- Email: [email protected]
Ferulic acid reverses ABCB1-mediated paclitaxel resistance in MDR cell lines
Author’s Accepted Manuscript Ferulic acid reverses ABCB1-mediated paclitaxel resistance in MDR cell lines Ganesan Muthusamy, Agilan Balupillai, Karthikeyan Ramasamy, Mohana Shanmugam, Srithar Gunaseelan, Beaulah Mary, N. Rajendra Prasad www.elsevier.com/locate/ejphar
PII: DOI: Reference:
S0014-2999(16)30328-4 http://dx.doi.org/10.1016/j.ejphar.2016.05.023 EJP70650
To appear in: European Journal of Pharmacology Received date: 13 April 2016 Revised date: 18 May 2016 Accepted date: 19 May 2016 Cite this article as: Ganesan Muthusamy, Agilan Balupillai, Karthikeyan Ramasamy, Mohana Shanmugam, Srithar Gunaseelan, Beaulah Mary and N. Rajendra Prasad, Ferulic acid reverses ABCB1-mediated paclitaxel resistance in MDR cell lines, European Journal of Pharmacology, http://dx.doi.org/10.1016/j.ejphar.2016.05.023 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Ferulic acid reverses ABCB1-mediated paclitaxel resistance in MDR cell lines
Ganesan Muthusamy, Agilan Balupillai, Karthikeyan Ramasamy, Mohana Shanmugam, Srithar Gunaseelan, Beaulah Mary, N. Rajendra Prasad* Department of Biochemistry and Biotechnology, Annamalai University, Annamalainagar – 608002, Tamilnadu, India.
*
Corresponding author. [email protected]. Department of Biochemistry and Biotechnology. Annamalai University. Annamalainagar – 608002. Tel: +91-9842305384. Fax: +91-04144-238080
Abstract Multidrug resistance (MDR) remains a major obstacle in cancer chemotherapy. The use of the dietary phytochemicals as chemosensitizing agents to enhance the efficacy of conventional cytostatic drugs has recently gained the attention as a plausible approach for overcoming the drug resistance. The aim of this study was to investigate whether a naturally occurring diet-based phenolic acid, ferulic acid, could sensitize paclitaxel efficacy in ABCB1 overexpressing (P-glycoprotein) colchicine selected KB ChR8-5 cell line. In vitro drug efflux assays demonstrated that ferulic acid inhibits P-glycoprotein transport function in drug resistant KB ChR8-5 cell lines. However, ferulic acid significantly downregulates ABCB1 expression in a concentration dependent manner. Cytotoxicity assay reveals that ferulic acid decreased paclitaxel resistance in KBChR8-5 and HEK293/ABCB1 cells, which indicates its chemosensitizing potential. Clonogenic cell survival assay and apoptotic morphological staining further confirm the chemosensitizing potential of ferulic acid in drug resistant KB ChR8-5 cell lines. Ferulic acid treatment enhances paclitaxel mediated cell cycle arrest and upregulates paclitaxel-induced
apoptotic signaling in KB resistant cells. Hence, it has been concluded that downregulation of ABCB1 and subsequent induction of paclitaxel-mediated cell cycle arrest and apoptotic signaling may be the cause for the chemosensitizing potential of ferulic acid in P-gp overexpressing cell lines. Keywords: Multidrug resistance; P-glycoprotein; Ferulic acid; Paclitaxel; Apoptosis; Cell cycle.
1. Introduction Multidrug resistance (MDR) is a significant obstruction for effective cancer chemotherapy and a major mechanism of resistance in cancer cells to many structurally and functionally unrelated drugs (Baguley, 2010). Overexpression of ATP-binding cassette (ABC) transporters in cancer cells has been reported as one of the most important factor linked to MDR (Sodani et al., 2012). Membrane P-glycoprotein (P-gp/ABCB1/MDR1) is the major contributor of multidrug resistance during cancer chemotherapy (Dean et al., 2001; Juliano et al., 1976). Accumulated evidences prove that P-gp pumps out a variety of anticancer drugs, such as anthracyclines, topoisomerase inhibitors, vinca alkaloids and taxanes, thereby reducing intracellular drug retention, resulting in chemotherapeutic drug resistance (Sarkadi et al., 2006; Coley, 2010). Therefore, inhibition of P-gp may resensitize the MDR cancer cells to the treatment of anticancer drugs. Currently available P-gp inhibitors show adverse toxic effects and accumulate chemotherapeutic drugs; hence there is a need for potent P-gp inhibitor/modulator to
reverse the clinical cancer multidrug resistance (Rowinsky, 1995; Hossam, et al., 2015). The combination of anticancer drugs with natural products shows efficacy and low toxicity to reverse MDR. Phytochemicals were investigated for their P-gp modulation/inhibition in several experimental MDR models (Prasad, et al., 2016; Di Domenico et al., 2012). Paclitaxel is a naturally occurring antineoplastic agent that is widely used in the treatment of a variety of solid tumors. It is a well-known mechanism that paclitaxel is a unique antimicrotubule agent guide to a mitotic block in the late G2/M-phase of the cell cycle (Fanale et al., 2015). The emergence of resistance remains an important problem and a major drawback associated with paclitaxel treatment (Yang, et al., 2015). There are numerous mechanisms have been reported to paclitaxel resistance and one important contributor is the overexpression of membrane P-gp (Orr et al., 2003; Ramanathan et al., 2005). Hence, modulation of membrane Pglycoprotein function/expressions seems to be a novel approach to overcome paclitaxel resistance in MDR cell lines. Ferulic acid, [FA (3-methoxy-4-hydroxycinnamic acid)], is a dietary phytochemical mainly present in the leaves and seeds of plants such as wheat, rice and barley (Jayaprakasam et al., 2006). Ferulic acid is a simple phenolic acid showed antitumor, chemopreventive and photoprotective properties in different experimental models (Hudson et al., 2000; Mori et al., 1999; Ambothi et al., 2015). Previously, we reported the radiosensitizing and radioprotective effect of ferulic acid on various human cervical cancer cell lines (Santhakumar et al., 2012 Karthikeyan at al., 2011). In this study, we investigated the chemosensitizing potential of ferulic acid in colchicine-resistant ABCB1 overexpressing KB ChR8-5 cell lines. 2. Materials and methods
2. 1. Cell culture P-gp overexpressing KB ChR 8-5 cell lines and its parental KB cell lines were purchased from NCCS, Pune. The cells were cultured in DMEM (Sigma) with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (Invitrogen). KB ChR8-5 cells were grown in the presence of 10 ng/ml colchicine. The parental cell line HEK293 and HEK/ABCB1 transfected with human ABCB1 cDNA were maintained in the DMEM with G418 (2 mg/ml) (Zhang, et al., 2012) and cultured in a similar manner. All cells were grown as adherent monolayers in drug-free culture media for more than 2 weeks before the assay.
