- Email: [email protected]
FcγRIIa polymorphism and clinical response to rituximab in non-Hodgkin lymphoma patients
Cancer Genetics and Cytogenetics 183 (2008) 35e40
FcgRIIa polymorphism and clinical response to rituximab in non-Hodgkin lymphoma patients ˆ ngelo Martinsb, Paula Ferreirac, Ma´rcia Paivaa, Herlander Marquesb, A Raquel Catarinoc, Rui Medeirosd,* a
Unit of Molecular Oncology, Laborato´rios piso 4, Instituto Portugueˆs de Oncologia, R. Dr. Ant. Bernardino Almeida, 4200-072 Porto, Portugal; Pharmaceutical Services, Oncology Unit, Hospital de S. Joa˜o, Alameda Prof. Hernaˆni Monteiro, 4200-319, Porto, Portugal b Onco-Haematology Department, COV piso 5, Instituto Portugueˆs de Oncologia, R. Dr. Ant. Bernadino Almeida, 4200-072 Porto, Portugal c Unit of Molecular Oncology, Laborato´rios piso 4, Instituto Portugueˆs de Oncologia, R. Dr. Ant. Bernardino Almeida, 4200-072 Porto, Portugal d Unit of Molecular Oncology, Laborato´rios piso 4, Instituto Portugueˆs de Oncologia, R. Dr. Ant. Bernardino Almeida, 4200-072 Porto, Portugal; ICBAS, Abel Salazar Institute for the Biomedical Sciences, Largo Prof. Abel Salazar, 2, 4099-003, Porto, Portugal Received 12 December 2007; received in revised form 28 January 2008; accepted 8 February 2008
Abstract
Rituximab is a chimeric monoclonal antibody that specifically targets the CD20 surface marker expressed in neoplastic B-lymphoid cells. Combined with chemotherapy or alone, in maintenance/ consolidation, it is used for the treatment of non-Hodgkin lymphoma (NHL). The role of a polymorphism in a specific Fc gamma receptor gene, FcgRIIa, in the clinical outcome of patients with NHL was investigated in this study. We characterized DNA samples from 64 non-Hodgkin lymphoma patients treated with rituximab using a polymerase chain reactionerestriction fragment length polymorphism method. The FcgRIIa HH genotype was significantly correlated with complete response to rituximab compared to the R allele (P50.028). In terms of overall or event-free survival, no difference was found according to FcgRIIa alleles. We hypothesize that the HH genotype increases the affinity of the FcgRIIa receptor, not only for naturally occurring IgG2, but also to ameliorate connection with chimeric IgG1 rituximab, contributing to a genetic individual profile of great interest in clinical onco-hematology. Ó 2008 Elsevier Inc. All rights reserved.
1. Introduction Non-Hodgkin lymphoma (NHL) is a heterogeneous group of malignancies of the lymphoid system. The incidence of NHL is increasing worldwide, predominantly in developed countries, affecting more males and older individuals. In Europe, there are 121,200 new cases every year, and NHL is the seventh more frequent cancer, causing approximately 65,200 deaths per year in the European Union [1]. B-cell lymphomas account for approximately 90% of all NHL, and the two most common histologic disease entities are follicular lymphoma and diffuse large B-cell lymphoma [2]. Treatment of these diseases is based on the histology and extent of disease. Lymphomas can be clinically classified as indolent or aggressive, which corresponds broadly to histologic classification of lowand high-grade lymphomas. Mantle cell lymphoma, a histologic low-grade lymphoma, has an aggressive behavior and * Corresponding author. Tel.: þ351-22-5084000 (ext. 5414); fax: þ351-22-5084001. E-mail address: [email protected] (R. Medeiros). 0165-4608/08/$ e see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.cancergencyto.2008.02.001
is usually considered an aggressive lymphoma. Indolent lymphomas have a median survival of up to 10 years; early stages may be treated and ‘‘cured’’ with radiation therapy, and advanced stages are characterized by treatment responses followed by relapses. Aggressive lymphomas have a rapid disease progression, but 30e70% can be cured with combination chemotherapy [2]. Patients with chemoresistant disease or whose disease relapses should be treated with novel therapies [3]. NHL represents an appropriate form of cancer to target with immunotherapeutic modalities. In particular, B-cell lymphomas express a differentiation marker on cell surface designated CD20, which is involved in the regulation of Bcell activation [4]. Rituximab is a chimeric IgG1 monoclonal antibody that specifically recognizes the CD20 marker present in the majority of NHL [5]. It was the first monoclonal antibody approved in oncology and is used nowadays in chemotherapy-resistant or relapsed NHL and in first-line therapy, maintenance/consolidation therapy, or in stem cell transplantation procedures [6]. The mechanism of rituximab action has not been defined clearly. Some authors suggest that it is able to prevent
36
M. Paiva et al. / Cancer Genetics and Cytogenetics 183 (2008) 35e40
chemotherapy failure by having a synergistic activity with chemotherapy [7]. Others postulate three mechanisms for rituximab action, including complement mediated cytotoxicity (CDC), antibody-dependent cellular cytotoxicity (ADCC), and stimulation of apoptosis pathway [8,9]. A rapid elimination of circulating B-cells was observed in vivo in all human disease status in which rituximab has been given in patients with NHL, supporting its clinical effectiveness [10]. There is increasing evidence that the Fc (crystallisable fragment) of the monoclonal antibody rituximab is the major component of its therapeutic activity through binding Fc gamma receptors (FcgR) expressed by effector cells [11]. Polymorphisms in FcgR genes have been associated with anti-tumor efficacy, as this heterogeneous family of receptors plays a critical role in immunity by linking the humoral to the cellular responses [12]. FcgR are expressed on a wide variety of cells, including B lymphocytes, dendritic cells, macrophages, monocytes, natural killer (NK) cells, neutrophils, and mast cells. [12]. The following three classes of FcgR have been described recently: (1) the high-affinity FcgRI, capable of binding monomeric IgG; (2) the low-affinity FcgRII; and (3) FcgRIII, which interact preferentially with complexed IgG [13]. In humans, there are variants of subclasses FcgRIIa and FcgRIIIa (131H/R and 158V/F, respectively) with different affinity to immune complexes resulting from mutations in or near the IgG-binding site [14]. A single-nucleotide polymorphism (SNP) at codon 131 of the FcgRIIa gene encodes either a histidine (H) or an arginine (R). A similar exchange occurs at codon 158 of the FcgRIIIa gene encoding either a valine (V) or a phenylalanine (F) [15]. Pharmacogenomic studies aim to elucidate the genetic bases for interindividual differences and use such genetic information to predict the efficacy, response rate, and safety of a selected drug [16e19]. To date, the prognostic value of FcgR polymorphisms as markers to predict treatment outcome in NHL is still being studied [20e22]. In the present study we analyzed FcgRIIa SNP in the genomic DNA isolated from peripheral blood of patients with NHL who had undergone immunotherapy with rituximab. Our goal was to determine whether there is any correlation between FcgRIIa polymorphisms and clinical features of patients with NHL. 2. Patients and methods The present study involved the genotypic analysis of 64 patients with NHL admitted and treated in the OncoHaematology Department (COV) of the Portuguese Institute of Oncology (Porto, Portugal). The patients were grouped according to clinical behavior of the tumour in two main groups: indolent and aggressive lymphomas. The group containing indolent lymphomas included patients with follicular lymphoma and one with lymphoplasmacytic lymphoma, whereas the group of patients with
