- Email: [email protected]
− mice
Biochemical and Biophysical Research Communications xxx (2017) 1e6
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Fatty acid oxidation alleviates the energy deficiency caused by the loss of MPC1 in MPC1þ/ mice Shiying Zou a, b, Tianqi Lang a, b, Boyang Zhang a, b, Kunlun Huang a, b, Lijing Gong c, Haosu Luo d, Wentao Xu a, b, Xiaoyun He a, b, * a Beijing Advanced Innovation Center for Food Nutrition and Human Health, College of Food Science & Nutritional Engineering, China Agricultural University, Beijing 100083, China b Beijing Laboratory for Food Quality and Safety, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing, China c China Academy of Sport and Health Sciences, Beijing Sport University, 100084 Beijing, China d College of Biological Sciences, China Agricultural University, 100083 Beijing, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 November 2017 Accepted 20 November 2017 Available online xxx
Pyruvate is a central substrate in energy metabolism, paramount to carbohydrate, fat, and amino acid catabolic and anabolic pathways. Mitochondrial pyruvate carrier 1(MPC1) is one important component of the complex that facilitates mitochondrial pyruvate import. Complete MPC1 deficiency is a serious concern, and has been shown to result in embryonic lethality in mice. The study outlined in this paper generated one mouse line with the MPC1 protein part deficiency by using the CRISPR/Cas9 system. Clinical observations, body weight and organ/tissue weight, gas exchange, cold-stimulation, blood parameters, as well as histopathology analysis were analyzed to evaluate potential physiological abnormalities caused by MPC1 deficiency. Results indicate that MPC1þ/ mice experienced a change in important clinical criteria such as low body weight, decreased movement, and low body shell temperature, few adipose accumulate. The mice show significant difference in some blood parameters including apo-B100, apo-A1, HDL, glucagon, insulin. However these changes alleviated while being fed with the HFD, which provided metabolites to sustain the TCA cycle and body development. The MPC1þ/ mice may employ fatty acid oxidation to meet their bioenergetic demands. This study suggests that inhibition of MPC1 activity can boost fatty acid oxidation to provide sufficient energy to the body. This work promotes further studies regarding the interplay between carbohydrate and fat metabolism. © 2017 Published by Elsevier Inc.
Keywords: Mitochondrial pyruvate carrier 1 Pyruvate Knockdown Phenotype
1. Introduction Pyruvate lies at a central biochemical node which connects carbohydrate, amino acid, and fatty acid metabolism. It also possesses the ability to balance glycolysis and oxidative phosphorylation, as well as to stabilize catabolic and anabolic metabolism [1]. Pyruvate is the end product of glycolysis, and a critical cellular metabolite, as well. Pyruvate can be transported into mitochondria and oxidized by pyruvate dehydrogenase comples (PDH) to enter the TCA cycle. More than 30 ATP molecules per molecule of glucose can be produced inside mitochondria. However, if the pyruvate goes into the glycolysis pathway, only two molecules of ATP will be
* Corresponding author. College of Food Science and Nutritional Engineering, China Agricultural University, No. 17 Tsinghua Donglu, Beijing 100083, China. E-mail address: [email protected] (X. He).
produced. ATP production has a major role in the overall metabolism of the cell [2]. Dysregulation of these processes contributes to the pathogenesis of numerous diseases, including diabetes and obesity [3,4], mitochondrial disorders [5], cardiac failure [3], neurodegenerative disorders [6], and cancer [7]. Therefore, a better understanding of how pyruvate fluxes into mitochondria and how to influence the substrate utilization may have therapeutic potential by directly or indirectly influencing glucose, lipid, and amino acid homeostasis. Although the existence of a MPC in the mitochondrial inner membrane has been known for many years [8], it has only recently been identified at the molecular level. The gene, renamed MPC1 and MPC2, encodes the multimeric mitochondrial pyruvate carrier(MPC) complex embedded in the inner mitochondrial membrane [9,10]. In some research, the MPCs have emerged as an unanticipated target of thiazolidinediones and a regular of insulin secretion, suggesting the MPCs play an important role in substrate
https://doi.org/10.1016/j.bbrc.2017.11.134 0006-291X/© 2017 Published by Elsevier Inc.
Please cite this article in press as: S. Zou, et al., Fatty acid oxidation alleviates the energy deficiency caused by the loss of MPC1 in MPC1þ/ mice, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.11.134
2
S. Zou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
selection and metabolic signaling [11]. Du and Elhammali et al. showed the phosphodiesterase inhibitor, Zaprinast, can alter aspartate and glutamate metabolism via the MPC and glutaminase [12,13]. Several mouse models which explore MPC deficiency have been reported, including MPC2 hypomorphic allele [14], acute MPC inhibition by UK5099 [15], and liver-specific knock-outs of MPC1 or MPC2 [16,17]. These studies demonstrate the important role MPCs have in regulating whole-body glucose homeostasis. Benoit et al. generated a whole-body knock-out of the MPC1 gene, which resulted in embryonic lethality at around E13.5, a period when robust mitochondrial biogenesis takes place. During an in vitro study, the mouse embryonic fibroblasts (MEFs) derived from this MPC1 model mice displayed defective pyruvate-driven respiration as well as perturbed metabolic profiles, both defects could be restored by reexpression of MPC1 [18]. Previously, there was no animal model of MPC1 whole body knock-outs. 2. Material and methods 2.1. One MPC1þ/ mice model There is limited knowledge of MPC function, but models that focus on gene knockout or knockdown in vivo may help increase understanding. Such research may also help scientists to better understand metabolic diseases. To investigate how metabolism is reprogrammed in response to MPC inhibition in vertebrates, we created a mice model with an MPC1 protein deficiency. We deleted part of the gene sequence (GCAAAGCGGCGGACTATGTCCGG) of MPC1(NCBI, NM_018819) in C57BL/6 mice by utilizing the Clustered Regularly Interspaced Short Palindromic Repeats/CRISPRassociated 9 system(CRISPR/Cas9) [19]. All experimental procedures were performed according to guidelines provided by the animal welfare act and animal welfare ordinance. The animal experiment and housing procedures were carried out in compliance with the OECD Good Laboratory Practice guidelines. This animal study was approved by the Animal Experimental Welfare & Ethical Inspection Committee (No.2015105), the Supervision & Testing Center for GMO Food Safety, Ministry of Agriculture (Beijing, China). Animals were cared for according to the Guide for the Care and Use of Laboratory Animals [20], and the attendant committees approved all protocols utilized. 2.2. Body weight of MPC1þ/ mice within 24 weeks Six male MPC1þ/ mice and six male WT mice were fed for 24 weeks with water and food ad libitum. They were entered into the experiment after weaning(5 weeks) with 6 mice in one group. 3 mice were fed in one cage. Body weights and food intake were recorded weekly and clinical behavior was observed daily. Blood samples were collected at 12 weeks. At the same time, 6 male MPC1þ/ mice and 6 male WT C57BL/6 mice were fed for 24 weeks with High-fat diet (product dataD12492, 60% calories provided by fat, 20% calories provided by carbohydrate and 20% calories provided by protein). Blood samples were collected at 12 weeks. 2.3. Blood samples collection and parameters test Orbital sinus blood samples were taken from the mice at 12 weeks old, and centrifuged at 4000g for 10 min after 12-hr fasting. Plasma was stored at 80 C for further analysis. Aspartic transaminase (AST), lactate dehydrogenase (LDH), triglycerides(TG), total cholesterol(CHO), alanine aminotransferase(ALT), apolipoprotein B100(apo-B100 0), apolipoprotein A1(apo-A1),
apolipoprotein E(apo-E), apolipoprotein H (apo-H), High-density lipoprotein(HDL), Low-density lipoprotein(LDL), b-hydroxybutyrate(b-HB), Epinephrine(EPI), Glucagon(GC), insulin(INS) and Norepinephrine (NE) were tested using the ELISA kit (Beijing Fangchengjiahong Technology Co Ltd).