2.2. Preparation of drug Ferulic acid (1 mM) was dissolved in dimethylsulphoxide (0.05% DMSO) and the solution was prepared freshly on a daily basis. Further dilution was made in culture media to obtain the desired concentrations. The final concentrations of DMSO in the culture medium were not more than 0.01% (v/v). 2.3. Cytotoxicity determination by MTT Assay MTT colorimetric assay was conducted to detect the chemosensitivity of cells to paclitaxel by ferulic acid in vitro (Singh et al., 2014). Briefly, 5000−6000 cells/well were seeded in 96-well plates and incubated at 37 °C, 5% CO2 for 24 h. Cells were pre-incubated with or without ferulic acid for 2 h and then different concentrations of paclitaxel were added into designated wells. After 72 h of incubation at 37 °C, 20 μL of MTT solution (4 mg/ml) was added
to each well. The plates were further incubated for 4 h at 37 °C. Consequently, without disturbing the cells the MTT medium was removed from each well, and 100 μl of DMSO was added into each well to dissolve the formazan crystals. The absorbance was determined at 570 nm by microplate reader (Tecan Multimode Reader, Austria). The assays were performed four times independently and each independent experiment was done in triplicate. 2.4. Colony formation assay Clonogenic assay or colony formation assay is an in vitro cell survival assay based on the capability to grow a single cell into a colony (Franken et al., 2006). KB and KB ChR8-5 cells were seeded in 6 cm dishes and allowed to adhere overnight at 37 ; C, consequently the cells were treated with ferulic acid and paclitaxel for 48 h incubation. After incubation the cells were reseeded in the 6 well plates and subsequently incubated for 10-14 days in drug free medium. The colonies were then fixed for 15 min with methanol-acetic acid (3:1) and stained with crystal violet (1%) for 30 min after which time residual staining solution was removed and plates were washed with water. After staining the colonies were counted.
PE =
no. of colonies formed ´100% no. of cells seeded
2.5. Fluorescence microscopic analysis of cell death We used acridine orange/ethidium bromide (AO/EtBr) double staining for apoptosis detection by morphological observation (Baskic et al., 2006). Briefly, acridine orange is taken up by both viable and nonviable cells and emits green fluorescence. Ethidium bromide is taken up only by nonviable cells and emits red fluorescence by intercalation into DNA. Cells were treated with ferulic acid and paclitaxel for 24 h. After treatment 20 µl of dye mixture was added to the
treated cells and immediately cells were examined under a Nikon inverted fluorescent microscope. Untreated cells serves as control and the results were expressed as mean ± S.E.M. for three independent determinations. 2.6. Wound healing assay Cell migration in the presence of ferulic acid and paclitaxel was tested using a woundhealing assay. In this experiment, cells were grown to confluence and an incision was made in the center of the plate. Equal number of live cells was seeded in 6 well plates. Ferulic acid and paclitaxel treatment was carried out, when cells were at 90% confluent. Then wounds were made in cells using a P-200 pipette tip. Microphotographs were taken at 0 and 24 h of incubation (Saxena et al., 2011). 2.7. Cell cycle analysis The cells (3.2×105 per well) were plated in 6-well plates and treated with combinations of ferulic acid and paclitaxel. Adherent and detached cells were harvested by trypsinization, and fixed in ice-cold 70% ethanol for at least 1h. The cell pellets were washed twice with cold phosphate-buffered saline (PBS) and incubated for 30 min at room temperature in 1 ml PBS containing 50 μg propidium iodide (Sigma-Aldrich), 0.1% Triton X-100, 1 mM EDTA and 0.5 mg RNaseA. After staining, the samples were analyzed using FACS Aria III (BD Biosciences). 2.8. Calcein-AM and rhodamine123 efflux assay The capability of the ferulic acid to inhibit the transport function of P-gp was analysed using calcein–AM and rhodamine-123, as described previously (Tiberghien et al., 1996). Briefly,
the drug resistant cells were trypsinized and incubated with different concentrations of ferulic acid subsequently incubated with calcein-AM (0.5 μM) for 10 min and rhodamine-123 for 45 min in the dark at 37 ○C. The cells were washed with cold PBS and fluorescence produced by intracellular calcein and rhodamine-123 was measured using a spectrofluorometer equipped with an excitation 488 nm and emission 530 nm, respectively (Tecan, Multimode Reader, Austria). The results are reported as an average of two independent experiments, each done in triplicates. The percentage calcein-AM and rhodamine-123 efflux remaining was analysed and the IC50 of ferulic acid was calculated. 2.9. Molecular docking All computational works were performed on Red Hat Enterprise Linux EL-5 workstation using the molecular modeling software Maestro (Schrodinger LLC 2009, USA). GLIDE-5.5 (Grid-based Ligand Docking with Energetics) searches were made for favorable docking interactions between ferulic acid with the homology modeled P-glycoprotein. The human P-gp homology model based on mouse P-gp in apoprotein state was generously provided by Dr. S. Aller (The University of Alabama at Birmingham, Birmingham, AL). All the molecular modeling simulations were carried out using OPLS-AA (Optimized Potential Liquid Simulation for All Atom) force field (Glide, 2009). PyMOL (Delano, 2002) software was used for graphical visualization, analyzing hydrogen bond interactions and producing quality images. Hydrophobic contacts were observed between protein and ligand using Ligplot software (Wallace et al., 1995). 2.10. Analysis of ferulic acid binding affinity with P-gp by tryptophan fluorescence quenching
DF / F0 ´100 =
DF / Fmax ´ (100) ´ [ S ] Kd + [S ]
The affinity of binding of ferulic acid to purified Pgp was determined using Trp quenching as described previously (Liu et al., 2000). Briefly, purified Pgp (50 μg in 0.5 ml) was titrated in 2 mM CHAPS buffer with increasing concentrations of ferulic acid, while quenching of Trp fluorescence was monitored at 330 nm following excitation at 290 nm. Kd and ΔFmax values were extracted following fitting of the data to an equation describing binding to a single affinity site.
Where, (ΔF/F0×100) represents the percent change in fluorescence intensity relative to the initial value after addition of ferulic acid at a concentration [S], and (ΔFmax/F0×100) is the maximum percent quenching of the fluorescence intensity that occurs upon saturation of the substrate binding site.
2.11. Transcriptional analysis of ABCB1 expression The total RNA was extracted from KB ChR8-5 cells using RNeasy Mini kit (Qiagen, USA) as per the recommended protocol by the manufacturer. The mRNA expression of ABCB1/MDR1, in KB ChR8-5 cells was determined using real-time PCR (Eppendorff, Thermocycler, USA). The primer sequence was F: 5’ TGGAGGTAAGTGACCCAGGGCTG 3’and R: 5’ AGGCAATCCGATGCAGAGCCCA 3’. The expression levels of genes were normalized to 18S mRNA in each sample. The mean Ct values from triplicate measurements were used to calculate the relative gene expression using the 2−ΔΔCt formula. 2.12. PCR array
The total RNA content of the cells were isolated from ferulic acid and/or paclitaxel treated KB ChR8-5 cells using RNeasy mini kit (Qiagen, India) according to the manufacturer’s instruction and stored at -80 °C until used for gene expression by qRT-PCR arrays. The purity of the freshly isolated total RNA was measured by Nanodrop (Thermo Scientific) and total RNA was employed for the gene expression analysis. The cDNA was reverse transcribed from RNA using the First Strand cDNA Synthesis Kit (Qiagen reverse transcriptase kit). The relative expression pattern of 13 genes related to drug resistance, apoptosis and cell cycle regulation was analyzed by PCR array using RT2 real-time SYBR Green PCR master mix (Qiagen) on eppondrof realplex. The fold changes of gene expressions were analyzed and plotted as clustergram using SA Biosciences PCR array data analysis online tool (pcrdataanalysis.sabiosciences.com/pcr/arrayanalysis.php).