aggressive lymphomas included mantle cell lymphoma, diffuse large B-cell lymphoma, and Burkitt lymphoma. The Ann Arbor Staging Classification was used to classify clinical staging [23]. This classification system, combined with age, number of extranodal or nodal sites, Eastern Cooperative Oncology Group (ECOG) classification, lactate dehydrogenase (LDH) levels, and hemoglobin levels, was used to define prognostic groups according to International Prognostic Index (IPI) and Follicular Lymphoma International Prognostic Index (FLIPI) [24,25]. The baseline characteristics of the patients are summarized in Table 1. Overall, among 64 patients, with a median age at diagnosis of 55 years (range 21e83), 31 are female and 33 are male. Thirty-one patients (48.4%) presented indolent NHL and 33 (51.6%) presented aggressive NHL. Follicular lymphoma and diffuse large B-cell lymphoma are the most common histologic entities with 30 (46.8%) and 25 patients (39.1%), respectively, which has also been observed in other population studies. All patients were submitted to immunotherapy with monoclonal antibody rituximab in combination with chemotherapy schemes as CHOP, ESHAP, HCVAD, MINE, TT, DHAP, FC, FND, or alone in maintenance/consolidation from May 1999 to July 2005, in first or subsequent lines. The response to therapeutics with rituximab was evaluated according to physical examination and computed tomography images. Responses were scored according to International Working Group Consensus [26]. 2.1. Genotype analysis Blood samples were obtained with the informed consent of the participants before their inclusion in the study. They were collected in EDTA-containing tubes. DNA was extracted from white blood fraction from each subject by a salting-out procedure [27]. FcgRIIa genotypes were determined on the basis of a polymerase chain reaction (PCR) method adapted from a previously established protocol [28]. The PCR primers for the FcgRIIa gene at loci 131 were 50 GGAAAATCCCAGAAATTCTCGC30 and 50 CAA CAGCCT GACTACCTATTAC GCGGG30 . The amplification was performed in a final volume of 50 mL reaction volume containing 2 mg of genomic DNA, 0.3 mmol/L of each primer, 1 unit Taq DNA polymerase, 1.5 mmol/L MgCl2, and 0.2 mmol/L dNTP. The PCR program consisted of an initial denaturation step at 94 C for 3 minutes, followed by 35 cycles of 94 C for 15 seconds, 55 C for 30 seconds, and 72 C for 40 seconds, and a final elongation step at 72 C for 7 minutes. The PCR products were analyzed on a 2% ethidium bromideestained agarose gel. The restriction fragment length polymorphism (RFLP) study was performed using the restriction enzyme Bsh1236I (Fermentas, Vilnius, Lithuania), according to standard supplier protocols. The digested products were analyzed on a 3.5% ethidium bromideestained agarose gel electrophoresis, and two digested bands of 337 and 316 base pairs
M. Paiva et al. / Cancer Genetics and Cytogenetics 183 (2008) 35e40
37
Table 1 Patients’ characteristics and immunotherapy outcomes Patients’ characteristics Histologic entities (n564) Follicular lymphoma Diffuse large B-cell lymphoma Mantle cell lymphoma Burkitt lymphoma Lymphoplasmacytic lymphoma Clinical staging (n564) IVA IIIA IA IIIB IVB IIA IB IIB Rituximab regimen (n564) R-CHOP R-ESHAP R alone (maintenance/consolidation) R-HCVAD R-MINE R-TT R-DHAP R-FC R-FND Line of treatment (n564) First line Maintenance/consolidation Second line Third line Fourth line Rituximab response (n555) Complete response (CR) Unconfirmed complete response (CRu) Partial response (PR) Stable disease (SD) Progression (P) Maintenance/consolidation (n59) Survival (n564) Alive without cancer Alive with cancer Dead with cancer Dead without cancer Total number of patients
n (%) 30 25 6 2 1
(46.8%) (39.1%) (9.4%) (3.1%) (1.6%)
33 11 6 5 3 3 2 1
(51.6%) (17.2%) (9.4%) (7.8%) (4.7%) (4.7%) (3.1%) (1.5%)
19 18 13 5 4 2 1 1 1
(29.7%) (28.1%) (20.2%) (7.8%) (6.3%) (3.1%) (1.6%) (1.6%) (1.6%)
outcomes were compared using chi-square or Fisher’s exact test. A cut-off P value of 0.05 was adopted for all the statistical analysis. Survival estimates were calculated using the KaplanMeier method. The curves were examined by the log-rank test, a statistical test for equality of survival distributions.
18 7 25 11 3
(28.1%) (10.9%) (39.1%) (17.2%) (4.7%)
Overall response rate was considered as complete response (CR), unconfirmed complete response (CRu), and partial response (PR). All patients who had undergone treatment with rituximab alone in maintenance/consolidation were excluded from response rate analysis (because most of them were already in CR with previous chemotherapy). Overall survival duration was defined as the period of time between the first treatment with rituximab and either death or the last clinical evaluation of the patient. Eventfree survival was defined as the time interval between the beginning of treatment with rituximab (day 1 of the first cycle) and the occurrence of an event (recurrence or death) or the time of the last clinical evaluation of the patient.
27 (49%) 11 (20%) 11 (20%) 3 (5.5%) 3 (5.5%) Not included in response analysis 41 12 10 1 64
(64.1%) (18.8%) (15.6%) (1.5%) (100%)
Abbreviations: R, rituximab; CHOP, cyclophosphamide, doxorubicin, vincristine, and prednisolone; ESHAP, etoposide, methylprednisolone, cytarabine, and cisplatin; HCVAD, cyclophosphamide, dexamethasone, doxorubicin, and vincristine; MINE, mesna, ifosfamide, mitoxantrone, and etoposide; TT, topotecan and paclitaxel; DHAP, dexamethasone, cytarabine, and cisplatin; FC, fludarabine and cyclophosphamide; FND, fludarabine, mitoxantrone, and dexamethasone.
were visualized in an Image Master VDS Pharmacia Biotech (Fig. 1).
Figure 1. Ethidium bromideestained electrophoresis of digested PCRRFLP product samples of FcgRIIa polymorphism: 100ebase pair ladder (lane M); RR genotype (lane 7); HR genotype (lanes 1, 4, 5, and 6) and HH genotype (lanes 2 and 3).