2.4. Gas exchange In quite condition: Six male MPC1þ/ mice and 6 male WT mice were chosen in this study. Rectal temperature was taken in each mouse, and energy expenditure was also tested. The animals were housed one mouse per cage with food and water ad libitum. Oxygen consumption and activity were measured for 24 h after 24 h of acclimation using an oxylet system with 4-cages (Panlab; OXYLET). In exercise: Mice were tested during exercise in order to track energy expenditure. The RER was measured using a 4-chamber calorimeter (Oxymax serious; Columbus Instrument) with airflow of 0.6 L/min. Before experimental testing, mice were subjected to a 3-day exercise familiarization protocol that consisted of progressively increasing the intensity and duration of treadmill running. Mice were fasted for 4-hr prior to running. Initially, the mice were running at 5 m/min for 3 min. The velocity was increased by 5 m/ min every 3 min until 60 m/min. The respiratory exchange ratio (RER ¼ VCO2/VO2) was calculated using software provided by the manufacturer.
2.5. Cold-stimulation The mice were placed in a cold room(4 C) for 4 h. Subsequently, cold-inducted thermogenesis was evaluated by taking photos using a handheld infrared camera (FLIR T600, FLIR systems, Oregon, USA). Body weights and blood glucose were measured together.
2.6. ITT, GTT, PTT Twelve male MPC1þ/ mice and 12 male WT C57BL/6 mice were chosen for the GTT, ITT, PTT. Dosages, unless otherwise stated, were based on body weight, prepared in sterile water, and administered intraperitoneally: 4-hr fast with 1.0U/kg insulin(Humulin R; Novo Nordisk) for insulin tolerance test(ITT); 12-hr fast with 2.0 g/kg glucose(Sigma,USA) for glucose tolerance test(GTT); 12-hr fast with 1.5 g/kg pyruvate(Sigma,USA) for pyruvate tolerance test(PTT). Blood glucoses were measured using commercially available kits and regents according to the manufacturer's direction (ACCU-CHEK per forma, Roche, USA) [21].
2.7. Tissue staining and histopathology After 24 weeks of study, all mice were sacrificed for research. Many tissues underwent general histopathological examination, including brain, heart, liver, spleen, lung, kidney, adrenal gland, testis, epididymis, white adipose tissue (WAT), and brown adipose tissue(BAT). All tissues were weighed. Liver and adipose samples were made into pathological slices with Oil Red O staining to assess adipose accumulation.
2.8. Statistical analysis All experiment data were shown as mean ± SD. Data were analyzed by Student's T-test using EXCEL software. Results were considered to be statistically significant at P < 0.05.
Please cite this article in press as: S. Zou, et al., Fatty acid oxidation alleviates the energy deficiency caused by the loss of MPC1 in MPC1þ/ mice, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.11.134
S. Zou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
3. Results 3.1. One MPC1þ/ mice was generated and this phenotype can pass on to the offspring The study produced a mice model with MPC1 gene heterozygous knockdown. Stable knockdown was confirmed at gene and protein levels; knockdown could be consistently maintained in offspring (Fig. 1A and B). The knockdown mice appeared outwardly normal, showing no growth defects in appearance. Food intake was also normal and all mice were fully viable and fertile. There were no effects on reproductive capacity (data were not shown). 3.2. The MPC1þ/ mice show lower body weight compared to the WT mice MPC1þ/ mice display no differences in body composition, food and water intake, or voluntary physical activity, suggesting the absence of any global physiological defect. Otherwise, MPC1þ/ mice display lower body weight compared with the WT mice (Fig. 1C), with body weights significantly decreased (p < 0.05) most notably in weeks 4e7, as well as weeks 9, 10, 14, 15, 17, 19, 21, 22, and 23. 3.3. The MPC1þ/ mice display with disordered glucose and fat management Research indicates that MPC1 knockdown has some effect on glucose and insulin secretion [16]. The insulin, glucagon, apo-B100 and apo-A1 (Fig. 1D,E,G,H) were all significantly increased in MPC1þ/ mice compared with the WT mice. The HDL (Fig. 1 F) was significantly decreased. The increase of apo-B100 and apo-A1 may help increase fat molecule transport around the body. The insulin and glucagon were all significant increased(p < 0.05) in MPC1þ/ mice. The disorder of the pancreas islet was responsible for the increase of insulin and glucagon. AST, ALT, and TG were all significantly increased in MPC1þ/ mice (Fig. 1I). The AST/ALT ratios were unchanged (data were not shown), suggesting the absence of liver damage in MPC1þ/ mice. Triglycerides were slightly increased. When the body requires fatty acids as an energy source, glucagon signals the breakdown of triglycerides by hormone-sensitive lipase to release free fatty acids. The increased ALT and AST may increase the concentration of a-ketoglutaric acid. This phenomenon was consistent with other research [22]. 3.4. Energy was derived mainly from fat rather than glucose during exercise in MPC1þ/ mice To investigate changes in gross metabolism, we measured gas exchange both in quite and exercise condition. The oxymax system is an open-circuit indirect calorimeter for lab animal research. The oxymax system measures oxygen consumption (VO2), respiratory exchange ratio (RER), and activity levels of mice. VO2 is a measure of the volume of oxygen used to convert energy substrate into ATP. RER is a ratio of VCO2 divided by VO2, and can be used to estimate the fuel source for energy production. An RER of 0.7 indicates that fatty acids are the primary substrate for oxidative metabolism, while an RER of 1.0 indicates that carbohydrates are the primary energy substrate [23]. ATP linked respiration only changed when all pyruvate transport, glutamine, and fatty acid oxidation were inhibited. No difference in VO2 exchange was observed between MPC1þ/ mice and WT mice when rectal temperature and energy expenditure were analyzed (Fig. 2A and B). MPC1þ/ mice were less active compared to the WT mice, regardless of day and night (Fig. 2C and D). At night,
3
activity was especially decreased (P < 0.05). The MPC1þ/ mice exhibited a global energy defect, which required them to decrease their energy consumption by also decreasing movement. The MPC1þ/ mice manifested a decreased respiratory exchange ratio (RER) during exercise(p < 0.01) (Fig. 2 H). During exercise, energy was derived mainly from fat rather than glucose [23]. The lack of MPC1 protein perturbed mouse respiratory and metabolic profiles during exercise. 3.5. The MPC1þ/ mice displayed low shell temperature in coldstimulation study No significant differences were observed in body weight or blood glucose, while shell temperature was lower in MPC1þ/ mice compared to WT mice (Fig. 2 E). 3.6. The MPC1þ/ mice showed some difficulty in the utilization of pyruvate Results demonstrate that MPC1þ/ mice show no difference in the GTT and ITT (Fig. 2 I and J). In PTT, the blood glucose of MPC1þ/ at 30min and 60min were significant lower than WT mice (Fig. 2 K). Sampled from the MPC1þ/ mice showed some difficulty in the utilization of pyruvate, consistent with impaired pyruvate-driven gluconeogenesis. Although fasting blood glucose levels of MPC1þ/ mice in ITT tended to be decreased, they were all within normal ranges. 3.7. The MPC1þ/ mice showed low tissue weight and less adipose accumulation The ratios of spleen, lung, and thymus were significantly increased in MPC1þ/ mice (Fig. 3A and B). This may be related to inflammation. When the body tries to cope with a metabolic disorder for a prolonged period of time, all systems may be in an antiinflammatory state. The weight and ratio of WAT and BAT were significantly decreased in MPC1þ/ mice(p < 0.05) (Fig. 3A and B). For the deficiency of MPC1 protein, energy supplied by glucose was limited. The body would produce more ATP by steatolysis, the consumption of fatty acids in the body results in weight changes in BAT and WAT. As shown in our research, the MPC1þ/ mice have lower body weight than WT mice. There were no histopathology changes in the brain, heart, liver, spleen, lung, kidney, adrenal gland, testis, or epididymis. The Oil Red O staining showed the fatty droplets in liver were less prevalent in MPC1þ/ mice(Fig. 3C and D,E,F). The MPC1þ/ mice displayed an energy accumulation deficiency. 3.8. The disorder condition can be reversed by given high-fat diet in MPC1þ/ mice The MPC1þ/ mice showed evidence of disorder in their blood parameters, but strikingly, these changes were reversed partly when the MPC1þ/ mice were fed a high fat diet (Fig. 3G and H,I,J,K). The high fat diet provides metabolites for growth and metabolism. As shown in Fig. 3, apo-B100, apo-A1, and HDL, combined with glucagon and insulin, showed no difference in mice who were fed with HFD. The HFD normalized the parameters and bypassed the need for a functional MPC1. 4. Discussion Pyruvate sustains gluconegenesis and supports mitochondrial metabolism because it can be converted to oxaloacetate or acetylCoA by a single reaction. These two intermediates are required to
Please cite this article in press as: S. Zou, et al., Fatty acid oxidation alleviates the energy deficiency caused by the loss of MPC1 in MPC1þ/ mice, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.11.134
Fig. 1. MPC1þ/ mice model and blood parameters changes. A:The MPC1þ/ mice were confirmed at gene level; B: The MPC1þ/ mice were confirmed at protein level; C: The mice body weight within 24wks fed with standard diet; D: the apo-B100 level of wild type and MPC1þ/ mice; E: the apo-A1 level; F:the HDL level; G: the glucagon level; H:the Insulin level; I: the results of AST, TG and ALT, the concentration of AST and ALT is ng/mL, the concentration of TG is mmol/L.**P < 0.01; *P < 0.05.