2.13. Western blotting KB or KB ChR8-5 cells were washed with ice-cold PBS, then cells were lysed with RIPA buffer for 30 min and centrifuged at 4 °C, 12,000 × g for 30 min. The supernatants were collected and protein concentration was determined using Nanodrop spectrophotometer (Thermo Scientific). Each sample with 50 μg protein was added with SDS sample buffer, and denatured at 95 °C for 5 min. Proteins were separated by 10 % SDS-PAGE electrophoresis and transferred to 0.45 μm nitrocellulose membrane. Membrane was blocked with 5 % bovine serum albumin for 1 h, and incubated with P-gp monoclonal antibodies at 4 °C overnight. Then the membrane was
incubated with secondary antibodies (Santa cruz, CA, USA) at room temperature for 1 h, washed with PBST three times, and detected with a chemiluminescent detecting system (Biorad). 3. Results 3.1. Paclitaxel sensitizing potential of ferulic acid in P-gp overexpressing KBChR 8-5 cell lines To determine whether ferulic acid could reverse P-gp mediated MDR, cell survival assays were performed in the presence or absence of ferulic acid using the parental KB and KB ChR 8-5 cell lines (Fig. 1A). KB ChR8-5 cell line showed 30 fold resistance to paclitaxel, as compared to the parental KB cell line (Table 1A). Ferulic acid significantly decreased the paclitaxel resistance in KB ChR8-5 cells as compared to the control KB cell line. The higher concentration of ferulic acid (30 μM) showed more potent reversal activity than 10 µM and 20 µM of ferulic acid. Similarly, we perfomed cell survival assays in the presence or absence of ferulic acid, using the parental HEK293 cell line and ABCB1-transfected HEK/ABCB1 cell line (Fig. 1B). HEK293/ABCB1 cell line showed 71 fold resistance to paclitaxel, as compared to the parental HEK293 cell line (Table 1B). Ferulic acid significantly decreased the paclitaxel resistance in HEK293/ABCB1 cells as compared to the control HEK293 cell line. The higher concentration of ferulic acid (30 μM) showed more potent reversal activity. 3.2. Effect of ferulic acid and paclitaxel on clonogenic cell survival and apoptotic morphological changes In KB cells paclitaxel alone treatment inhibits cell growth and decreases the colony formation. In KB ChR 8-5 cells paclitaxel alone treatment didn’t prevent the colony formation. Conversely, ferulic acid-paclitaxel combination significantly inhibits resistant cell survival and colony formation than paclitaxel alone treatment (Fig. 2). Further, we observed elevated apoptotic incidence (60%) during ferulic acid–paclitaxel treatment than ferulic acid alone (15%)
or paclitaxel alone treatment (20%). Further, ferulic acid-paclitaxel treated cells showed condensed nuclei, membrane blubbing and apoptotic bodies (Fig. 2). 3.3. Effect of ferulic acid and paclitaxel on cell migration in KB and KB ChR 8-5 cell lines Treatment with paclitaxel and paclitaxel-ferulic acid decreased cell migration in parental KB cells (Fig. 3). Whereas, paclitaxel alone treatment has not shown any inhibition of cell migration and wound healing in resistant cell lines. Conversely, ferulic acid–paclitaxel combination shown significant inhibition of cell migration in drug resistant KB ChR 8-5 cell lines. 3.4. Ferulic acid treatment potentiates G2/M arrest in paclitaxel-treated KB ChR 8-5 cells We examined the effect of ferulic acid on paclitaxel mediated cycle arrest at the G2/M phase in KB ChR8-5 cells. 0.1 µM of paclitaxel and 10 µM of ferulic acid showed no effect on the cell cycle at the G2/M phase (10.7% and 14.7%, respectively) in the drug resistant KB ChR8-5 cells. While ferulic acid pretreatment enhance the paclitaxel mediated arrest at G2/M phase of the cell cycle (up to 37.2%) in drug resistant KB ChR 8-5 cells (Fig. 4). 3.5. Calcein-AM and rhodamine-123 efflux assays Ferulic acid was evaluated for its capability to inhibit transport function of P-gp using calcein–AM and rhodamine123 efflux assays in KB ChR8-5 cells. Ferulic acid inhibits P-gp transport function in both the membrane efflux assays in a concentration dependant manner (Fig. 5). The higher concentration of ferulic acid (30 μM) showed 35% and 40% transport function inhibition in calcein–AM and rhodamine123 efflux assays, respectively. 3.6. Binding interaction of ferulic acid with P-glycoprotein The docking was carried out to understand binding interaction of ferulic acid with drug binding pocket of TMD region of homology modeled P-glycoprotein. Ferulic acid has showed inter- and
intra molecular interaction with active site residues of P-gp (Fig. 6 A). Induced Fit Docking (IFD) and glide energy of FA with P-gp was found to be -6.30 kcal/mol and -28.75 kcal/mol, respectively. The amino acid residue Tyr-310 shows hydrogen bond interaction (O-H...O) with ferulic acid whereas Phe 72, Met 69, Phe 732, Leu 975, Phe 336, Phe 983 shows hydrophobic bond interaction with ferulic acid. Trp quenching experiments were carried out using ferulic acid with purified P-gp. The results displayed considerable Trp quenching and the Kd values for binding of ferulic acid with P-gp was foud to be 10 µM (Fig. 6B). 3.7. Ferulic acid and/or PTX on ABCB1 and apoptotic gene expression in KB ChR 8-5 cells We observed overexpression of ABCB1in KB ChR8-5 cells when compared with parental KB cells (Fig. 7). Further, ferulic acid downregulates the expression pattern of ABCB1, at mRNA as well as protein level, in a dose dependent manner (Fig. 7). We also observed that ABC transporters such as ABCC1, ABCC2, ABCC3, ABCC5 and ABCG2 were not expressed in KB ChR8-5 cells (Fig. 8). Treatment with ferulic acid alone or paclitaxel alone did not alter the mRNA expression pattern of apoptotic and cell cycle signaling molecules such as p53, CDKN1A, CDK2, BCL-XL, BAX (Fig. 8) in drug resistant cell lines. The combination of paclitaxel and ferulic acid treatment downregulates CDK2, BCL-XL gene expression. Further, this combination upregulates p53, CDKN1A, BAX expression in KB ChR8-5 cells. 4. Discussion Multidrug resistance is a major barrier in cancer chemotherapy. The ATP-dependent efflux pump, primarily P-gp, decreases the intracellular concentration of various anticancer drugs in drug resistant cells (Gottesman et al., 2002). Downregulation of P-gp expression or inhibition of its transport function would be a novel approach to reverse multidrug resistance. In this study, we analyzed the chemosensitizing potential of ferulic acid in colchicine-selected drug resistant