2.3. Definitions
3. Results 3.1. Frequency of FcgRIIa alleles The FcgRIIa polymorphism, according to the amino acid at position 131 of the FcgRIIa protein, can be heterozygote (HR allele) or homozygote (HH or RR alleles). The distribution of HH, HR, and RR alleles in the patients was 11 (17.2%), 34 (53.1%), and 19 (29.7%), respectively, while considering only two groups [HH and R allele (HR/RR)] was 11 (17.2%) and 53 (82.8%). 3.2. Prognostic characteristics of the population
2.2. Statistical analysis Data were analyzed using the computer software SPSS for Windows (version 13.0), and the patients’ treatment
There were no statistically significant differences between the groups of patients with different FcgRIIa genotypes (HH genotype or R allele) regarding prognostic
M. Paiva et al. / Cancer Genetics and Cytogenetics 183 (2008) 35e40
38
Table 2 Patients’ prognostic characteristics according to genotype FcgRIIa (n564) R allele (HR/RR)
HH
n (%)
n (%)
P
Aggressive (n533) Indolent (n531)
27 (81.8%) 26 (83.9%)
6 (18.2%) 5 (16.1%)
0.828
Stage III/IV (n552) Stage I/II (n512)
43 (82.7%) 10 (83.3%)
9 (17.3%) 2 (16.7%)
0.958
ECOG>2 (n52) ECOG!2 (n540)
1 (50.0%) 34 (85.0%)
1 (50.0%) 6 (15.0%)
0.195
LDHO190 (n534) LDH<190 (n527)
28 (82.4%) 22 (81.5%)
6 (17.6%) 5 (18.5%)
0.930
IPI/FLIPI 3e5 (n510) IPI/FLIPI 0e2 (n554)
9 (90.0%) 44 (81.5%)
1 (10.0%) 10 (18.5%)
0.512
Figure 3. Complete response rate in patients according to genotype.
3.4. Survival analysis according to FcgRIIa alleles characteristics as aggressive NHL, stage III/IV, ECOG>2, LDHO190, and IPI/FLIPI 3e5 among the population (PO0,05), as summarized in Table 2.
3.3. Response to rituximab therapy according to FcgRIIa alleles The overall response rate for the 55 evaluable patients (excluding those in maintenance/consolidation) was 89%. The overall response rate for HH genotype was 100% and for R allele was 87% (P50.251; Fig. 2). We found no statistically significant differences in the genotype distribution of the FcgRIIa polymorphism among patients considering overall response to immunotherapy. However, our results demonstrate that all patients carrying the HH genotype had complete responses to rituximab therapy. Complete response rate for HH genotype was 100% and for R allele was 63% (P50.028; Fig. 3).
Figure 2. Overall response rate in patients according to genotype.
With a median follow-up duration of 27 months (range 1e85), 17 patients (26.6%) relapsed and 11 deaths (17.2%) occurred. The overall survival at 3 years was 34.961.0 for the HH genotype and 31.961.3 for the R allele (P50.338; Fig. 4). The event-free survival at 3 years was 32.162.5 for the HH genotype and 26.462.2 for the R allele (P50.449; Fig. 5). When comparing the FcgRIIa genotypes, the HH genotype or R allele do not have a significant impact on survival.
4. Discussion This study demonstrates that FcgRIIa polymorphism is predictive of complete response to regimens containing rituximab in non-Hodgkin lymphoma patients, but is not predictive of overall or event-free survival. Moreover, a 100% response rate was obtained in HH genotype carriers with rituximab-based immunochemotherapy. Based on the current observation, rituximab has in some way an FcgRIIa-
Figure 4. Overall survival in patients according to genotype.
M. Paiva et al. / Cancer Genetics and Cytogenetics 183 (2008) 35e40
39
rituximab, a chimeric IgG1, to its encoded receptor, endorsing ADCC activity. In conclusion, besides the synergistic role of rituximab when combined with chemotherapy, the pharmacogenomic FcgRIIa profile of patients may be predictive of complete response to therapeutics. Modulation of FcgRIIa/IgG interaction evidently presents a promising approach for the treatment of various immunologic diseases, including hematologic cancer. In a near future, more studies should be considered with larger populations, separate histologic identities, and a longer follow-up period correlating this polymorphism with other genetic variations.
Figure 5. Event-free survival in patients according to genotype.
dependent mechanism of action that has an ameliorating effect on patients with the HH genotype. Studies conducted by Group d’Etude des Lymphoms de l’Adult demonstrated the benefit of R-CHOP therapy versus CHOP, suggesting that rituximab is able to prevent chemotherapy failure [7,29]. Mounier et al. [30] suggested that this benefit of rituximab could be associated with overcoming bcl-2 geneemediated chemoresistance. However, several other authors suggested that the mechanism of action of rituximab is not only confined to synergistic activity with CHOP chemotherapy. Two additional mechanisms other than direct apoptotic action were proposed for rituximab action: antibody-dependent cellular cytotoxicity (ADCC) and complement dependent cytotoxicity (CDC) [31,32]. In ADCC, rituximab binds to CD20 and then bridges the effector cells, such as neutrophils, macrophages, and NK cells, via the FcgR present on these cells. Effector cells then become activated and kill the antibody-coated tumor cells [31,32] . This event depends on the FcgR affinity of effector cells to the different IgG subclasses. The FcgR profile of effector cells depends on single-nucleotide polymorphisms. The major polymorphisms of FcgRIIa and FcgRIIIa have been recently correlated with rituximab activity in NHL [20e22]. Data from three clinical studies, two in follicular lymphoma and one in diffuse large B-cell lymphoma, revealed the potential impact of SNP in response to rituximab [20e22]. In the present study, we demonstrate that FcgRIIa polymorphism correlates with complete response in rituximab-based regimens in NHL patients (P50.028), confirming data from Weng et al. [20]. FcgRIIa-131H/Heencoded receptor binds with greater affinity to human IgG2 than FcgRIIa-131Reencoded receptors [33]. Since FcgRIIa represents the sole FcgR capable of binding with human IgG2, the ability to interact with this antibody subclass depends on the individual HH genotype. We hypothesize that the FcgRIIa-131H/Heencoded receptor has a greater affinity not only to human IgG2, but to all natural or engineered IgGs. As a result, FcgRIIa polymorphism may influence the binding affinity of
Acknowledgments The authors thank the Liga Portuguesa Contra o Cancro (Portuguese League against Cancer) e Centro Regional do Norte, Associac¸a˜o Portuguesa de Leucemias e Linfomas (Portuguese Association of Leukaemia and Lymphoma) and Roche Farmaceˆutica e Quı´mica Portugal for their support. References [1] Boyle P, Ferlay J. Cancer incidence and mortality in Europe, 2004. Ann Oncol 2005;16:481e8. [2] Ansell SM, Armitage J. Non-Hodgkin lymphoma: diagnosis and treatment. Mayo Clin Proc 2005;80:1087e97. [3] Traulle C, Coiffier BB. Evolving role of rituximab in the treatment of patients with non-Hodgkin’s lymphoma. Future Oncol 2005;1:297e306. [4] Kennedy RC, Shearer MH. A role for antibodies in tumor immunity. Int Rev Immunol 2003;22:141e72. [5] Eisenbeis CF, Caligiuri MA, Byrd JC. Rituximab: converging mechanisms of action in non-Hodgkin’s lymphoma? Clin Cancer Res 2003;9:5810e2. [6] Rastetter W, Molina A, White CA. Rituximab: expanding role in therapy for lymphomas and autoimmune diseases. Annu Rev Med 2004;55:477e503. [7] Feugier P, Van Hoof A, Sebban C, Solal-Celigny P, Bouabdallah R, Ferme C, Christian B, Lepage E, Tilly H, Morschhauser F, Gaulard P, Salles G, Bosly A, Gisselbrecht C, Reyes F, Coffier B. Long-term results of the R-CHOP study in the treatment of elderly patients with diffuse large B-cell lymphoma: a study by the Groupe d’Etude des Lymphomes de l’Adulte. J Clin Oncol 2005;23:4117e26. [8] Reff ME, Carner K, Chambers KS, Chinn PC, Leonard JE, Raab R, et al. Depletion of B cells in vivo by a chimeric mouse human monoclonal antibody to CD20. Blood 1994;83:435e45. [9] Cartron G, Watier H, Golay J, Solal-Celigny P. From the bench to the bedside: ways to improve rituximab efficacy. Blood 2004;104: 2635e42. [10] Pescovitz MD. Rituximab, an anti-cd20 monoclonal antibody: history and mechanism of action. Am J Transplant 2006;6:859e66. [11] van Sorge NM, van der Pol WL, van de Winkel JG. FcgammaR polymorphisms: Implications for function, disease susceptibility and immunotherapy. Tissue Antigens 2003;61:189e202. [12] Cohen-Solal JF, Cassard L, Fridman WH, Sautes-Fridman C. Fc gamma receptors. Immunol Lett 2004;92:199e205. [13] Dijstelbloem HM, van de Winkel JG, Kallenberg CG. Inflammation in autoimmunity: receptors for IgG revisited. Trends Immunol 2001;22:510e6.