Fig. 2. Gas exchanges and the results of ITT, GTT, PTT. A: the VO2 of MPC1þ/ mice and WT mice at day; B:the VO2 at night; C: the movement of mice during the light phase; D: the movement of mice during the dark phase; E: the thermography of MPC1þ/ mice and WT mice; G: the velocity of exercise test; H: the RER of WT and MPC1þ/ mice in exercise test; I: the GTT results; J:the ITT results; K: the PTT results.*P < 0.05, **P < 0.01.
Please cite this article in press as: S. Zou, et al., Fatty acid oxidation alleviates the energy deficiency caused by the loss of MPC1 in MPC1þ/ mice, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.11.134
S. Zou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
sustain the TCA cycle flux. The MPCs contain two distinct proteins, MPC1 and MPC2, these two proteins construct one complex, and the absence of either leads to disorder of mitochondrial pyruvate uptake and utilization in yeast and mammalian cells. Epidemiological investigation makes clear that the MPC1 protein was deleted or underexpressed in multiple cancers including colon, kidney, lung, bladder and brain, and increases the likelihood of death [24]. MPC1 may be inactive in cancer and tumors; the Warburg effect may be associated with decreased pyruvate oxidation [24,25]. This research sought to explore how metabolism was sustained when MPC1 or MPC2 was deficient. Studies indicate that when MPC activity decreases, regulated increases in gluconeogenesis during fasting are most efficiently supplied by glutaminolysis [16]. Gray et al. and McCommis et al. show that the live-specific loss of MPC1 activity impairs pyruvate-driven gluconeogenesis. Euglycemia is maintained by adaptive utilization of glutamine and increased urea, as well as pyruvate-alanine cycle activities [16]. Li et al. examined one line of MPC1 knockout mice and concluded that the heterozygous MPC1 knockout weakens fertility and influences the metabolism of glucose, fatty acids, and body weight in mice [22]. In this mice model, MPC activity was inhibited and the biosynthetic metabolism was shifted from glucose to amino acid and fatty acid oxidation, all without myoblasts proliferating. The TCA cycle was maintained through increased glutamine anaplerosis and oxidation, malic enzyme flux, and fatty acid oxidation [22]. Some research shows MPC inhibition would likely diminish the pool of intramitochondrial citrate, potentially reducing its effuse and, in turn, lipogenesis [11,26]. Vacanti et al. aimed to research the role of the MPC in substrate regulation. They found that despite profound suppression of both glucose and pyruvate oxidation, cell growth, oxygen consumption, and TCA cycle were surprisingly maintained
5
[26]. TCA metabolism was achieved through increased reliance on glutaminolysis through malic enzyme and pyruvate dehydrogenase(PDH), as well as fatty acid and branched chain amino acid(BACCs) oxidation [26]. They observed that MPC1 knockdown in A549 cells exhibited an increased reliance on fatty acid oxidation to fuel TCA cycle metabolism [26]. The aim of this study was to gain a more robust understanding of the physiological role of MPC1 in regulating metabolic homeostasis in vertebrates. This study developed one MPC1 knock-down mice model. The MPC1þ/ mice displayed rescued energy deficit and disordered glucose regulation. When there was an energy deficit, the MPC1þ/ mice showed low body weight, less body movement, lower shell temperature, lower RER in exercise test, less WAT and BAT weight, and fewer fat droplets accumulated in the MPC1þ/ mice liver compared to the WT mice. MPC1þ/ mice displayed gross changes in the plasma parameters but maintained fasting euglycemia. The MPC1þ/ mice transported fewer pyruvate to the mitochondria, and the deficiency of MPC1 also impaired the RER where mitochondria did not supply enough pyruvate to the TCA cycle. Energy may have been provided by fatty acid oxidation was not significantly enhanced in MPC1þ/ mice compared to controls, resulting in lower body weight and fat mass. These results strongly suggest that, although mitochondrial pyruvate transport plays an important role in gluconeogenesis, the deficiency of MPC1 can be circumvented by an increased dependence on the oxidation of fatty acid. ATP linked respiration was only affected when all three pathways, including pyruvate transport and glutamine and fatty acid oxidation, were inhibited. The MPC1þ/ mice potentially employ fatty acid oxidation to meet their bioenergetic demands. The MPC1þ/ mice did not show a similar increase in parameters when fed with the HFD. However, the HFD provided some
Fig. 3. Tissue staining and blood parameter changes after fed with HFD. A: the organ weight. B: the organ/body weight ratio; C and D: the Oil Red O staining liver of WT mice; E and F: staining liver of MPC1þ/ mice; G: the apo-B100 level of WT and MPC1þ/ mice fed with HFD; H: the apo-A1 level with HFD; I: the glucagon level with HFD; J: the HDL level with HFD; K: the Insulin level with HFD. S: spleen; T: thymus; W: WAT; B: BAT; L: lung. *P < 0.05, **P < 0.01.
Please cite this article in press as: S. Zou, et al., Fatty acid oxidation alleviates the energy deficiency caused by the loss of MPC1 in MPC1þ/ mice, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.11.134
6
S. Zou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
metabolites to sustain the TCA cycle and body development. Our model suggests that inhibition of MPC1 activity can boost fatty acid oxidation to provide enough energy to the body, a finding which may provide a research approach for further studies of the interplay between carbohydrate and fat metabolism.
[12]
[13]
Acknowledgement This work was supported by grants from the Genetically Modified Organisms Breeding Major Projects of P.R.China (2016ZX08011005). S.Z. wrote the main manuscript. S.Y. and X.H. designed the study. H.L. designed the animal model. T.L. and L.G. performed the animal trial. X.H. and S.Z. analyzed the data. K.H. and W.X. final approve of the manuscript. All authors reviewed the manuscript.