KB cell line. Colchicine-selected KB ChR8-5 cell line is a typical P-gp overexpressing cell line (Shen et al., 1986). Further we analysed the chemosensitizing potential of ferulic acid with ABCB1 transfected HEK/ABCB1 cells. In this study, we observed ferulic acid pretreatment significantly induced paclitaxel mediated cell death in drug resistant KB ChR8-5 cells and transfected HEK/ABCB1 cells. It has been already documented that nanoformulations of ferulic acid could reduce the doses and improves the therapeutic efficacy (Trombino et al., 2013). Further, ferulic acid pretreatment promotes paclitaxel’s mediated apoptotic cell death and inhibits resistant cell colony formation. The induction of apoptosis in tumor cells plays a major role in chemotherapy induced cancer cell killing and blockade of the apoptosis might be a one of the mechanism for MDR of chemotherapy (Tsuruo et al., 2003). Apart from drug efflux mechanism, P-gp regulates the export of signaling molecules that assist tumor cell migration (Saxena et al., 2011). It has been well documented that ABC transporters have a direct role during tumor progression through cancer cell migration and invasion (Velasco-Velázquez et al., 2011). Overexpression of P-gp confers survival advantage against chemotherapeutic agents encountered in the transiting tumor microenvironments. P-gp regulates the export of signaling molecules that may assist their migration (Saxena et al., 2011). Present study confers survival advantage of KB ChR8-5 cells against paclitaxel treatment due to P-gp overexpression. Conversely, ferulic acid and paclitaxel combination effectively inhibits cell migration in resistant KB ChR8-5 cells indicates the chemosensitizing potential of ferulic acid. In this study, the combination of ferulic acid-paclitaxel treatment induced significant cell cycle arrest at G2/M phase. This strongly advocates that ferulic acid treatment potentiate the capability of paclitaxel to induce G2/M arrest to overcome the P-gp mediated drug resistance. Similarly, dietary phytochemicals like resveratrol and curcumin analogs increase the availability
of paclitaxel to induce G2/M arrest of drug resistant cells (Lee, K et al., 2014; Gupta et al., 2011). Paclitaxel sensitizing effect of ferulic acid may be due to modulating one or more mechanisms of chemoresistance i.e. inducing apoptotic pathways, downregulating P-gp expression and inhibiting its transport function. In this study, we found that ferulic acid inhibits the transport function of P-gp in KB ChR8-5 cells. Further, docking studies reveals that ferulic acid interacts weakly within the drug binding pocket of homology modeled P-gp. Hence, ferulic acid was unable to completely inhibit its transport function and this may be probably due to its smaller molecular size and lipophilicity. However, curcumin, a dimer of ferulic acid, has been reported to inhibit P-gp transport function in drug resistant KB cell lines which may be due to its dimer size (Anuchapreeda et al., 2002). The tryptophan fluorescence measurement data indicate that ferulic acid can interact with P-gp. The 3-methoxy and more importantly 4-hydroxyl group of ferulic acid may be involved in polar interactions with P-gp (Klopman et al., 1997). Ferulic acid possesses different structural motifs that can interact with enzymes, transcription factors and transporters. The inhibitory effects of ferulic acid with cyclooxygenase-2 through the phenolic hydroxyl bond were previously studied by bond dissociation enthalpy (BDE) and semi-empirical molecular orbital and ab initio methods (Murakami et al., 2005) The expression pattern of major drug resistance ABC transporters i.e. ABCB1, ABCC1, ABCC2, ABCC3, ABCCC5 and ABCG2 among all the 48 ABC transporters were analyzed in KB ChR8-5 cell line. It has been found that only ABCB1was overexpressed in KB ChR8-5 cells. Generally, colchicines resistant KB cells typically overexpress P-gp and no other ABC transporters (Shen et al., 1986). Phytochemicals can overcome chemoresistance in tumor cells by down-regulating drug transporters (Kitagawa, 2006; Fantini et al., 2015). In this study, ABCB1 overexpression, both mRNA as well as protein level, was downregulated by ferulic acid
treatment in a concentration dependent manner in the resistant cells. Ferulic acid might modulate transcription factors which are involved in the P-gp overexpression. Previously it has been reported that curcumin decreased MDR1 mRNA levels through modulating transcription factors in KB cells (Kitagawa et al., 2004). Ferulic acid is a potential transcriptional regulator, apart from its antioxidant potential, involved in the modulation of variety of cellular stress response elements (Fetoni et al., 2010). The mechanism by which ferulic acid downregulates P-gp expression might be due to the activation of Nrf2 and its translocation from cytosol to the nucleus. Previsously, ferulic acid modulates hemeoxygenase-1 (HO-1) expression through activation of Nrf2 and its translocation from cytosol to the nucleus (Catino et al., 2016). Apart from downregulation of P-gp overexpression, ferulic acid pretreatment also induces paclitaxel-mediated apoptosis in drug resistant cell lines. Paclitaxel can induce apoptosis by activating signal transduction factors besides its effect on cell cycle arrest (Sakai et al., 2014). Paclitaxel triggers apoptosis mainly through CDKN1A, which encodes a strong cyclin-dependent kinase inhibitor; it binds to and inhibits the activity of CDK2 and CDK4 activities and behaves as a regulator of cell cycle progression (Shah et al., 2011). The expression of CDKN1A is regulated by the tumor suppressor protein p53. In this study, either paclitaxel alone or ferulic acid alone treatments does not induce the expression of either CDKN1A or p53 in the drug resistant cells. Conversely, combination of ferulic acid-paclitaxel treatment upregulates p53, CDKN1A expression and downregulates Bcl-xL expression in KB resistant cells. The overexpression of CDKN1A in tumor cells, suppresses colony formation in resistant cancer cells related to that p53 overexpression (Liu et al., 2003). It has been previously reported that the MDR1 promoter be able to affected by p53 and downregulates endogenous MDR1 gene expression (Zastawny, 1993). In this study, ferulic acid
sensitizes paclitaxel mediated p53 expression which subsequently downregulates ABCB1 expression and induces apoptotic events. Thus, ferulic acid enhanced paclitaxel cytotoxicity in Pgp overexpressing multidrug resistant KB ChR8-5 cell lines by downregulating ABCB1 expression and promoting paclitaxel mediated G2/M arrest and apoptotic cell death. To date there are no sufficient clinical studies demonstrating the efficacy and safety of new formulations based on natural phytochemicals and therapeutic drugs (Mancuso and Santangelo, 2014; Mancuso et al., 2015). The potential interaction of ferulic acid with drug metabolizing enzymes, which is a common feature of phenolic acid derivatives, has to be investigated before claiming this phenolic acid as a potential chemosensitizing agent. Moreover, further studies required to reveal the mechanism of downregulation of ABCB1 expression by ferulic acid in drug resistant cancer cell lines.
Conflict of interest None declared. Acknowledgement This research was supported by the Department of Science and Technology, New Delhi. DST Grant no. SR/SO/BB – 0034.