40
M. Paiva et al. / Cancer Genetics and Cytogenetics 183 (2008) 35e40
[14] Koene HR, Kleijer M, Algra J, Roos D, von dem Borne AE, de Haas M. Fc gammaRIIIa-158V/F polymorphism influences the binding of IgG by natural killer cell Fc gammaRIIIa, independently of the Fc gammaRIIIa-48L/R/H phenotype. Blood 1997;90:1109e14. [15] de Haas M. IgG-Fc receptors and the clinical relevance of their polymorphisms. Wien Klin Wochenschr 2001;113:825e31. [16] Lee W, Lockhart AC, Kim RB, Rothenberg ML. Cancer pharmacogenomics: powerful tools in cancer chemotherapy and drug development. Oncologist 2005;10:104e11. [17] Pinto D, Pereira D, Portela C, da Silva JL, Lopes C, Medeiros R. The influence of HER2 genotypes as molecular markers in ovarian cancer outcome. Biochem Biophys Res Commun 2005;335:1173e8. [18] Medeiros R, Pereira D, Afonso N, Palmeira C, Faleiro C, AfonsoLopes C, Freitas-Silva M, Vasconcelos A, Costa S, Oso´rio T, Lopes C. Platinum/paclitaxel-based chemotherapy in advanced ovarian carcinoma: glutathione S-transferase genetic polymorphisms as predictive biomarkers of disease outcome. Int J Clin Oncol 2003;8: 156e61. [19] Santos AM, Sousa H, Portela C, Pereira D, Pinto D, Catarino R, Rodrigues C, Arau´jo AP, Lopes C, Medeiros R. TP53 and P21 polymorphisms: response to cisplatinum/paclitaxel-based chemotherapy in ovarian cancer. Biochem Biophys Res Commun 2006;340: 256e62. [20] Weng WK, Levy R. Two immunoglobulin G fragment C receptor polymorphisms independently predict response to rituximab in patients with follicular lymphoma. J Clin Oncol 2003;21:3940e7. [21] Kim DH, Jung HD, Kim JG, Lee JJ, Yang DH, Park YH, et al. FCGR3A gene polymorphisms may correlate with response to frontline R-CHOP therapy for diffuse large B-cell lymphoma. Blood 2006;108:2720e5. [22] Cartron G, Dacheux L, Salles G, Solal-Celigny P, Bardos P, Colombat P, et al. Therapeutic activity of humanized anti-CD20 monoclonal antibody and polymorphism in IgG Fc receptor FcgammaRIIIa gene. Blood 2002;99:754e8. [23] Carbone PP, Kaplan HS, Musshoff K, Smithers DW, Tubiana M. Report of the Committee on Hodgkin’s Disease Staging Classification. Cancer Res 1971;31:1860e1.
[24] A predictive model for aggressive non-Hodgkin’s lymphoma. The International Non-Hodgkin’s Lymphoma Prognostic Factors Project. N Engl J Med 1993;329:987e94. [25] Solal-Celigny P, Roy P, Colombat P, White J, Armitage JO, ArranzSaez R, et al. Follicular lymphoma international prognostic index. Blood 2004;104:1258e65. [26] Cheson BD, Horning SJ, Coiffier B, Shipp MA, Fisher RI, Connors JM, et al. Report of an international workshop to standardize response criteria for non-Hodgkin’s lymphomas. NCI Sponsored International Working Group. J Clin Oncol 1999;17:1244. [27] Mullenbach R, Lagoda PJ, Welter C. An efficient salt-chloroform extraction of DNA from blood and tissues. Trends Genet 1989;5: 391. [28] Jiang XM, Arepally G, Poncz M, McKenzie SE. Rapid detection of the Fc gamma RIIA-H/R 131 ligand-binding polymorphism using an allele-specific restriction enzyme digestion (ASRED). J Immunol Meth 1996;199:55e9. [29] Coiffier B, Lepage E, Briere J. CHOP chemotherapy plus rituximab compared with CHOP alone in elderly patients with diffuse large-Bcell Lymphoma. N Engl J Med 2002;346:235e42. [30] Mounier N, Briere J, Gisselbrecht C, Emile JF, Lederlin P, Sebban C, Berger F, Bosly A, Morel P, Tilly H, Bouabdallah R, Reyes F, Gaulard P, Coiffier B. Rituximab plus CHOP (R-CHOP) overcomes bcl-2eassociated resistance to chemotherapy in elderly patients with diffuse large B-cell lymphoma (DLBCL). Blood 2003;101:4279e84. [31] Anderson DR, Grillo-Lopez A, Varns C, Chambers KS, Hanna N. Targeted anti-cancer therapy using rituximab, a chimaeric antiCD20 antibody (IDEC-C2B8) in the treatment of non-Hodgkin’s Bcell lymphoma. Biochem Soc Transact 1997;25:705e8. [32] Golay J, Zaffaroni L, Vaccari T, Lazzari M, Borleri GM, Bernasconi S, Tedesco F, Rambaldi A, Introna M. Biologic response of B lymphoma cells to anti-CD20 monoclonal antibody rituximab in vitro: CD55 and CD59 regulate complement-mediated cell lysis. Blood 2000;95:3900e8. [33] Clynes R. Antitumor antibodies in the treatment of cancer: Fc receptors link opsonic antibody with cellular immunity. Hematol Oncol Clinics 2006;20:585e612.