[14]
[15]
[16]
Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2017.11.134. References [1] T. Bender, J.C. Martinou, The mitochondrial pyruvate carrier in health and disease: to carry or not to carry? Biochim. Biophys. Acta 1863 (10) (2016) 2436e2442. [2] L.R. Gray, S.C. Tompkins, E.B. Taylor, Regulation of pyruvate metabolism and human disease, Cell Mol. Life Sci. 71 (2014) 2577e2604. [3] R.A. DeFronzo, D. Tripathy, Skeletal muscle insulin resistance is the primary defect in type 2 diabetes, Diabetes Care 32 (Suppl 2) (2009) S157eS163. [4] M.C. Sugden, M.G. Zariwala, M.J. Holness, PPARs and the orchestration of metabolic fuel selection, Pharmacol. Res. 60 (2009) 141e150. [5] D.S. Kerr, Review of clinical trials for mitochondrial disorders: 1997-2012, Neurotherapeutics 10 (2013) 307e319. [6] S. Cunnane, S. Nugent, M. Roy, A. Courchesne-Loyer, E. Croteau, S. Tremblay, A. Castellano, F. Pifferi, C. Bocti, N. Paquet, H. Begdouri, M. Bentourkia, E. Turcotte, M. Allard, P. Barberger-Gateau, T. Fulop, S.I. Rapoport, Brain fuel metabolism, aging, and Alzheimer's disease, Nutrition 27 (2011) 3e20. [7] E. Currie, A. Schulze, R. Zechner, T.C. Walther, R.V. Farese Jr., Cellular fatty acid metabolism and cancer, Cell Metab. 18 (2013) 153e161. [8] A.P. Halestrap, R.M. Denton, Hormonal regulation of adipose-tissue acetylCoenzyme A carboxylase by changes in the polymeric state of the enzyme. The role of long-chain fatty acyl-Coenzyme A thioesters and citrate, Biochem. J. 142 (1974) 365e377. [9] S. Herzig, E. Raemy, S. Montessuit, J.L. Veuthey, N. Zamboni, B. Westermann, E.R. Kunji, J.C. Martinou, Identification and functional expression of the mitochondrial pyruvate carrier, Science 337 (2012) 93e96. [10] D.K. Bricker, E.B. Taylor, J.C. Schell, T. Orsak, A. Boutron, Y.C. Chen, J.E. Cox, C.M. Cardon, J.G. Van Vranken, N. Dephoure, C. Redin, S. Boudina, S.P. Gygi, M. Brivet, C.S. Thummel, J. Rutter, A mitochondrial pyruvate carrier required for pyruvate uptake in yeast, Drosophila, and humans, Science 337 (2012) 96e100. [11] A.S. Divakaruni, S.E. Wiley, G.W. Rogers, A.Y. Andreyev, S. Petrosyan, M. Loviscach, E.A. Wall, N. Yadava, A.P. Heuck, D.A. Ferrick, R.R. Henry, W.G. McDonald, J.R. Colca, M.I. Simon, T.P. Ciaraldi, A.N. Murphy,
[17]
[18]
[19]
[20] [21]
[22]
[23]
[24]
[25]
[26]
Thiazolidinediones are acute, specific inhibitors of the mitochondrial pyruvate carrier, Proc. Natl. Acad. Sci. U. S. A. 110 (2013) 5422e5427. J. Du, W.M. Cleghorn, L. Contreras, K. Lindsay, A.M. Rountree, A.O. Chertov, S.J. Turner, A. Sahaboglu, J. Linton, M. Sadilek, J. Satrustegui, I.R. Sweet, F. Paquet-Durand, J.B. Hurley, Inhibition of mitochondrial pyruvate transport by zaprinast causes massive accumulation of aspartate at the expense of glutamate in the retina, J. Biol. Chem. 288 (2013) 36129e36140. A. Elhammali, J.E. Ippolito, L. Collins, J. Crowley, J. Marasa, D. Piwnica-Worms, A high-throughput fluorimetric assay for 2-hydroxyglutarate identifies Zaprinast as a glutaminase inhibitor, Cancer Discov. 4 (2014) 828e839. P.A. Vigueira, K.S. McCommis, G.G. Schweitzer, M.S. Remedi, K.T. Chambers, X. Fu, W.G. McDonald, S.L. Cole, J.R. Colca, R.F. Kletzien, Mitochondrial pyruvate carrier 2 hypomorphism in mice leads to defects in glucose-stimulated insulin secretion, Cell Rep. 7 (2014) 2042e2053. J.N. Patterson, K. Cousteils, J.W. Lou, J.E.M. Fox, P.E. MacDonald, J.W. Joseph, Mitochondrial metabolism of pyruvate is essential for regulating glucosestimulated insulin secretion, J. Biol. Chem. 289 (2014) 13335e13346. L.R. Gray, M.R. Sultana, A.J. Rauckhorst, L. Oonthonpan, S.C. Tompkins, A. Sharma, X. Fu, R. Miao, A.D. Pewa, K.S. Brown, E.E. Lane, A. Dohlman, D. Zepeda-Orozco, J. Xie, J. Rutter, A.W. Norris, J.E. Cox, S.C. Burgess, M.J. Potthoff, E.B. Taylor, Hepatic mitochondrial pyruvate carrier 1 is required for efficient regulation of gluconeogenesis and whole-body glucose homeostasis, Cell Metab. 22 (2015) 669e681. K.S. McCommis, Z. Chen, X. Fu, W.G. McDonald, J.R. Colca, R.F. Kletzien, S.C. Burgess, B.N. Finck, Loss of mitochondrial pyruvate carrier 2 in the liver leads to defects in gluconeogenesis and compensation via pyruvate-alanine cycling, Cell Metab. 22 (2015) 682e694. B. Vanderperre, S. Herzig, P. Krznar, M. Horl, Z. Ammar, S. Montessuit, S. Pierredon, N. Zamboni, J.C. Martinou, Embryonic lethality of mitochondrial pyruvate carrier 1 deficient mouse can Be rescued by a ketogenic diet, PLoS Genet. 12 (2016) e1006056. Z. Tu, W. Yang, S. Yan, X. Guo, X.J. Li, CRISPR/Cas9: a powerful genetic engineering tool for establishing large animal models of neurodegenerative diseases, Mol. Neurodegener. 10 (2015) 35. K. Bayne, Revised guide for the care and use of laboratory animals available. American physiological society, Physiologist 39 (1996) 199e208. Y. Sheng, S. Zheng, T. Ma, C. Zhang, X. Ou, X. He, W. Xu, K. Huang, Mulberry leaf alleviates streptozotocin-induced diabetic rats by attenuating NEFA signaling and modulating intestinal microflora, Sci. Rep. 7 (2017) 12041. X. Li, Y. Li, G. Han, Y. Ji, Z. Fan, Y. Zhong, J. Cao, J. Zhao, G. Mariusz, M. Zhang, J. Wen, J.M. Nesland, Z. Suo, Establishment of mitochondrial pyruvate carrier 1 (MPC1) gene knockout mice with preliminary gene function analyses, Oncotarget 7 (2016) 79981e79994. P.M. Marvyn, R.M. Bradley, E.B. Mardian, K.A. Marks, R.E. Duncan, Data on oxygen consumption rate, respiratory exchange ratio, and movement in C57BL/6J female mice on the third day of consuming a high-fat diet, Data Brief. 7 (2016) 472e475. R. Aguirre-Gamboa, H. Gomez-Rueda, E. Martinez-Ledesma, A. MartinezTorteya, R. Chacolla-Huaringa, A. Rodriguez-Barrientos, J.G. Tamez-Pena, V. Trevino, SurvExpress: an online biomarker validation tool and database for cancer gene expression data using survival analysis, PLoS One 8 (2013) e74250. J.C. Schell, K.A. Olson, L. Jiang, A.J. Hawkins, J.G. Van Vranken, J. Xie, R.A. Egnatchik, E.G. Earl, R.J. DeBerardinis, J. Rutter, A role for the mitochondrial pyruvate carrier as a repressor of the Warburg effect and colon cancer cell growth, Mol. Cell 56 (2014) 400e413. N.M. Vacanti, A.S. Divakaruni, C.R. Green, S.J. Parker, R.R. Henry, T.P. Ciaraldi, A.N. Murphy, C.M. Metallo, Regulation of substrate utilization by the mitochondrial pyruvate carrier, Mol. Cell 56 (2014) 425e435.