References Anuchapreeda, S., Leechanachai, P., Smith, M.M., Ambudkar, S.V., Limtrakul, P., 2002. Modulation of P-glycoprotein expression and expression by curcumin in multidrug resistant human KB cells. Biochemical Pharmacology 64, 573-582. Baguley, B.C., 2010. Multidrug resistance in cancer. Methods Mol. Biol. 596, 1−14. Barbuti, Z. M., Chen, Z. S., 2015. Paclitaxel Through the Ages of Anticancer Therapy: Exploring Its Role in Chemoresistance and Radiation Therapy. Cancers (Basel) 7(4): 2360– 2371. Baskic, D., Popović, S., Ristić, P., Arsenijević, N.N., 2006. Analysis of cyclohexamide-induced apoptosis in human leukocytes: Fluorescence microscopy using annexin V/propidium iodide versus acridine orange/ethidium bromide. Cell Biol. Int. 30, 924–932. Binkhathlan, Z., Lavasanifar, A. P-glycoprotein inhibition as a therapeutic approach for overcoming multidrug resistance in cancer: current status and future perspectives. Curr Cancer Drug Targets. 2013 Mar;13(3):326-46. Catino, S., Paciello, F., Miceli, F., Rolesi, R., Troiani, D., Calabrese, V., Santangelo, R., Mancuso, C., 2016. Ferulic Acid Regulates the Nrf2/Heme Oxygenase-1 System and Counteracts Trimethyltin-Induced Neuronal Damage in the Human Neuroblastoma Cell Line SH-SY5Y. Front Pharmacol. 8, 6:305. Coley, H.M., 2010. Overcoming multidrug resistance in cancer: clinical studies of p-glycoprotein inhibitors. Methods Mol. Biol. 596, 341−358. Dean, M., Hamon, Y., Chimini, G., 2001. The human ATP-binding cassette (ABC) transporter super family. J. Lipid Res. 42, 1007− 1017.
DeLano, W.L., 2002. PYMOL- a molecular graphics system. DeLano Scientific: San Carlos, CA, USA. Di Domenico, F., Foppoli, C., Coccia, R., Perluigi, M., 2012. Antioxidants in cervical cancer: chemopreventive and chemotherapeutic effects of polyphenols. Biochim. Biophys. Acta. 1822(5), 737-47. Doyle, L.A., Yang, W., Abruzzi, L.V., Krogmann, T., Gao, Y., Rishi, A.K., Ross, D.A., 1998. Multidrug resistance transporter from human MCF-7 breast cancer cells. Proc. Natl. Acad. Sci. USA. 95 (26), 15665-70. Fanale, d., Bronte, G., Passiglia, F., Calò, V., et al., 2015. Stabilizing versus Destabilizing the Microtubules: A Double-Edge Sword for an Effective Cancer Treatment Option?. Anal Cell Pathol (Amst) 19, 204. Fantini, M., Benvenuto, M., Masuelli, L., Frajese, G.V., Tresoldi, I., Modesti, A., Bei, R., 2015. In vitro and in vivo antitumoral effects of combinations of polyphenols, or polyphenols and anticancer drugs: perspectives on cancer treatment. Int. J. Mol. Sci. 16(5), 9236-82. Fetoni, A.R., Mancuso, C., Eramo, S.L., Ralli, M., Piacentini, R., Barone, E., Paludetti, G., Troiani, D., 2010. In vivo protective effect of ferulic acid against noise-induced hearing loss in the guinea-pig. Neuroscience 169(4), 1575-88. Franken, N.A., Rodermond, H.M., Stap, J., Haveman, J., van Bree, C., 2006. Clonogenic assay of cells in vitro. Nat. Protoc. 1(5), 2315-9. Glide. Version 5.5. 2009, Schrodinger, LLC, New York, NY. Gottesman, M.M., Fojo, T., Bates, S.E., 2002. Multidrug resistance in cancer: role of ATPdependent transporters. Nat. Rev. Cancer 2(1),48-58.
Gupta, S. C., Kannappan, R., Reuter, S., Kim, J.H., Aggarwal, B.B., 2011. Chemosensitization of tumors by resveratrol. Ann. N. Y. Acad. Sci. 1215, 150–160. Hossam M. A., Ahmed M. A., El-Dine, R. S., El-Halawany, A. M., 2015. P-glycoprotein inhibitors of natural origin as potential tumor chemo-sensitizers: A review. J Adv Res. 6(1), 45–62. Hudson, E.A., Dinh, P.A., Kokubun, T., Simmonds, M.S., Gescher, A.C., 2000. Characterization of potentially chemopreventive phenols in extracts of brown rice that inhibit the growth of human breast and colon cancer cells. Cancer Epidemiol. Biomark. Prev. 9, 1163–1170 Jayaprakasam, B., Vanisree, M., Zhang, Y., Dewitt, D.L., Nair, M.G., 2006. Impact of alkyl esters of caffeic and ferulic acids on tumor cell proliferation, cyclooxygenase enzyme, and lipid peroxidation. J. Agric. Food Chem. 54, 5375–5381. Juliano, R.L., Ling, V.A., 1976. Surface glycoprotein modulating drug permeability in Chinese hamster ovary cell mutants. Biochim. Biophys. Acta. 455, 152−162. Karthikeyan, S., Kanimozhi, G., Prasad, N.R., Mahalakshmi, R., 2011. Radiosensitizing effect of ferulic acid on human cervical carcinoma cells in vitro. Toxicol In Vitro 25(7), 1366-75. Kitagawa, S., Nabekura, T., Kamiyama, S., 2004. Inhibitions of P-glycoprotein function by tea catechins in KB-C2 cells. J. Pharm. Pharmacol. 56(8), 1001-5. Kitagawa. S., 2006. Inhibitory Effects of Polyphenols on P-Glycoprotein-Mediated Transport. Biol. Pharm. Bull. 29(1), 1- 6. Klopman, G., Shi, L.M., Ramu, A. 1997. Quantitative structure-activity relationship of multidrug resistance reversal agents. Mol Pharmacol. 52(2), 323-34.
Lee, K et al., 2014 Effect of coumarin derivative-mediated inhibition of P- glycoprotein on oral bioavailability and therapeutic efficacy of paclitaxel. Eur. J. Pharmacol. 723: 381-8. Liu, R., Siemiarczuk, A., Sharom, F.J. 2000 . Intrinsic fluorescence of the P-glycoprotein multidrug transporter: sensitivity of tryptophan residues to binding of drugs and nucleotides. Biochemistry 39(48), 14927-38. Liu, S, Bishop, W.R., Liu, M., 2003. Differential effects of cell cycle regulatory protein p21 (WAF1/Cip1) on apoptosis and sensitivity to cancer chemotherapy. Drug Resist. Updat. 6(4),183-95. Mancuso, C., 2015. Key factors which concur to the correct therapeutic evaluation of herbal products in free radical-induced diseases. Front Pharmacol. 22, 6:86. Mancuso, C., Santangelo, R., Ferulic acid: pharmacological and toxicological aspects. Food Chem Toxicol. 65, 185-95. Mori, H., Kawabata, K., Yoshimi, N., Tanaka, T., Murakami, T., Okada, T., Murai, H., 1999. Chemopreventive effects of ferulic acid on oral and rice germ on large bowel carcinogenesis. Anticancer Res. 19, 3775-3778. Murakami, Y., Ito, S., Atsumi, T., Fujisawa, S. 2005. Theoretical prediction of the relationship between phenol function and COX-2/AP-1 inhibition for ferulic acid-related compounds. In Vivo 19(6), 1039-43. Orr, G.A., Verdier-Pinard, P., McDaid, H., Horwitz, S.B., 2003. Mechanisms of Taxol resistance related to microtubules. Oncogene 22, 7280-7295. Prasad, N.R., Muthusamy, G., Shanmugam, M., Ambudkar, S.V., 2016 South Asian Medicinal Compounds as Modulators of Resistance to Chemotherapy and Radiotherapy. Cancers 8, 32.