FcgRIIa polymorphism and clinical response to rituximab in non-Hodgkin lymphoma patients ˆ ngelo Martinsb, Paula Ferreirac, Ma´rcia Paivaa, Herlander Marquesb, A Raquel Catarinoc, Rui Medeirosd,* a
Unit of Molecular Oncology, Laborato´rios piso 4, Instituto Portugueˆs de Oncologia, R. Dr. Ant. Bernardino Almeida, 4200-072 Porto, Portugal; Pharmaceutical Services, Oncology Unit, Hospital de S. Joa˜o, Alameda Prof. Hernaˆni Monteiro, 4200-319, Porto, Portugal b Onco-Haematology Department, COV piso 5, Instituto Portugueˆs de Oncologia, R. Dr. Ant. Bernadino Almeida, 4200-072 Porto, Portugal c Unit of Molecular Oncology, Laborato´rios piso 4, Instituto Portugueˆs de Oncologia, R. Dr. Ant. Bernardino Almeida, 4200-072 Porto, Portugal d Unit of Molecular Oncology, Laborato´rios piso 4, Instituto Portugueˆs de Oncologia, R. Dr. Ant. Bernardino Almeida, 4200-072 Porto, Portugal; ICBAS, Abel Salazar Institute for the Biomedical Sciences, Largo Prof. Abel Salazar, 2, 4099-003, Porto, Portugal Received 12 December 2007; received in revised form 28 January 2008; accepted 8 February 2008
Abstract
Rituximab is a chimeric monoclonal antibody that specifically targets the CD20 surface marker expressed in neoplastic B-lymphoid cells. Combined with chemotherapy or alone, in maintenance/ consolidation, it is used for the treatment of non-Hodgkin lymphoma (NHL). The role of a polymorphism in a specific Fc gamma receptor gene, FcgRIIa, in the clinical outcome of patients with NHL was investigated in this study. We characterized DNA samples from 64 non-Hodgkin lymphoma patients treated with rituximab using a polymerase chain reactionerestriction fragment length polymorphism method. The FcgRIIa HH genotype was significantly correlated with complete response to rituximab compared to the R allele (P50.028). In terms of overall or event-free survival, no difference was found according to FcgRIIa alleles. We hypothesize that the HH genotype increases the affinity of the FcgRIIa receptor, not only for naturally occurring IgG2, but also to ameliorate connection with chimeric IgG1 rituximab, contributing to a genetic individual profile of great interest in clinical onco-hematology. Ó 2008 Elsevier Inc. All rights reserved.
1. Introduction Non-Hodgkin lymphoma (NHL) is a heterogeneous group of malignancies of the lymphoid system. The incidence of NHL is increasing worldwide, predominantly in developed countries, affecting more males and older individuals. In Europe, there are 121,200 new cases every year, and NHL is the seventh more frequent cancer, causing approximately 65,200 deaths per year in the European Union [1]. B-cell lymphomas account for approximately 90% of all NHL, and the two most common histologic disease entities are follicular lymphoma and diffuse large B-cell lymphoma [2]. Treatment of these diseases is based on the histology and extent of disease. Lymphomas can be clinically classified as indolent or aggressive, which corresponds broadly to histologic classification of lowand high-grade lymphomas. Mantle cell lymphoma, a histologic low-grade lymphoma, has an aggressive behavior and * Corresponding author. Tel.: þ351-22-5084000 (ext. 5414); fax: þ351-22-5084001. E-mail address: [email protected] (R. Medeiros). 0165-4608/08/$ e see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.cancergencyto.2008.02.001
is usually considered an aggressive lymphoma. Indolent lymphomas have a median survival of up to 10 years; early stages may be treated and ‘‘cured’’ with radiation therapy, and advanced stages are characterized by treatment responses followed by relapses. Aggressive lymphomas have a rapid disease progression, but 30e70% can be cured with combination chemotherapy [2]. Patients with chemoresistant disease or whose disease relapses should be treated with novel therapies [3]. NHL represents an appropriate form of cancer to target with immunotherapeutic modalities. In particular, B-cell lymphomas express a differentiation marker on cell surface designated CD20, which is involved in the regulation of Bcell activation [4]. Rituximab is a chimeric IgG1 monoclonal antibody that specifically recognizes the CD20 marker present in the majority of NHL [5]. It was the first monoclonal antibody approved in oncology and is used nowadays in chemotherapy-resistant or relapsed NHL and in first-line therapy, maintenance/consolidation therapy, or in stem cell transplantation procedures [6]. The mechanism of rituximab action has not been defined clearly. Some authors suggest that it is able to prevent
36
M. Paiva et al. / Cancer Genetics and Cytogenetics 183 (2008) 35e40
chemotherapy failure by having a synergistic activity with chemotherapy [7]. Others postulate three mechanisms for rituximab action, including complement mediated cytotoxicity (CDC), antibody-dependent cellular cytotoxicity (ADCC), and stimulation of apoptosis pathway [8,9]. A rapid elimination of circulating B-cells was observed in vivo in all human disease status in which rituximab has been given in patients with NHL, supporting its clinical effectiveness [10]. There is increasing evidence that the Fc (crystallisable fragment) of the monoclonal antibody rituximab is the major component of its therapeutic activity through binding Fc gamma receptors (FcgR) expressed by effector cells [11]. Polymorphisms in FcgR genes have been associated with anti-tumor efficacy, as this heterogeneous family of receptors plays a critical role in immunity by linking the humoral to the cellular responses [12]. FcgR are expressed on a wide variety of cells, including B lymphocytes, dendritic cells, macrophages, monocytes, natural killer (NK) cells, neutrophils, and mast cells. [12]. The following three classes of FcgR have been described recently: (1) the high-affinity FcgRI, capable of binding monomeric IgG; (2) the low-affinity FcgRII; and (3) FcgRIII, which interact preferentially with complexed IgG [13]. In humans, there are variants of subclasses FcgRIIa and FcgRIIIa (131H/R and 158V/F, respectively) with different affinity to immune complexes resulting from mutations in or near the IgG-binding site [14]. A single-nucleotide polymorphism (SNP) at codon 131 of the FcgRIIa gene encodes either a histidine (H) or an arginine (R). A similar exchange occurs at codon 158 of the FcgRIIIa gene encoding either a valine (V) or a phenylalanine (F) [15]. Pharmacogenomic studies aim to elucidate the genetic bases for interindividual differences and use such genetic information to predict the efficacy, response rate, and safety of a selected drug [16e19]. To date, the prognostic value of FcgR polymorphisms as markers to predict treatment outcome in NHL is still being studied [20e22]. In the present study we analyzed FcgRIIa SNP in the genomic DNA isolated from peripheral blood of patients with NHL who had undergone immunotherapy with rituximab. Our goal was to determine whether there is any correlation between FcgRIIa polymorphisms and clinical features of patients with NHL. 2. Patients and methods The present study involved the genotypic analysis of 64 patients with NHL admitted and treated in the OncoHaematology Department (COV) of the Portuguese Institute of Oncology (Porto, Portugal). The patients were grouped according to clinical behavior of the tumour in two main groups: indolent and aggressive lymphomas. The group containing indolent lymphomas included patients with follicular lymphoma and one with lymphoplasmacytic lymphoma, whereas the group of patients with