Please cite this article in press as: S. Zou, et al., Fatty acid oxidation alleviates the energy deficiency caused by the loss of MPC1 in MPC1þ/ mice, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.11.134
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Fatty acid oxidation alleviates the energy deficiency caused by the loss of MPC1 in MPC1þ/ mice Shiying Zou a, b, Tianqi Lang a, b, Boyang Zhang a, b, Kunlun Huang a, b, Lijing Gong c, Haosu Luo d, Wentao Xu a, b, Xiaoyun He a, b, * a Beijing Advanced Innovation Center for Food Nutrition and Human Health, College of Food Science & Nutritional Engineering, China Agricultural University, Beijing 100083, China b Beijing Laboratory for Food Quality and Safety, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing, China c China Academy of Sport and Health Sciences, Beijing Sport University, 100084 Beijing, China d College of Biological Sciences, China Agricultural University, 100083 Beijing, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 November 2017 Accepted 20 November 2017 Available online xxx
Pyruvate is a central substrate in energy metabolism, paramount to carbohydrate, fat, and amino acid catabolic and anabolic pathways. Mitochondrial pyruvate carrier 1(MPC1) is one important component of the complex that facilitates mitochondrial pyruvate import. Complete MPC1 deficiency is a serious concern, and has been shown to result in embryonic lethality in mice. The study outlined in this paper generated one mouse line with the MPC1 protein part deficiency by using the CRISPR/Cas9 system. Clinical observations, body weight and organ/tissue weight, gas exchange, cold-stimulation, blood parameters, as well as histopathology analysis were analyzed to evaluate potential physiological abnormalities caused by MPC1 deficiency. Results indicate that MPC1þ/ mice experienced a change in important clinical criteria such as low body weight, decreased movement, and low body shell temperature, few adipose accumulate. The mice show significant difference in some blood parameters including apo-B100, apo-A1, HDL, glucagon, insulin. However these changes alleviated while being fed with the HFD, which provided metabolites to sustain the TCA cycle and body development. The MPC1þ/ mice may employ fatty acid oxidation to meet their bioenergetic demands. This study suggests that inhibition of MPC1 activity can boost fatty acid oxidation to provide sufficient energy to the body. This work promotes further studies regarding the interplay between carbohydrate and fat metabolism. © 2017 Published by Elsevier Inc.
Keywords: Mitochondrial pyruvate carrier 1 Pyruvate Knockdown Phenotype
1. Introduction Pyruvate lies at a central biochemical node which connects carbohydrate, amino acid, and fatty acid metabolism. It also possesses the ability to balance glycolysis and oxidative phosphorylation, as well as to stabilize catabolic and anabolic metabolism [1]. Pyruvate is the end product of glycolysis, and a critical cellular metabolite, as well. Pyruvate can be transported into mitochondria and oxidized by pyruvate dehydrogenase comples (PDH) to enter the TCA cycle. More than 30 ATP molecules per molecule of glucose can be produced inside mitochondria. However, if the pyruvate goes into the glycolysis pathway, only two molecules of ATP will be
* Corresponding author. College of Food Science and Nutritional Engineering, China Agricultural University, No. 17 Tsinghua Donglu, Beijing 100083, China. E-mail address: [email protected] (X. He).
produced. ATP production has a major role in the overall metabolism of the cell [2]. Dysregulation of these processes contributes to the pathogenesis of numerous diseases, including diabetes and obesity [3,4], mitochondrial disorders [5], cardiac failure [3], neurodegenerative disorders [6], and cancer [7]. Therefore, a better understanding of how pyruvate fluxes into mitochondria and how to influence the substrate utilization may have therapeutic potential by directly or indirectly influencing glucose, lipid, and amino acid homeostasis. Although the existence of a MPC in the mitochondrial inner membrane has been known for many years [8], it has only recently been identified at the molecular level. The gene, renamed MPC1 and MPC2, encodes the multimeric mitochondrial pyruvate carrier(MPC) complex embedded in the inner mitochondrial membrane [9,10]. In some research, the MPCs have emerged as an unanticipated target of thiazolidinediones and a regular of insulin secretion, suggesting the MPCs play an important role in substrate
https://doi.org/10.1016/j.bbrc.2017.11.134 0006-291X/© 2017 Published by Elsevier Inc.
Please cite this article in press as: S. Zou, et al., Fatty acid oxidation alleviates the energy deficiency caused by the loss of MPC1 in MPC1þ/ mice, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.11.134
2
S. Zou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
selection and metabolic signaling [11]. Du and Elhammali et al. showed the phosphodiesterase inhibitor, Zaprinast, can alter aspartate and glutamate metabolism via the MPC and glutaminase [12,13]. Several mouse models which explore MPC deficiency have been reported, including MPC2 hypomorphic allele [14], acute MPC inhibition by UK5099 [15], and liver-specific knock-outs of MPC1 or MPC2 [16,17]. These studies demonstrate the important role MPCs have in regulating whole-body glucose homeostasis. Benoit et al. generated a whole-body knock-out of the MPC1 gene, which resulted in embryonic lethality at around E13.5, a period when robust mitochondrial biogenesis takes place. During an in vitro study, the mouse embryonic fibroblasts (MEFs) derived from this MPC1 model mice displayed defective pyruvate-driven respiration as well as perturbed metabolic profiles, both defects could be restored by reexpression of MPC1 [18]. Previously, there was no animal model of MPC1 whole body knock-outs. 2. Material and methods 2.1. One MPC1þ/ mice model There is limited knowledge of MPC function, but models that focus on gene knockout or knockdown in vivo may help increase understanding. Such research may also help scientists to better understand metabolic diseases. To investigate how metabolism is reprogrammed in response to MPC inhibition in vertebrates, we created a mice model with an MPC1 protein deficiency. We deleted part of the gene sequence (GCAAAGCGGCGGACTATGTCCGG) of MPC1(NCBI, NM_018819) in C57BL/6 mice by utilizing the Clustered Regularly Interspaced Short Palindromic Repeats/CRISPRassociated 9 system(CRISPR/Cas9) [19]. All experimental procedures were performed according to guidelines provided by the animal welfare act and animal welfare ordinance. The animal experiment and housing procedures were carried out in compliance with the OECD Good Laboratory Practice guidelines. This animal study was approved by the Animal Experimental Welfare & Ethical Inspection Committee (No.2015105), the Supervision & Testing Center for GMO Food Safety, Ministry of Agriculture (Beijing, China). Animals were cared for according to the Guide for the Care and Use of Laboratory Animals [20], and the attendant committees approved all protocols utilized. 2.2. Body weight of MPC1þ/ mice within 24 weeks Six male MPC1þ/ mice and six male WT mice were fed for 24 weeks with water and food ad libitum. They were entered into the experiment after weaning(5 weeks) with 6 mice in one group. 3 mice were fed in one cage. Body weights and food intake were recorded weekly and clinical behavior was observed daily. Blood samples were collected at 12 weeks. At the same time, 6 male MPC1þ/ mice and 6 male WT C57BL/6 mice were fed for 24 weeks with High-fat diet (product dataD12492, 60% calories provided by fat, 20% calories provided by carbohydrate and 20% calories provided by protein). Blood samples were collected at 12 weeks. 2.3. Blood samples collection and parameters test Orbital sinus blood samples were taken from the mice at 12 weeks old, and centrifuged at 4000g for 10 min after 12-hr fasting. Plasma was stored at 80 C for further analysis. Aspartic transaminase (AST), lactate dehydrogenase (LDH), triglycerides(TG), total cholesterol(CHO), alanine aminotransferase(ALT), apolipoprotein B100(apo-B100 0), apolipoprotein A1(apo-A1),
apolipoprotein E(apo-E), apolipoprotein H (apo-H), High-density lipoprotein(HDL), Low-density lipoprotein(LDL), b-hydroxybutyrate(b-HB), Epinephrine(EPI), Glucagon(GC), insulin(INS) and Norepinephrine (NE) were tested using the ELISA kit (Beijing Fangchengjiahong Technology Co Ltd).