Ramanathan, B., Jan, K.Y., Chen, C.H., Hour, T.C., Yu, H.J., Pu, Y.S., 2005. Resistance to paclitaxel is proportional to cellular total antioxidant capacity. Cancer Res. 65, 8455-8460. Rowinsky, E.K., Donehower, R.C., 1995. Paclitaxel (taxol). N. Engl. J. Med. 332, 1004-1014. Sakai, R., Morikawa, Y., Kondo, C., Oka, H., Miyajima, H., Kubo, K., Uehara, T., 2014. Combinatorial measurement of CDKN1A/p21 and KIF20A expression for discrimination of DNA damage-induced clastogenicity. Int. J. Mol. Sci. 15(10), 17256-69. Sarkadi, B., Homolya, L., Szakács, G., Váradi, A., 2006. Human multidrug resistance ABCB1 and ABCG2 transporters: participation in a chemoimmunity defense system. Physiol. Rev. 86, 1179−1236. Saxena, M., Stephens, M.A., Pathak, H., Rangarajan, A., 2011. Transcription factors that mediate epithelial-mesenchymal transition lead to multidrug resistance by upregulating ABC transporters. Cell Death Dis. 7, 2:e179. Schrodinger Suite. The induced Fit Docking protocol Schrodinger, LLC, New York, NY. (2009). Shah, M.A., Schwartz, G.K., 2011. Cell cycle-mediated drug resistance: an emerging concept in cancer therapy. Clin. Cancer Res. 7(8), 2168-81. Shanthakumar, J., Karthikeyan, A., Bandugula, V.R., Rajendra Prasad N., 2012. Ferulic acid, a dietary phenolic acid, modulates radiation effects in Swiss albino mice. Eur. J. Pharmacol. 691(1-3), 268-74. Shen, D.W., Fojo, A., Chin, J.E., Roninson, I.B., Richert, N., Pastan, I., Gottesman, M.M., 1986. Human multidrug-resistant cell lines: increased mdr1 expression can precede gene amplification. Science 232(4750), 643-5. Singh, S., Prasad, N,R., Chufan, E,E., Patel, B.A., Wang, Y,J., Chen, Z,S., Ambudkar, S,V., Talele, T.T., 2014. Design and synthesis of human ABCB1 (P-glycoprotein) inhibitors by
peptide coupling of diverse chemical scaffolds on carboxyl and amino termini of (S)-valinederived thiazole amino acid. J. Med. Chem. 57(10), 4058-72. Sodani, K., Patel, A., Kathawala, R.J., Chen, Z.S., 2012. Multidrug resistance associated proteins in multidrug resistance. Chin. J. Cancer 31, 58−72. Tiberghien, F., Loor, F., 1996. Ranking of P-glycoprotein substrates and inhibitors by a calceinAM fluorometry screening assay. Anticancer Drugs 7, 568-578. Trombino, S., Cassano, R., Ferrarelli, T., Barone, E., Picci, N., Mancuso, C., 2013. Trans-ferulic acid-based solid lipid nanoparticles and their antioxidant effect in rat brain microsomes. Colloids Surf. B Biointerfaces 109, 273-9. Tsuruo, T., Iida, H., Tsukagoshi, S., Sakurai, Y., 1981. Overcoming of vincristine resistance in P388 leukemia in vivo and in vitro through enhanced cytotoxicity of vincristine and vinblastine by verapamil. Cancer Res. 41: 1967−1972. Velasco-Velázquez, M.A., Popov, V.M., Lisanti, M.P., Pestell, R.G., 2011. The role of breast cancer stem cells in metastasis and therapeutic implications. Am. J. Pathol. 179(1), 2-11. Wallace, A.C., Laskowski, R.A., Thornton, J.M., 1995. LIGPLOT: A program to generate schematic diagrams of protein-ligand interactions. Prot. Eng. 8(2), 127-34. Yang, X., Feng, Y., Gao, Y., Shen, J., Choy, E., Cote, G., Harmon, D., Zhang, Z., Mankin, H., Hornicek, F.J., Duan, Z., 2015. NSC23925 prevents the emergence of multidrug resistance in ovarian cancer in vitro and in vivo. Gynecol Oncol. 137(1), 134-42. Zambetti, G.P., Levine, A.J., 1993. A comparison of the biological activities of wild-type and mutant p53. FASEB J. 7(10), 855-65.
Zastawny, R.L., Salvino, R., Chen, V., Benchimol, S., Ling, V., 1993. The core promoter region of the P-glycoprotein gene is sufficient to confer differential responsiveness to wild-type and mutant p53. Oncogene 8(6), 1529-35. Zhang, D.M., Shu, C., Chen, J.J., Sodani, K., Wang, J., Bhatnagar, J., Lan, P., Ruan, Z.X, Xiao, Z.J., Ambudkar, S.V., Chen, W.M., Chen, Z.S., Ye, W.C., 2012. BBA, a derivative of 23hydroxybetulinic acid, potently reverses ABCB1-mediated drug resistance in vitro and in vivo. Mol Pharm. 9(11), 3147-59.
Fig. 1 (A). Ferulic acid pretreatment enhances the cytotoxicity of paclitaxel in KB ChR8-5 cells. KB and KB ChR8-5 cells were treated with various concentrations of paclitaxel in the presence or absence of ferulic acid for 72 h. Concentration-dependent curves of paclitaxel with or without ferulic acid in KB and drug resistant KB ChR8-5 cells. Points with error bars represent the mean ± S.E.M. Fig. 1 (B). Ferulic acid pretreatment enhances the cytotoxicity of paclitaxel in HEK293 and HEK293/ABCB1 cells. HEK293 and HEK293/ABCB1 cells were treated with various concentrations of paclitaxel in the presence or absence of ferulic acid for 72 h. Concentrationdependent curves of paclitaxel with or without ferulic acid in HEK293 and transfected HEK293/ABCB1 cells. Points with error bars represent the mean ± S.E.M. Fig. 2 Effect of ferulic acid and paclitaxel on (A). Clonogenic cell survival (B). Apoptotic incidence by ethidium bromide and acridine orange staining. Values are given as means ± S.E.M. of six experiments in each group. Values not sharing a common marking (*, **, ***. . .) differ significantly at P < 0.05 vs. control (DMRT).