aggressive lymphomas included mantle cell lymphoma, diffuse large B-cell lymphoma, and Burkitt lymphoma. The Ann Arbor Staging Classification was used to classify clinical staging [23]. This classification system, combined with age, number of extranodal or nodal sites, Eastern Cooperative Oncology Group (ECOG) classification, lactate dehydrogenase (LDH) levels, and hemoglobin levels, was used to define prognostic groups according to International Prognostic Index (IPI) and Follicular Lymphoma International Prognostic Index (FLIPI) [24,25]. The baseline characteristics of the patients are summarized in Table 1. Overall, among 64 patients, with a median age at diagnosis of 55 years (range 21e83), 31 are female and 33 are male. Thirty-one patients (48.4%) presented indolent NHL and 33 (51.6%) presented aggressive NHL. Follicular lymphoma and diffuse large B-cell lymphoma are the most common histologic entities with 30 (46.8%) and 25 patients (39.1%), respectively, which has also been observed in other population studies. All patients were submitted to immunotherapy with monoclonal antibody rituximab in combination with chemotherapy schemes as CHOP, ESHAP, HCVAD, MINE, TT, DHAP, FC, FND, or alone in maintenance/consolidation from May 1999 to July 2005, in first or subsequent lines. The response to therapeutics with rituximab was evaluated according to physical examination and computed tomography images. Responses were scored according to International Working Group Consensus [26]. 2.1. Genotype analysis Blood samples were obtained with the informed consent of the participants before their inclusion in the study. They were collected in EDTA-containing tubes. DNA was extracted from white blood fraction from each subject by a salting-out procedure [27]. FcgRIIa genotypes were determined on the basis of a polymerase chain reaction (PCR) method adapted from a previously established protocol [28]. The PCR primers for the FcgRIIa gene at loci 131 were 50 GGAAAATCCCAGAAATTCTCGC30 and 50 CAA CAGCCT GACTACCTATTAC GCGGG30 . The amplification was performed in a final volume of 50 mL reaction volume containing 2 mg of genomic DNA, 0.3 mmol/L of each primer, 1 unit Taq DNA polymerase, 1.5 mmol/L MgCl2, and 0.2 mmol/L dNTP. The PCR program consisted of an initial denaturation step at 94 C for 3 minutes, followed by 35 cycles of 94 C for 15 seconds, 55 C for 30 seconds, and 72 C for 40 seconds, and a final elongation step at 72 C for 7 minutes. The PCR products were analyzed on a 2% ethidium bromideestained agarose gel. The restriction fragment length polymorphism (RFLP) study was performed using the restriction enzyme Bsh1236I (Fermentas, Vilnius, Lithuania), according to standard supplier protocols. The digested products were analyzed on a 3.5% ethidium bromideestained agarose gel electrophoresis, and two digested bands of 337 and 316 base pairs
M. Paiva et al. / Cancer Genetics and Cytogenetics 183 (2008) 35e40
37
Table 1 Patients’ characteristics and immunotherapy outcomes Patients’ characteristics Histologic entities (n564) Follicular lymphoma Diffuse large B-cell lymphoma Mantle cell lymphoma Burkitt lymphoma Lymphoplasmacytic lymphoma Clinical staging (n564) IVA IIIA IA IIIB IVB IIA IB IIB Rituximab regimen (n564) R-CHOP R-ESHAP R alone (maintenance/consolidation) R-HCVAD R-MINE R-TT R-DHAP R-FC R-FND Line of treatment (n564) First line Maintenance/consolidation Second line Third line Fourth line Rituximab response (n555) Complete response (CR) Unconfirmed complete response (CRu) Partial response (PR) Stable disease (SD) Progression (P) Maintenance/consolidation (n59) Survival (n564) Alive without cancer Alive with cancer Dead with cancer Dead without cancer Total number of patients
n (%) 30 25 6 2 1
(46.8%) (39.1%) (9.4%) (3.1%) (1.6%)
33 11 6 5 3 3 2 1
(51.6%) (17.2%) (9.4%) (7.8%) (4.7%) (4.7%) (3.1%) (1.5%)
19 18 13 5 4 2 1 1 1
(29.7%) (28.1%) (20.2%) (7.8%) (6.3%) (3.1%) (1.6%) (1.6%) (1.6%)
outcomes were compared using chi-square or Fisher’s exact test. A cut-off P value of 0.05 was adopted for all the statistical analysis. Survival estimates were calculated using the KaplanMeier method. The curves were examined by the log-rank test, a statistical test for equality of survival distributions.
18 7 25 11 3
(28.1%) (10.9%) (39.1%) (17.2%) (4.7%)
Overall response rate was considered as complete response (CR), unconfirmed complete response (CRu), and partial response (PR). All patients who had undergone treatment with rituximab alone in maintenance/consolidation were excluded from response rate analysis (because most of them were already in CR with previous chemotherapy). Overall survival duration was defined as the period of time between the first treatment with rituximab and either death or the last clinical evaluation of the patient. Eventfree survival was defined as the time interval between the beginning of treatment with rituximab (day 1 of the first cycle) and the occurrence of an event (recurrence or death) or the time of the last clinical evaluation of the patient.
27 (49%) 11 (20%) 11 (20%) 3 (5.5%) 3 (5.5%) Not included in response analysis 41 12 10 1 64
(64.1%) (18.8%) (15.6%) (1.5%) (100%)
Abbreviations: R, rituximab; CHOP, cyclophosphamide, doxorubicin, vincristine, and prednisolone; ESHAP, etoposide, methylprednisolone, cytarabine, and cisplatin; HCVAD, cyclophosphamide, dexamethasone, doxorubicin, and vincristine; MINE, mesna, ifosfamide, mitoxantrone, and etoposide; TT, topotecan and paclitaxel; DHAP, dexamethasone, cytarabine, and cisplatin; FC, fludarabine and cyclophosphamide; FND, fludarabine, mitoxantrone, and dexamethasone.
were visualized in an Image Master VDS Pharmacia Biotech (Fig. 1).
Figure 1. Ethidium bromideestained electrophoresis of digested PCRRFLP product samples of FcgRIIa polymorphism: 100ebase pair ladder (lane M); RR genotype (lane 7); HR genotype (lanes 1, 4, 5, and 6) and HH genotype (lanes 2 and 3).