2.4. Gas exchange In quite condition: Six male MPC1þ/ mice and 6 male WT mice were chosen in this study. Rectal temperature was taken in each mouse, and energy expenditure was also tested. The animals were housed one mouse per cage with food and water ad libitum. Oxygen consumption and activity were measured for 24 h after 24 h of acclimation using an oxylet system with 4-cages (Panlab; OXYLET). In exercise: Mice were tested during exercise in order to track energy expenditure. The RER was measured using a 4-chamber calorimeter (Oxymax serious; Columbus Instrument) with airflow of 0.6 L/min. Before experimental testing, mice were subjected to a 3-day exercise familiarization protocol that consisted of progressively increasing the intensity and duration of treadmill running. Mice were fasted for 4-hr prior to running. Initially, the mice were running at 5 m/min for 3 min. The velocity was increased by 5 m/ min every 3 min until 60 m/min. The respiratory exchange ratio (RER ¼ VCO2/VO2) was calculated using software provided by the manufacturer.
2.5. Cold-stimulation The mice were placed in a cold room(4 C) for 4 h. Subsequently, cold-inducted thermogenesis was evaluated by taking photos using a handheld infrared camera (FLIR T600, FLIR systems, Oregon, USA). Body weights and blood glucose were measured together.
2.6. ITT, GTT, PTT Twelve male MPC1þ/ mice and 12 male WT C57BL/6 mice were chosen for the GTT, ITT, PTT. Dosages, unless otherwise stated, were based on body weight, prepared in sterile water, and administered intraperitoneally: 4-hr fast with 1.0U/kg insulin(Humulin R; Novo Nordisk) for insulin tolerance test(ITT); 12-hr fast with 2.0 g/kg glucose(Sigma,USA) for glucose tolerance test(GTT); 12-hr fast with 1.5 g/kg pyruvate(Sigma,USA) for pyruvate tolerance test(PTT). Blood glucoses were measured using commercially available kits and regents according to the manufacturer's direction (ACCU-CHEK per forma, Roche, USA) [21].
2.7. Tissue staining and histopathology After 24 weeks of study, all mice were sacrificed for research. Many tissues underwent general histopathological examination, including brain, heart, liver, spleen, lung, kidney, adrenal gland, testis, epididymis, white adipose tissue (WAT), and brown adipose tissue(BAT). All tissues were weighed. Liver and adipose samples were made into pathological slices with Oil Red O staining to assess adipose accumulation.
2.8. Statistical analysis All experiment data were shown as mean ± SD. Data were analyzed by Student's T-test using EXCEL software. Results were considered to be statistically significant at P < 0.05.
Please cite this article in press as: S. Zou, et al., Fatty acid oxidation alleviates the energy deficiency caused by the loss of MPC1 in MPC1þ/ mice, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.11.134
S. Zou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
3. Results 3.1. One MPC1þ/ mice was generated and this phenotype can pass on to the offspring The study produced a mice model with MPC1 gene heterozygous knockdown. Stable knockdown was confirmed at gene and protein levels; knockdown could be consistently maintained in offspring (Fig. 1A and B). The knockdown mice appeared outwardly normal, showing no growth defects in appearance. Food intake was also normal and all mice were fully viable and fertile. There were no effects on reproductive capacity (data were not shown). 3.2. The MPC1þ/ mice show lower body weight compared to the WT mice MPC1þ/ mice display no differences in body composition, food and water intake, or voluntary physical activity, suggesting the absence of any global physiological defect. Otherwise, MPC1þ/ mice display lower body weight compared with the WT mice (Fig. 1C), with body weights significantly decreased (p < 0.05) most notably in weeks 4e7, as well as weeks 9, 10, 14, 15, 17, 19, 21, 22, and 23. 3.3. The MPC1þ/ mice display with disordered glucose and fat management Research indicates that MPC1 knockdown has some effect on glucose and insulin secretion [16]. The insulin, glucagon, apo-B100 and apo-A1 (Fig. 1D,E,G,H) were all significantly increased in MPC1þ/ mice compared with the WT mice. The HDL (Fig. 1 F) was significantly decreased. The increase of apo-B100 and apo-A1 may help increase fat molecule transport around the body. The insulin and glucagon were all significant increased(p < 0.05) in MPC1þ/ mice. The disorder of the pancreas islet was responsible for the increase of insulin and glucagon. AST, ALT, and TG were all significantly increased in MPC1þ/ mice (Fig. 1I). The AST/ALT ratios were unchanged (data were not shown), suggesting the absence of liver damage in MPC1þ/ mice. Triglycerides were slightly increased. When the body requires fatty acids as an energy source, glucagon signals the breakdown of triglycerides by hormone-sensitive lipase to release free fatty acids. The increased ALT and AST may increase the concentration of a-ketoglutaric acid. This phenomenon was consistent with other research [22]. 3.4. Energy was derived mainly from fat rather than glucose during exercise in MPC1þ/ mice To investigate changes in gross metabolism, we measured gas exchange both in quite and exercise condition. The oxymax system is an open-circuit indirect calorimeter for lab animal research. The oxymax system measures oxygen consumption (VO2), respiratory exchange ratio (RER), and activity levels of mice. VO2 is a measure of the volume of oxygen used to convert energy substrate into ATP. RER is a ratio of VCO2 divided by VO2, and can be used to estimate the fuel source for energy production. An RER of 0.7 indicates that fatty acids are the primary substrate for oxidative metabolism, while an RER of 1.0 indicates that carbohydrates are the primary energy substrate [23]. ATP linked respiration only changed when all pyruvate transport, glutamine, and fatty acid oxidation were inhibited. No difference in VO2 exchange was observed between MPC1þ/ mice and WT mice when rectal temperature and energy expenditure were analyzed (Fig. 2A and B). MPC1þ/ mice were less active compared to the WT mice, regardless of day and night (Fig. 2C and D). At night,
3
activity was especially decreased (P < 0.05). The MPC1þ/ mice exhibited a global energy defect, which required them to decrease their energy consumption by also decreasing movement. The MPC1þ/ mice manifested a decreased respiratory exchange ratio (RER) during exercise(p < 0.01) (Fig. 2 H). During exercise, energy was derived mainly from fat rather than glucose [23]. The lack of MPC1 protein perturbed mouse respiratory and metabolic profiles during exercise. 3.5. The MPC1þ/ mice displayed low shell temperature in coldstimulation study No significant differences were observed in body weight or blood glucose, while shell temperature was lower in MPC1þ/ mice compared to WT mice (Fig. 2 E). 3.6. The MPC1þ/ mice showed some difficulty in the utilization of pyruvate Results demonstrate that MPC1þ/ mice show no difference in the GTT and ITT (Fig. 2 I and J). In PTT, the blood glucose of MPC1þ/ at 30min and 60min were significant lower than WT mice (Fig. 2 K). Sampled from the MPC1þ/ mice showed some difficulty in the utilization of pyruvate, consistent with impaired pyruvate-driven gluconeogenesis. Although fasting blood glucose levels of MPC1þ/ mice in ITT tended to be decreased, they were all within normal ranges. 3.7. The MPC1þ/ mice showed low tissue weight and less adipose accumulation The ratios of spleen, lung, and thymus were significantly increased in MPC1þ/ mice (Fig. 3A and B). This may be related to inflammation. When the body tries to cope with a metabolic disorder for a prolonged period of time, all systems may be in an antiinflammatory state. The weight and ratio of WAT and BAT were significantly decreased in MPC1þ/ mice(p < 0.05) (Fig. 3A and B). For the deficiency of MPC1 protein, energy supplied by glucose was limited. The body would produce more ATP by steatolysis, the consumption of fatty acids in the body results in weight changes in BAT and WAT. As shown in our research, the MPC1þ/ mice have lower body weight than WT mice. There were no histopathology changes in the brain, heart, liver, spleen, lung, kidney, adrenal gland, testis, or epididymis. The Oil Red O staining showed the fatty droplets in liver were less prevalent in MPC1þ/ mice(Fig. 3C and D,E,F). The MPC1þ/ mice displayed an energy accumulation deficiency. 3.8. The disorder condition can be reversed by given high-fat diet in MPC1þ/ mice The MPC1þ/ mice showed evidence of disorder in their blood parameters, but strikingly, these changes were reversed partly when the MPC1þ/ mice were fed a high fat diet (Fig. 3G and H,I,J,K). The high fat diet provides metabolites for growth and metabolism. As shown in Fig. 3, apo-B100, apo-A1, and HDL, combined with glucagon and insulin, showed no difference in mice who were fed with HFD. The HFD normalized the parameters and bypassed the need for a functional MPC1. 4. Discussion Pyruvate sustains gluconegenesis and supports mitochondrial metabolism because it can be converted to oxaloacetate or acetylCoA by a single reaction. These two intermediates are required to
Please cite this article in press as: S. Zou, et al., Fatty acid oxidation alleviates the energy deficiency caused by the loss of MPC1 in MPC1þ/ mice, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.11.134
Fig. 1. MPC1þ/ mice model and blood parameters changes. A:The MPC1þ/ mice were confirmed at gene level; B: The MPC1þ/ mice were confirmed at protein level; C: The mice body weight within 24wks fed with standard diet; D: the apo-B100 level of wild type and MPC1þ/ mice; E: the apo-A1 level; F:the HDL level; G: the glucagon level; H:the Insulin level; I: the results of AST, TG and ALT, the concentration of AST and ALT is ng/mL, the concentration of TG is mmol/L.**P < 0.01; *P < 0.05.