Fig. 3 Effect of ferulic acid and paclitaxel on cell migration assay. Photomicrographs represents distance migrated by cells during different experimental conditions. Images of the wounds were taken at 0 and 24 h. Fig. 4 Ferulic acid treatment potentiates G2/M arrest in paclitaxel-treated KB ChR8-5 cells. (A, B) KB ChR8-5 cells were treated with 0.1 µM of paclitaxel alone or in combination with 10 µM ferulic acid for 24 h. After staining with propidium iodide, cell cycle stages were analyzed by FACS. Fig. 5 Analysis of P-gp mediated membrane transport function. (A). Fluorescent images of calcein-AM and rhodamine-123 accumulation in KB ChR8-5 cells. (B). KB ChR8-5 cells were assayed for calcein-AM and rhodamine-123 transport in the presence of increasing concentrations of ferulic acid. Fig. 6 (A). Molecular docking of ferulic acid with P-gp. The docking score of FA was found to be -6.305182 and Glide energy was observed as -28.753043. Ferulic acid shows hydrogen bonding and hydrophobic interaction with TMD region of P-gp. (B). Binding interaction of ferulic acid with purified P-gp by tryptophan fluorescence quenching. The data represent mean ± S.E.M. of three independent experiments. Fig. 7 (A) (i) ABCB1 gene expression in KB and KB ChR8-5 cells (ii) Effect of ferulic acid on ABCB1 expression in KB ChR8-5 cells (iii) Expression are normalized with GAPDH and β -actin, respectively. (B) (i) P- gp protein expression in KB and KBChR8-5 cells (ii) Effect of ferulic acid on P-gp expression in KB ChR8-5 cells. (iii) Expression are normalized with GAPDH and β- actin, respectively. Values are given as means ± S.E.M. of three experiments in each group. Values not sharing a common marking (*,**,***. . .) differ significantly at P < 0.05 vs. control (DMRT).
Fig. 8 Effect of ferulic acid and/or paclitaxel in KB ChR8-5 cells. After different treatment condition total cellular mRNA was isolated and reverse transcribed. The mRNA levels of 13 genes involved in drug resistance, apoptosis and cell cycle mediated pathway were detected using custom PCR array by following the manufacturer’s instructions. The clustergram results were analyzed using the SA Biosciences online tool. The mRNA expression levels were analyzed three independent experiments. Fig. 9 The proposed mechanism for chemosensitizing potential of ferulic acid in drug resistant KB ChR8-5 cells. Ferulic acid downregulates P-gp expression thereby induces paclitaxel mediated cell cycle arrest and induces apoptotic cell death.
Arrows indicate upregulation of
expression. Arrows indicate downregulation of expression. -Ferulic acid,
- Paclitaxel
Table: 1A Compound
KB ChR8-5
KB FRb
IC50 ± S.E.M.α (μM)
IC50 ± S.E.M.α (µΜ)
FRb
Paclitaxel
0.1 ± 0.01
[ 1.0]
3 ± 0.20
[ 30.0]
+ FA (10 uM)
0.09 ± 0.03
[ 0.9]
1.6 ± 0.05
[ 16.0]
+ FA (20 uM)
0.08 ± 0.01
[ 0.8]
0.14 ± 0.01
[ 1.4]
+ FA (30 uM)
0.08 ± 0.05
[ 0.8]
0.09 ± 0.01
[0.9]
α
IC50, concentration of ferulic acid required for 50% inhibition of cell survival were calculated
from the killing curves shown in table. Mean values ± S.E.M. are from six independent experiments, each performed in triplicate. bFR: fold-resistance was calculated by dividing the IC50 value for paclitaxel of KB and KB ChR8-5 cells in the absence or presence of ferulic acid by IC50 value for paclitaxel of parental KB cells.
Table: 1B Compound
HEK293 IC50 ± S.E.M.α (μM)
HEK293/ABCB1 FRb
IC50 ± S.E.M.α (µΜ)
FRb
Paclitaxel
0.065 ± 0.003
[ 1.0]
4.67± 0.20
[ 71.53]
+ FA (10 uM)
0.065 ± 0.003
[ 1.0]
2.5 ± 0.05
[ 38.46]
+ FA (20 uM)
0.064 ± 0.001
[ 1.0]
1.14 ± 0.01
[ 17.53]
+ FA (30 uM)
0.065 ± 0.003
[ 1.0]
0.51 ± 0.01
[7.84]
α
IC50, concentration of ferulic acid required for 50% inhibition of cell survival were calculated
from the killing curves shown in table. Mean values ± S.E.M. are from six independent experiments, each performed in triplicate. bFR: fold-resistance was calculated by dividing the IC50 value for paclitaxel of HEK293 and HEK293/ABCB1 cells in the absence or presence of ferulic acid by IC50 value for paclitaxel of parental HEK293 cells.
Figure Click here to download high resolution image
Figure Click here to download high resolution image
Figure Click here to download high resolution image
Figure Click here to download high resolution image
Figure Click here to download high resolution image
Figure Click here to download high resolution image
Figure Click here to download high resolution image
Figure Click here to download high resolution image
Figure Click here to download high resolution image
Figure Click here to download high resolution image
Figure Click here to download high resolution image
PII: DOI: Reference:
S0014-2999(16)30328-4 http://dx.doi.org/10.1016/j.ejphar.2016.05.023 EJP70650
To appear in: European Journal of Pharmacology Received date: 13 April 2016 Revised date: 18 May 2016 Accepted date: 19 May 2016 Cite this article as: Ganesan Muthusamy, Agilan Balupillai, Karthikeyan Ramasamy, Mohana Shanmugam, Srithar Gunaseelan, Beaulah Mary and N. Rajendra Prasad, Ferulic acid reverses ABCB1-mediated paclitaxel resistance in MDR cell lines, European Journal of Pharmacology, http://dx.doi.org/10.1016/j.ejphar.2016.05.023 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Ferulic acid reverses ABCB1-mediated paclitaxel resistance in MDR cell lines
Ganesan Muthusamy, Agilan Balupillai, Karthikeyan Ramasamy, Mohana Shanmugam, Srithar Gunaseelan, Beaulah Mary, N. Rajendra Prasad* Department of Biochemistry and Biotechnology, Annamalai University, Annamalainagar – 608002, Tamilnadu, India.