2.3. Definitions
3. Results 3.1. Frequency of FcgRIIa alleles The FcgRIIa polymorphism, according to the amino acid at position 131 of the FcgRIIa protein, can be heterozygote (HR allele) or homozygote (HH or RR alleles). The distribution of HH, HR, and RR alleles in the patients was 11 (17.2%), 34 (53.1%), and 19 (29.7%), respectively, while considering only two groups [HH and R allele (HR/RR)] was 11 (17.2%) and 53 (82.8%). 3.2. Prognostic characteristics of the population
2.2. Statistical analysis Data were analyzed using the computer software SPSS for Windows (version 13.0), and the patients’ treatment
There were no statistically significant differences between the groups of patients with different FcgRIIa genotypes (HH genotype or R allele) regarding prognostic
M. Paiva et al. / Cancer Genetics and Cytogenetics 183 (2008) 35e40
38
Table 2 Patients’ prognostic characteristics according to genotype FcgRIIa (n564) R allele (HR/RR)
HH
n (%)
n (%)
P
Aggressive (n533) Indolent (n531)
27 (81.8%) 26 (83.9%)
6 (18.2%) 5 (16.1%)
0.828
Stage III/IV (n552) Stage I/II (n512)
43 (82.7%) 10 (83.3%)
9 (17.3%) 2 (16.7%)
0.958
ECOG>2 (n52) ECOG!2 (n540)
1 (50.0%) 34 (85.0%)
1 (50.0%) 6 (15.0%)
0.195
LDHO190 (n534) LDH<190 (n527)
28 (82.4%) 22 (81.5%)
6 (17.6%) 5 (18.5%)
0.930
IPI/FLIPI 3e5 (n510) IPI/FLIPI 0e2 (n554)
9 (90.0%) 44 (81.5%)
1 (10.0%) 10 (18.5%)
0.512
Figure 3. Complete response rate in patients according to genotype.
3.4. Survival analysis according to FcgRIIa alleles characteristics as aggressive NHL, stage III/IV, ECOG>2, LDHO190, and IPI/FLIPI 3e5 among the population (PO0,05), as summarized in Table 2.
3.3. Response to rituximab therapy according to FcgRIIa alleles The overall response rate for the 55 evaluable patients (excluding those in maintenance/consolidation) was 89%. The overall response rate for HH genotype was 100% and for R allele was 87% (P50.251; Fig. 2). We found no statistically significant differences in the genotype distribution of the FcgRIIa polymorphism among patients considering overall response to immunotherapy. However, our results demonstrate that all patients carrying the HH genotype had complete responses to rituximab therapy. Complete response rate for HH genotype was 100% and for R allele was 63% (P50.028; Fig. 3).
Figure 2. Overall response rate in patients according to genotype.
With a median follow-up duration of 27 months (range 1e85), 17 patients (26.6%) relapsed and 11 deaths (17.2%) occurred. The overall survival at 3 years was 34.961.0 for the HH genotype and 31.961.3 for the R allele (P50.338; Fig. 4). The event-free survival at 3 years was 32.162.5 for the HH genotype and 26.462.2 for the R allele (P50.449; Fig. 5). When comparing the FcgRIIa genotypes, the HH genotype or R allele do not have a significant impact on survival.
4. Discussion This study demonstrates that FcgRIIa polymorphism is predictive of complete response to regimens containing rituximab in non-Hodgkin lymphoma patients, but is not predictive of overall or event-free survival. Moreover, a 100% response rate was obtained in HH genotype carriers with rituximab-based immunochemotherapy. Based on the current observation, rituximab has in some way an FcgRIIa-
Figure 4. Overall survival in patients according to genotype.
M. Paiva et al. / Cancer Genetics and Cytogenetics 183 (2008) 35e40
39
rituximab, a chimeric IgG1, to its encoded receptor, endorsing ADCC activity. In conclusion, besides the synergistic role of rituximab when combined with chemotherapy, the pharmacogenomic FcgRIIa profile of patients may be predictive of complete response to therapeutics. Modulation of FcgRIIa/IgG interaction evidently presents a promising approach for the treatment of various immunologic diseases, including hematologic cancer. In a near future, more studies should be considered with larger populations, separate histologic identities, and a longer follow-up period correlating this polymorphism with other genetic variations.
Figure 5. Event-free survival in patients according to genotype.
dependent mechanism of action that has an ameliorating effect on patients with the HH genotype. Studies conducted by Group d’Etude des Lymphoms de l’Adult demonstrated the benefit of R-CHOP therapy versus CHOP, suggesting that rituximab is able to prevent chemotherapy failure [7,29]. Mounier et al. [30] suggested that this benefit of rituximab could be associated with overcoming bcl-2 geneemediated chemoresistance. However, several other authors suggested that the mechanism of action of rituximab is not only confined to synergistic activity with CHOP chemotherapy. Two additional mechanisms other than direct apoptotic action were proposed for rituximab action: antibody-dependent cellular cytotoxicity (ADCC) and complement dependent cytotoxicity (CDC) [31,32]. In ADCC, rituximab binds to CD20 and then bridges the effector cells, such as neutrophils, macrophages, and NK cells, via the FcgR present on these cells. Effector cells then become activated and kill the antibody-coated tumor cells [31,32] . This event depends on the FcgR affinity of effector cells to the different IgG subclasses. The FcgR profile of effector cells depends on single-nucleotide polymorphisms. The major polymorphisms of FcgRIIa and FcgRIIIa have been recently correlated with rituximab activity in NHL [20e22]. Data from three clinical studies, two in follicular lymphoma and one in diffuse large B-cell lymphoma, revealed the potential impact of SNP in response to rituximab [20e22]. In the present study, we demonstrate that FcgRIIa polymorphism correlates with complete response in rituximab-based regimens in NHL patients (P50.028), confirming data from Weng et al. [20]. FcgRIIa-131H/Heencoded receptor binds with greater affinity to human IgG2 than FcgRIIa-131Reencoded receptors [33]. Since FcgRIIa represents the sole FcgR capable of binding with human IgG2, the ability to interact with this antibody subclass depends on the individual HH genotype. We hypothesize that the FcgRIIa-131H/Heencoded receptor has a greater affinity not only to human IgG2, but to all natural or engineered IgGs. As a result, FcgRIIa polymorphism may influence the binding affinity of
Acknowledgments The authors thank the Liga Portuguesa Contra o Cancro (Portuguese League against Cancer) e Centro Regional do Norte, Associac¸a˜o Portuguesa de Leucemias e Linfomas (Portuguese Association of Leukaemia and Lymphoma) and Roche Farmaceˆutica e Quı´mica Portugal for their support. References [1] Boyle P, Ferlay J. Cancer incidence and mortality in Europe, 2004. Ann Oncol 2005;16:481e8. [2] Ansell SM, Armitage J. Non-Hodgkin lymphoma: diagnosis and treatment. Mayo Clin Proc 2005;80:1087e97. [3] Traulle C, Coiffier BB. Evolving role of rituximab in the treatment of patients with non-Hodgkin’s lymphoma. Future Oncol 2005;1:297e306. [4] Kennedy RC, Shearer MH. A role for antibodies in tumor immunity. Int Rev Immunol 2003;22:141e72. [5] Eisenbeis CF, Caligiuri MA, Byrd JC. Rituximab: converging mechanisms of action in non-Hodgkin’s lymphoma? Clin Cancer Res 2003;9:5810e2. [6] Rastetter W, Molina A, White CA. Rituximab: expanding role in therapy for lymphomas and autoimmune diseases. Annu Rev Med 2004;55:477e503. [7] Feugier P, Van Hoof A, Sebban C, Solal-Celigny P, Bouabdallah R, Ferme C, Christian B, Lepage E, Tilly H, Morschhauser F, Gaulard P, Salles G, Bosly A, Gisselbrecht C, Reyes F, Coffier B. Long-term results of the R-CHOP study in the treatment of elderly patients with diffuse large B-cell lymphoma: a study by the Groupe d’Etude des Lymphomes de l’Adulte. J Clin Oncol 2005;23:4117e26. [8] Reff ME, Carner K, Chambers KS, Chinn PC, Leonard JE, Raab R, et al. Depletion of B cells in vivo by a chimeric mouse human monoclonal antibody to CD20. Blood 1994;83:435e45. [9] Cartron G, Watier H, Golay J, Solal-Celigny P. From the bench to the bedside: ways to improve rituximab efficacy. Blood 2004;104: 2635e42. [10] Pescovitz MD. Rituximab, an anti-cd20 monoclonal antibody: history and mechanism of action. Am J Transplant 2006;6:859e66. [11] van Sorge NM, van der Pol WL, van de Winkel JG. FcgammaR polymorphisms: Implications for function, disease susceptibility and immunotherapy. Tissue Antigens 2003;61:189e202. [12] Cohen-Solal JF, Cassard L, Fridman WH, Sautes-Fridman C. Fc gamma receptors. Immunol Lett 2004;92:199e205. [13] Dijstelbloem HM, van de Winkel JG, Kallenberg CG. Inflammation in autoimmunity: receptors for IgG revisited. Trends Immunol 2001;22:510e6.