Fig. 2. Gas exchanges and the results of ITT, GTT, PTT. A: the VO2 of MPC1þ/ mice and WT mice at day; B:the VO2 at night; C: the movement of mice during the light phase; D: the movement of mice during the dark phase; E: the thermography of MPC1þ/ mice and WT mice; G: the velocity of exercise test; H: the RER of WT and MPC1þ/ mice in exercise test; I: the GTT results; J:the ITT results; K: the PTT results.*P < 0.05, **P < 0.01.
Please cite this article in press as: S. Zou, et al., Fatty acid oxidation alleviates the energy deficiency caused by the loss of MPC1 in MPC1þ/ mice, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.11.134
S. Zou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
sustain the TCA cycle flux. The MPCs contain two distinct proteins, MPC1 and MPC2, these two proteins construct one complex, and the absence of either leads to disorder of mitochondrial pyruvate uptake and utilization in yeast and mammalian cells. Epidemiological investigation makes clear that the MPC1 protein was deleted or underexpressed in multiple cancers including colon, kidney, lung, bladder and brain, and increases the likelihood of death [24]. MPC1 may be inactive in cancer and tumors; the Warburg effect may be associated with decreased pyruvate oxidation [24,25]. This research sought to explore how metabolism was sustained when MPC1 or MPC2 was deficient. Studies indicate that when MPC activity decreases, regulated increases in gluconeogenesis during fasting are most efficiently supplied by glutaminolysis [16]. Gray et al. and McCommis et al. show that the live-specific loss of MPC1 activity impairs pyruvate-driven gluconeogenesis. Euglycemia is maintained by adaptive utilization of glutamine and increased urea, as well as pyruvate-alanine cycle activities [16]. Li et al. examined one line of MPC1 knockout mice and concluded that the heterozygous MPC1 knockout weakens fertility and influences the metabolism of glucose, fatty acids, and body weight in mice [22]. In this mice model, MPC activity was inhibited and the biosynthetic metabolism was shifted from glucose to amino acid and fatty acid oxidation, all without myoblasts proliferating. The TCA cycle was maintained through increased glutamine anaplerosis and oxidation, malic enzyme flux, and fatty acid oxidation [22]. Some research shows MPC inhibition would likely diminish the pool of intramitochondrial citrate, potentially reducing its effuse and, in turn, lipogenesis [11,26]. Vacanti et al. aimed to research the role of the MPC in substrate regulation. They found that despite profound suppression of both glucose and pyruvate oxidation, cell growth, oxygen consumption, and TCA cycle were surprisingly maintained
5
[26]. TCA metabolism was achieved through increased reliance on glutaminolysis through malic enzyme and pyruvate dehydrogenase(PDH), as well as fatty acid and branched chain amino acid(BACCs) oxidation [26]. They observed that MPC1 knockdown in A549 cells exhibited an increased reliance on fatty acid oxidation to fuel TCA cycle metabolism [26]. The aim of this study was to gain a more robust understanding of the physiological role of MPC1 in regulating metabolic homeostasis in vertebrates. This study developed one MPC1 knock-down mice model. The MPC1þ/ mice displayed rescued energy deficit and disordered glucose regulation. When there was an energy deficit, the MPC1þ/ mice showed low body weight, less body movement, lower shell temperature, lower RER in exercise test, less WAT and BAT weight, and fewer fat droplets accumulated in the MPC1þ/ mice liver compared to the WT mice. MPC1þ/ mice displayed gross changes in the plasma parameters but maintained fasting euglycemia. The MPC1þ/ mice transported fewer pyruvate to the mitochondria, and the deficiency of MPC1 also impaired the RER where mitochondria did not supply enough pyruvate to the TCA cycle. Energy may have been provided by fatty acid oxidation was not significantly enhanced in MPC1þ/ mice compared to controls, resulting in lower body weight and fat mass. These results strongly suggest that, although mitochondrial pyruvate transport plays an important role in gluconeogenesis, the deficiency of MPC1 can be circumvented by an increased dependence on the oxidation of fatty acid. ATP linked respiration was only affected when all three pathways, including pyruvate transport and glutamine and fatty acid oxidation, were inhibited. The MPC1þ/ mice potentially employ fatty acid oxidation to meet their bioenergetic demands. The MPC1þ/ mice did not show a similar increase in parameters when fed with the HFD. However, the HFD provided some
Fig. 3. Tissue staining and blood parameter changes after fed with HFD. A: the organ weight. B: the organ/body weight ratio; C and D: the Oil Red O staining liver of WT mice; E and F: staining liver of MPC1þ/ mice; G: the apo-B100 level of WT and MPC1þ/ mice fed with HFD; H: the apo-A1 level with HFD; I: the glucagon level with HFD; J: the HDL level with HFD; K: the Insulin level with HFD. S: spleen; T: thymus; W: WAT; B: BAT; L: lung. *P < 0.05, **P < 0.01.
Please cite this article in press as: S. Zou, et al., Fatty acid oxidation alleviates the energy deficiency caused by the loss of MPC1 in MPC1þ/ mice, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.11.134
6
S. Zou et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
metabolites to sustain the TCA cycle and body development. Our model suggests that inhibition of MPC1 activity can boost fatty acid oxidation to provide enough energy to the body, a finding which may provide a research approach for further studies of the interplay between carbohydrate and fat metabolism.
[12]
[13]
Acknowledgement This work was supported by grants from the Genetically Modified Organisms Breeding Major Projects of P.R.China (2016ZX08011005). S.Z. wrote the main manuscript. S.Y. and X.H. designed the study. H.L. designed the animal model. T.L. and L.G. performed the animal trial. X.H. and S.Z. analyzed the data. K.H. and W.X. final approve of the manuscript. All authors reviewed the manuscript.
