12), Lachnospiraceae bacterium (band 14), and Fervidobacterium sp. (band 18) present in control treatment disappeared in antibiotic treatments. On the contrary, Alcaligenes sp. (band 27), Proteobacteria (bands 32 and 33 in L-level and band 33 in H- level treatments), Pseudomonas argentinensis (band 29), and Pseudoxanthomonas taiwanensis (28) were appeared in antibiotic treatments. The analysis clearly indicated that the differences among the treatments were notable on day 1 and 3; whereas, on subsequent days, the differences disappeared. Antibiotic resistance details of these identified bacteria in the literature may provide some information on the specific enrichment or disappearance in response to specific antibiotics; however, the results would be speculative as additional isolation and investigation may be required. Therefore it is logical to conclude that the addition of antibiotics elicited a transient perturbation and the diversity was restored along the composting period. 4. Conclusions Despite the undetectable levels of tetracyclines, sulfadiazine and ciprofloxacin in the pig manure, ARGs representing the sulfonamides, tetracyclines and fluoroquinolones were present up to 10.28%, 1.91% and 0.00022%, respectively, of the 16S rDNA copies in the initial composting mass. None of these ARGs, except parC, could be detectable after 42 days of composting indicating that composting is a potential method of manure management. The thermophilic temperature seems to play a significant role in

mitigating the presence of ARGs. Addition of antibiotics elicited only a transient perturbation and the bacterial diversity was restored after 3 weeks along the composting period. Acknowledgements The authors thank the Research Grant Council of the Hong Kong Special Administrative Region, People’s Republic of China (Grant HKBU261808), and Hong Kong Baptist University (Grant FRG2/ 11-12/105) for the financial support for this project. References Agersø, Y., Wulff, G., Vaclavik, E., Halling-Sørensen, B., Jensen, L.B., 2006. Effect of tetracycline residues in pig manure slurry on tetracycline-resistant bacteria and resistance gene tet(M) in soil microcosms. Environ. Int. 32, 876–882. Alexander, T., Yanke, J., Reuter, T., Topp, E., Read, R., Selinger, B., McAllister, T., 2011. Longitudinal characterization of antimicrobial resistance genes in feces shed from cattle fed different subtherapeutic antibiotics. BMC Microbiol. 11, Article 19 (p. 12). Aminov, R.I., Garrigues-Jeanjean, N., Mackie, R.I., 2001. Molecular ecology of tetracycline resistance. development and validation of primers for detection of tetracycline resistance genes encoding ribosomal protection proteins. Appl. Environ. Microbiol. 67, 22–32. Aminov, R.I., Chee-Sanford, J.C., Garrigues, N., Teferedegne, B., Krapac, I.J., White, B.A., Mackie, R.I., 2002. Development, validation, and application of PCR primers for detection of tetracycline efflux genes of Gram-negative bacteria. Appl. Environ. Microbiol. 68, 1786–1793. Arikan, O.A., Mulbry, W., Ingram, D., Millner, P., 2009. Minimally managed composting of beef manure at the pilot scale: effect of manure pile construction on pile temperature profiles and on the fate of oxytetracycline and chlortetracycline. Bioresour. Technol. 100, 4447–4453. Barton, M.D., 2000. Antibiotic use in animal feed and its impact on human health. Nutr. Res. Rev. 13, 279–299. Binh, C.T.T., Heuer, H., Kaupenjohann, M., Smalla, K., 2008. Piggery manure used for soil fertilization is a reservoir for transferable antibiotic resistance plasmids. FEMS Microbiol. Ecol. 66, 25–37. Case, R.J., Boucher, Y., Dahllöf, I., Holmström, C., Doolittle, W.F., Kjelleberg, S., 2007. Use of 16S rRNA and rpoB genes as molecular markers for microbial ecology studies. Appl. Environ. Microbiol. 73, 278–288. Chee-Sanford, J.C., Aminov, R.I., Krapac, I.J., Garrigues-Jeanjean, N., Mackie, R.I., 2001. Occurrence and diversity of tetracycline resistance genes in lagoons and groundwater underlying two swine production facilities. Appl. Environ. Microbiol. 67, 1494–1502. Chen, J., Yu, Z., Michel, F.C., Wittum, T., Morrison, M., 2007. Development and application of real-time PCR assays for quantification of erm genes conferring resistance to macrolides-lincosamides-streptogramin B in livestock manure and manure management systems. Appl. Environ. Microbiol. 73, 4407–4416. Díaz, L., Savage, G., Eggerth, L., Golueke, C., 1993. Composting and Recycling Municipal Solid Waste. Lewis publishers, California, USA. Dolliver, H., Gupta, S., Noll, S., 2008. Antibiotic degradation during manure composting. J. Environ. Qual. 37, 1245–1253. Enne, V.I., Cassar, C., Sprigings, K., Woodward, M.J., Bennett, P.M., 2008. A high prevalence of antimicrobial resistant Escherichia coli isolated from pigs and a low prevalence of antimicrobial resistant E. coli from cattle and sheep in Great Britain at slaughter. FEMS Microbiol. Lett. 278, 193–199.