40
M. Paiva et al. / Cancer Genetics and Cytogenetics 183 (2008) 35e40
[14] Koene HR, Kleijer M, Algra J, Roos D, von dem Borne AE, de Haas M. Fc gammaRIIIa-158V/F polymorphism influences the binding of IgG by natural killer cell Fc gammaRIIIa, independently of the Fc gammaRIIIa-48L/R/H phenotype. Blood 1997;90:1109e14. [15] de Haas M. IgG-Fc receptors and the clinical relevance of their polymorphisms. Wien Klin Wochenschr 2001;113:825e31. [16] Lee W, Lockhart AC, Kim RB, Rothenberg ML. Cancer pharmacogenomics: powerful tools in cancer chemotherapy and drug development. Oncologist 2005;10:104e11. [17] Pinto D, Pereira D, Portela C, da Silva JL, Lopes C, Medeiros R. The influence of HER2 genotypes as molecular markers in ovarian cancer outcome. Biochem Biophys Res Commun 2005;335:1173e8. [18] Medeiros R, Pereira D, Afonso N, Palmeira C, Faleiro C, AfonsoLopes C, Freitas-Silva M, Vasconcelos A, Costa S, Oso´rio T, Lopes C. Platinum/paclitaxel-based chemotherapy in advanced ovarian carcinoma: glutathione S-transferase genetic polymorphisms as predictive biomarkers of disease outcome. Int J Clin Oncol 2003;8: 156e61. [19] Santos AM, Sousa H, Portela C, Pereira D, Pinto D, Catarino R, Rodrigues C, Arau´jo AP, Lopes C, Medeiros R. TP53 and P21 polymorphisms: response to cisplatinum/paclitaxel-based chemotherapy in ovarian cancer. Biochem Biophys Res Commun 2006;340: 256e62. [20] Weng WK, Levy R. Two immunoglobulin G fragment C receptor polymorphisms independently predict response to rituximab in patients with follicular lymphoma. J Clin Oncol 2003;21:3940e7. [21] Kim DH, Jung HD, Kim JG, Lee JJ, Yang DH, Park YH, et al. FCGR3A gene polymorphisms may correlate with response to frontline R-CHOP therapy for diffuse large B-cell lymphoma. Blood 2006;108:2720e5. [22] Cartron G, Dacheux L, Salles G, Solal-Celigny P, Bardos P, Colombat P, et al. Therapeutic activity of humanized anti-CD20 monoclonal antibody and polymorphism in IgG Fc receptor FcgammaRIIIa gene. Blood 2002;99:754e8. [23] Carbone PP, Kaplan HS, Musshoff K, Smithers DW, Tubiana M. Report of the Committee on Hodgkin’s Disease Staging Classification. Cancer Res 1971;31:1860e1.
[24] A predictive model for aggressive non-Hodgkin’s lymphoma. The International Non-Hodgkin’s Lymphoma Prognostic Factors Project. N Engl J Med 1993;329:987e94. [25] Solal-Celigny P, Roy P, Colombat P, White J, Armitage JO, ArranzSaez R, et al. Follicular lymphoma international prognostic index. Blood 2004;104:1258e65. [26] Cheson BD, Horning SJ, Coiffier B, Shipp MA, Fisher RI, Connors JM, et al. Report of an international workshop to standardize response criteria for non-Hodgkin’s lymphomas. NCI Sponsored International Working Group. J Clin Oncol 1999;17:1244. [27] Mullenbach R, Lagoda PJ, Welter C. An efficient salt-chloroform extraction of DNA from blood and tissues. Trends Genet 1989;5: 391. [28] Jiang XM, Arepally G, Poncz M, McKenzie SE. Rapid detection of the Fc gamma RIIA-H/R 131 ligand-binding polymorphism using an allele-specific restriction enzyme digestion (ASRED). J Immunol Meth 1996;199:55e9. [29] Coiffier B, Lepage E, Briere J. CHOP chemotherapy plus rituximab compared with CHOP alone in elderly patients with diffuse large-Bcell Lymphoma. N Engl J Med 2002;346:235e42. [30] Mounier N, Briere J, Gisselbrecht C, Emile JF, Lederlin P, Sebban C, Berger F, Bosly A, Morel P, Tilly H, Bouabdallah R, Reyes F, Gaulard P, Coiffier B. Rituximab plus CHOP (R-CHOP) overcomes bcl-2eassociated resistance to chemotherapy in elderly patients with diffuse large B-cell lymphoma (DLBCL). Blood 2003;101:4279e84. [31] Anderson DR, Grillo-Lopez A, Varns C, Chambers KS, Hanna N. Targeted anti-cancer therapy using rituximab, a chimaeric antiCD20 antibody (IDEC-C2B8) in the treatment of non-Hodgkin’s Bcell lymphoma. Biochem Soc Transact 1997;25:705e8. [32] Golay J, Zaffaroni L, Vaccari T, Lazzari M, Borleri GM, Bernasconi S, Tedesco F, Rambaldi A, Introna M. Biologic response of B lymphoma cells to anti-CD20 monoclonal antibody rituximab in vitro: CD55 and CD59 regulate complement-mediated cell lysis. Blood 2000;95:3900e8. [33] Clynes R. Antitumor antibodies in the treatment of cancer: Fc receptors link opsonic antibody with cellular immunity. Hematol Oncol Clinics 2006;20:585e612.