[14]
[15]
[16]
Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2017.11.134. References [1] T. Bender, J.C. Martinou, The mitochondrial pyruvate carrier in health and disease: to carry or not to carry? Biochim. Biophys. Acta 1863 (10) (2016) 2436e2442. [2] L.R. Gray, S.C. Tompkins, E.B. Taylor, Regulation of pyruvate metabolism and human disease, Cell Mol. Life Sci. 71 (2014) 2577e2604. [3] R.A. DeFronzo, D. Tripathy, Skeletal muscle insulin resistance is the primary defect in type 2 diabetes, Diabetes Care 32 (Suppl 2) (2009) S157eS163. [4] M.C. Sugden, M.G. Zariwala, M.J. Holness, PPARs and the orchestration of metabolic fuel selection, Pharmacol. Res. 60 (2009) 141e150. [5] D.S. Kerr, Review of clinical trials for mitochondrial disorders: 1997-2012, Neurotherapeutics 10 (2013) 307e319. [6] S. Cunnane, S. Nugent, M. Roy, A. Courchesne-Loyer, E. Croteau, S. Tremblay, A. Castellano, F. Pifferi, C. Bocti, N. Paquet, H. Begdouri, M. Bentourkia, E. Turcotte, M. Allard, P. Barberger-Gateau, T. Fulop, S.I. Rapoport, Brain fuel metabolism, aging, and Alzheimer's disease, Nutrition 27 (2011) 3e20. [7] E. Currie, A. Schulze, R. Zechner, T.C. Walther, R.V. Farese Jr., Cellular fatty acid metabolism and cancer, Cell Metab. 18 (2013) 153e161. [8] A.P. Halestrap, R.M. Denton, Hormonal regulation of adipose-tissue acetylCoenzyme A carboxylase by changes in the polymeric state of the enzyme. The role of long-chain fatty acyl-Coenzyme A thioesters and citrate, Biochem. J. 142 (1974) 365e377. [9] S. Herzig, E. Raemy, S. Montessuit, J.L. Veuthey, N. Zamboni, B. Westermann, E.R. Kunji, J.C. Martinou, Identification and functional expression of the mitochondrial pyruvate carrier, Science 337 (2012) 93e96. [10] D.K. Bricker, E.B. Taylor, J.C. Schell, T. Orsak, A. Boutron, Y.C. Chen, J.E. Cox, C.M. Cardon, J.G. Van Vranken, N. Dephoure, C. Redin, S. Boudina, S.P. Gygi, M. Brivet, C.S. Thummel, J. Rutter, A mitochondrial pyruvate carrier required for pyruvate uptake in yeast, Drosophila, and humans, Science 337 (2012) 96e100. [11] A.S. Divakaruni, S.E. Wiley, G.W. Rogers, A.Y. Andreyev, S. Petrosyan, M. Loviscach, E.A. Wall, N. Yadava, A.P. Heuck, D.A. Ferrick, R.R. Henry, W.G. McDonald, J.R. Colca, M.I. Simon, T.P. Ciaraldi, A.N. Murphy,
[17]
[18]
[19]
[20] [21]
[22]
[23]
[24]
[25]
[26]
Thiazolidinediones are acute, specific inhibitors of the mitochondrial pyruvate carrier, Proc. Natl. Acad. Sci. U. S. A. 110 (2013) 5422e5427. J. Du, W.M. Cleghorn, L. Contreras, K. Lindsay, A.M. Rountree, A.O. Chertov, S.J. Turner, A. Sahaboglu, J. Linton, M. Sadilek, J. Satrustegui, I.R. Sweet, F. Paquet-Durand, J.B. Hurley, Inhibition of mitochondrial pyruvate transport by zaprinast causes massive accumulation of aspartate at the expense of glutamate in the retina, J. Biol. Chem. 288 (2013) 36129e36140. A. Elhammali, J.E. Ippolito, L. Collins, J. Crowley, J. Marasa, D. Piwnica-Worms, A high-throughput fluorimetric assay for 2-hydroxyglutarate identifies Zaprinast as a glutaminase inhibitor, Cancer Discov. 4 (2014) 828e839. P.A. Vigueira, K.S. McCommis, G.G. Schweitzer, M.S. Remedi, K.T. Chambers, X. Fu, W.G. McDonald, S.L. Cole, J.R. Colca, R.F. Kletzien, Mitochondrial pyruvate carrier 2 hypomorphism in mice leads to defects in glucose-stimulated insulin secretion, Cell Rep. 7 (2014) 2042e2053. J.N. Patterson, K. Cousteils, J.W. Lou, J.E.M. Fox, P.E. MacDonald, J.W. Joseph, Mitochondrial metabolism of pyruvate is essential for regulating glucosestimulated insulin secretion, J. Biol. Chem. 289 (2014) 13335e13346. L.R. Gray, M.R. Sultana, A.J. Rauckhorst, L. Oonthonpan, S.C. Tompkins, A. Sharma, X. Fu, R. Miao, A.D. Pewa, K.S. Brown, E.E. Lane, A. Dohlman, D. Zepeda-Orozco, J. Xie, J. Rutter, A.W. Norris, J.E. Cox, S.C. Burgess, M.J. Potthoff, E.B. Taylor, Hepatic mitochondrial pyruvate carrier 1 is required for efficient regulation of gluconeogenesis and whole-body glucose homeostasis, Cell Metab. 22 (2015) 669e681. K.S. McCommis, Z. Chen, X. Fu, W.G. McDonald, J.R. Colca, R.F. Kletzien, S.C. Burgess, B.N. Finck, Loss of mitochondrial pyruvate carrier 2 in the liver leads to defects in gluconeogenesis and compensation via pyruvate-alanine cycling, Cell Metab. 22 (2015) 682e694. B. Vanderperre, S. Herzig, P. Krznar, M. Horl, Z. Ammar, S. Montessuit, S. Pierredon, N. Zamboni, J.C. Martinou, Embryonic lethality of mitochondrial pyruvate carrier 1 deficient mouse can Be rescued by a ketogenic diet, PLoS Genet. 12 (2016) e1006056. Z. Tu, W. Yang, S. Yan, X. Guo, X.J. Li, CRISPR/Cas9: a powerful genetic engineering tool for establishing large animal models of neurodegenerative diseases, Mol. Neurodegener. 10 (2015) 35. K. Bayne, Revised guide for the care and use of laboratory animals available. American physiological society, Physiologist 39 (1996) 199e208. Y. Sheng, S. Zheng, T. Ma, C. Zhang, X. Ou, X. He, W. Xu, K. Huang, Mulberry leaf alleviates streptozotocin-induced diabetic rats by attenuating NEFA signaling and modulating intestinal microflora, Sci. Rep. 7 (2017) 12041. X. Li, Y. Li, G. Han, Y. Ji, Z. Fan, Y. Zhong, J. Cao, J. Zhao, G. Mariusz, M. Zhang, J. Wen, J.M. Nesland, Z. Suo, Establishment of mitochondrial pyruvate carrier 1 (MPC1) gene knockout mice with preliminary gene function analyses, Oncotarget 7 (2016) 79981e79994. P.M. Marvyn, R.M. Bradley, E.B. Mardian, K.A. Marks, R.E. Duncan, Data on oxygen consumption rate, respiratory exchange ratio, and movement in C57BL/6J female mice on the third day of consuming a high-fat diet, Data Brief. 7 (2016) 472e475. R. Aguirre-Gamboa, H. Gomez-Rueda, E. Martinez-Ledesma, A. MartinezTorteya, R. Chacolla-Huaringa, A. Rodriguez-Barrientos, J.G. Tamez-Pena, V. Trevino, SurvExpress: an online biomarker validation tool and database for cancer gene expression data using survival analysis, PLoS One 8 (2013) e74250. J.C. Schell, K.A. Olson, L. Jiang, A.J. Hawkins, J.G. Van Vranken, J. Xie, R.A. Egnatchik, E.G. Earl, R.J. DeBerardinis, J. Rutter, A role for the mitochondrial pyruvate carrier as a repressor of the Warburg effect and colon cancer cell growth, Mol. Cell 56 (2014) 400e413. N.M. Vacanti, A.S. Divakaruni, C.R. Green, S.J. Parker, R.R. Henry, T.P. Ciaraldi, A.N. Murphy, C.M. Metallo, Regulation of substrate utilization by the mitochondrial pyruvate carrier, Mol. Cell 56 (2014) 425e435.
Please cite this article in press as: S. Zou, et al., Fatty acid oxidation alleviates the energy deficiency caused by the loss of MPC1 in MPC1þ/ mice, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.11.134