390

A. Selvam et al. / Bioresource Technology 126 (2012) 383–390

Frank, T., Gautier, V., Talarmin, A., Bercion, R., Arlet, G., 2007. Characterization of sulphonamide resistance genes and class 1 integron gene cassettes in Enterobacteriaceae, Central African Republic (CAR). J. Antimicrob. Chemother. 59, 742–745. Guan, J., Wasty, A., Grenier, C., Chan, M., 2007. Influence of temperature on survival and conjugative transfer of multiple antibiotic-resistant plasmids in chicken manure and compost microcosms. Poult. Sci. 86, 610–613. Heisig, P., 1996. Genetic evidence for a role of parC mutations in development of high-level fluoroquinolone resistance in Escherichia coli. Antimicrob. Agents Chemother. 40, 879–885. Heuer, H., Schmitt, H., Smalla, K., 2011. Antibiotic resistance gene spread due to manure application on agricultural fields. Curr. Opin. Microbiol. 14, 236–243. Heuer, H., Smalla, K., 2007. Manure and sulfadiazine synergistically increased bacterial antibiotic resistance in soil over at least two months. Environ. Microbiol. 9, 657–666. Hu, Z., Liu, Y., Chen, G., Gui, X., Chen, T., Zhan, X., 2011. Characterization of organic matter degradation during composting of manure-straw mixtures spiked with tetracyclines. Bioresour. Technol. 102, 7329–7334. Johnsen, P.J., Townsend, J.P., Bohn, T., Simonsen, G.S., Sundsfjord, A., Nielsen, K.M., 2009. Factors affecting the reversal of antimicrobial drug resistance. Lancet Infect. Dis. 9, 357–364. Keen, P.L., de With, N., 2012. Tracking antibiotics and antibiotic resistance genes through the composting process and field distribution of poultry waste: lessons learned. In: Keen, P.L., Montforts, M.H.M.M. (Eds.), Antimicrobial Resistance in the Environment. John Wiley & Sons, Inc., USA, pp. 465–481. Kerrn, M.B., Klemmensen, T., Frimodt-Møller, N., Espersen, F., 2002. Susceptibility of Danish Escherichia coli strains isolated from urinary tract infections and bacteraemia, and distribution of sul genes conferring sulphonamide resistance. J. Antimicrob. Chemother. 50, 1–4. Levy, S.B., McMurry, L.M., Barbosa, T.M., Burdett, V., Courvalin, P., Hillen, W., Roberts, M.C., Rood, J.I., Taylor, D.E., 1999. Nomenclature for new tetracycline resistance determinants. Antimicrob. Agents Chemother. 43, 1523–1524. Mackie, R.I., Koike, S., Krapac, I., Chee-Sanford, J., Maxwell, S., Aminov, R.I., 2006. Tetracycline residues and tetracycline resistance genes in groundwater impacted by swine production facilities. Anim. Biotechnol. 17, 157–176.

Maurin, M., Abergel, C., Raoult, D., 2001. DNA gyrase-mediated natural resistance to fluoroquinolones in Ehrlichia spp. Antimicrob. Agents Chemother. 45, 2098– 2105. McKinney, C.W., Loftin, K.A., Meyer, M.T., Davis, J.G., Pruden, A., 2010. Tet and sul antibiotic resistance genes in livestock lagoons of various operation type, configuration, and antibiotic occurrence. Environ. Sci. Technol. 44, 6102–6109. Muyzer, G., de Waal, E.C., Uitterlinden, A.G., 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59, 695–700. O’Sullivan, L.A., Webster, G., Fry, J.C., Parkes, R.J., Weightman, A.J., 2008. Modified linker-PCR primers facilitate complete sequencing of DGGE DNA fragments. J. Microbiol. Meth. 75, 579–581. Salyers, A.A., 2002. An overview of the genetic basis of antibiotic resistance in bacteria and its implications for agriculture. Anim. Biotechnol. 13, 1–5. Schwaiger, K., Harms, K., Hölzel, C.S., Meyer, K., Karl, M., Bauer, J., 2009. Tetracycline in liquid manure selects for co-occurrence of the resistance genes tet(M) and tet(L) in Enterococcus faecalis. Vet. Microbiol. 139, 386–392. Selvam, A., Zhao, Z., Wong, J.W.-C., 2012. Composting of swine manure spiked with sulfadiazine, chlortetracycline and ciprofloxacin. Biores. Technol. 126, 412–417. Smalla, K., Heuer, H., Götz, A., Niemeyer, D., Krögerrecklenfort, E., Tietze, E., 2000. Exogenous isolation of antibiotic resistance plasmids from piggery manure slurries reveals a high prevalence and diversity of IncQ-like plasmids. Appl. Environ. Microbiol. 66, 4854–4862. Smith, C.J., Osborn, A.M., 2009. Advantages and limitations of quantitative PCR (QPCR)-based approaches in microbial ecology. FEMS Microbiol. Ecol. 67, 6–20. Wu, X., Wei, Y., Zheng, J., Zhao, X., Zhong, W., 2011. The behavior of tetracyclines and their degradation products during swine manure composting. Bioresour. Technol. 102, 5924–5931. Yu, Z., Michel, F.C., Hansen, G., Wittum, T., Morrison, M., 2005. Development and application of real-time PCR assays for quantification of genes encoding tetracycline resistance. Appl. Environ. Microbiol. 71, 6926–6933.