*
Corresponding author. [email protected]. Department of Biochemistry and Biotechnology. Annamalai University. Annamalainagar – 608002. Tel: +91-9842305384. Fax: +91-04144-238080
Abstract Multidrug resistance (MDR) remains a major obstacle in cancer chemotherapy. The use of the dietary phytochemicals as chemosensitizing agents to enhance the efficacy of conventional cytostatic drugs has recently gained the attention as a plausible approach for overcoming the drug resistance. The aim of this study was to investigate whether a naturally occurring diet-based phenolic acid, ferulic acid, could sensitize paclitaxel efficacy in ABCB1 overexpressing (P-glycoprotein) colchicine selected KB ChR8-5 cell line. In vitro drug efflux assays demonstrated that ferulic acid inhibits P-glycoprotein transport function in drug resistant KB ChR8-5 cell lines. However, ferulic acid significantly downregulates ABCB1 expression in a concentration dependent manner. Cytotoxicity assay reveals that ferulic acid decreased paclitaxel resistance in KBChR8-5 and HEK293/ABCB1 cells, which indicates its chemosensitizing potential. Clonogenic cell survival assay and apoptotic morphological staining further confirm the chemosensitizing potential of ferulic acid in drug resistant KB ChR8-5 cell lines. Ferulic acid treatment enhances paclitaxel mediated cell cycle arrest and upregulates paclitaxel-induced
apoptotic signaling in KB resistant cells. Hence, it has been concluded that downregulation of ABCB1 and subsequent induction of paclitaxel-mediated cell cycle arrest and apoptotic signaling may be the cause for the chemosensitizing potential of ferulic acid in P-gp overexpressing cell lines. Keywords: Multidrug resistance; P-glycoprotein; Ferulic acid; Paclitaxel; Apoptosis; Cell cycle.
1. Introduction Multidrug resistance (MDR) is a significant obstruction for effective cancer chemotherapy and a major mechanism of resistance in cancer cells to many structurally and functionally unrelated drugs (Baguley, 2010). Overexpression of ATP-binding cassette (ABC) transporters in cancer cells has been reported as one of the most important factor linked to MDR (Sodani et al., 2012). Membrane P-glycoprotein (P-gp/ABCB1/MDR1) is the major contributor of multidrug resistance during cancer chemotherapy (Dean et al., 2001; Juliano et al., 1976). Accumulated evidences prove that P-gp pumps out a variety of anticancer drugs, such as anthracyclines, topoisomerase inhibitors, vinca alkaloids and taxanes, thereby reducing intracellular drug retention, resulting in chemotherapeutic drug resistance (Sarkadi et al., 2006; Coley, 2010). Therefore, inhibition of P-gp may resensitize the MDR cancer cells to the treatment of anticancer drugs. Currently available P-gp inhibitors show adverse toxic effects and accumulate chemotherapeutic drugs; hence there is a need for potent P-gp inhibitor/modulator to
reverse the clinical cancer multidrug resistance (Rowinsky, 1995; Hossam, et al., 2015). The combination of anticancer drugs with natural products shows efficacy and low toxicity to reverse MDR. Phytochemicals were investigated for their P-gp modulation/inhibition in several experimental MDR models (Prasad, et al., 2016; Di Domenico et al., 2012). Paclitaxel is a naturally occurring antineoplastic agent that is widely used in the treatment of a variety of solid tumors. It is a well-known mechanism that paclitaxel is a unique antimicrotubule agent guide to a mitotic block in the late G2/M-phase of the cell cycle (Fanale et al., 2015). The emergence of resistance remains an important problem and a major drawback associated with paclitaxel treatment (Yang, et al., 2015). There are numerous mechanisms have been reported to paclitaxel resistance and one important contributor is the overexpression of membrane P-gp (Orr et al., 2003; Ramanathan et al., 2005). Hence, modulation of membrane Pglycoprotein function/expressions seems to be a novel approach to overcome paclitaxel resistance in MDR cell lines. Ferulic acid, [FA (3-methoxy-4-hydroxycinnamic acid)], is a dietary phytochemical mainly present in the leaves and seeds of plants such as wheat, rice and barley (Jayaprakasam et al., 2006). Ferulic acid is a simple phenolic acid showed antitumor, chemopreventive and photoprotective properties in different experimental models (Hudson et al., 2000; Mori et al., 1999; Ambothi et al., 2015). Previously, we reported the radiosensitizing and radioprotective effect of ferulic acid on various human cervical cancer cell lines (Santhakumar et al., 2012 Karthikeyan at al., 2011). In this study, we investigated the chemosensitizing potential of ferulic acid in colchicine-resistant ABCB1 overexpressing KB ChR8-5 cell lines. 2. Materials and methods
2. 1. Cell culture P-gp overexpressing KB ChR 8-5 cell lines and its parental KB cell lines were purchased from NCCS, Pune. The cells were cultured in DMEM (Sigma) with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (Invitrogen). KB ChR8-5 cells were grown in the presence of 10 ng/ml colchicine. The parental cell line HEK293 and HEK/ABCB1 transfected with human ABCB1 cDNA were maintained in the DMEM with G418 (2 mg/ml) (Zhang, et al., 2012) and cultured in a similar manner. All cells were grown as adherent monolayers in drug-free culture media for more than 2 weeks before the assay.
2.2. Preparation of drug Ferulic acid (1 mM) was dissolved in dimethylsulphoxide (0.05% DMSO) and the solution was prepared freshly on a daily basis. Further dilution was made in culture media to obtain the desired concentrations. The final concentrations of DMSO in the culture medium were not more than 0.01% (v/v). 2.3. Cytotoxicity determination by MTT Assay MTT colorimetric assay was conducted to detect the chemosensitivity of cells to paclitaxel by ferulic acid in vitro (Singh et al., 2014). Briefly, 5000−6000 cells/well were seeded in 96-well plates and incubated at 37 °C, 5% CO2 for 24 h. Cells were pre-incubated with or without ferulic acid for 2 h and then different concentrations of paclitaxel were added into designated wells. After 72 h of incubation at 37 °C, 20 μL of MTT solution (4 mg/ml) was added
to each well. The plates were further incubated for 4 h at 37 °C. Consequently, without disturbing the cells the MTT medium was removed from each well, and 100 μl of DMSO was added into each well to dissolve the formazan crystals. The absorbance was determined at 570 nm by microplate reader (Tecan Multimode Reader, Austria). The assays were performed four times independently and each independent experiment was done in triplicate. 2.4. Colony formation assay Clonogenic assay or colony formation assay is an in vitro cell survival assay based on the capability to grow a single cell into a colony (Franken et al., 2006). KB and KB ChR8-5 cells were seeded in 6 cm dishes and allowed to adhere overnight at 37 ; C, consequently the cells were treated with ferulic acid and paclitaxel for 48 h incubation. After incubation the cells were reseeded in the 6 well plates and subsequently incubated for 10-14 days in drug free medium. The colonies were then fixed for 15 min with methanol-acetic acid (3:1) and stained with crystal violet (1%) for 30 min after which time residual staining solution was removed and plates were washed with water. After staining the colonies were counted.
PE =
no. of colonies formed ´100% no. of cells seeded
2.5. Fluorescence microscopic analysis of cell death We used acridine orange/ethidium bromide (AO/EtBr) double staining for apoptosis detection by morphological observation (Baskic et al., 2006). Briefly, acridine orange is taken up by both viable and nonviable cells and emits green fluorescence. Ethidium bromide is taken up only by nonviable cells and emits red fluorescence by intercalation into DNA. Cells were treated with ferulic acid and paclitaxel for 24 h. After treatment 20 µl of dye mixture was added to the
treated cells and immediately cells were examined under a Nikon inverted fluorescent microscope. Untreated cells serves as control and the results were expressed as mean ± S.E.M. for three independent determinations. 2.6. Wound healing assay Cell migration in the presence of ferulic acid and paclitaxel was tested using a woundhealing assay. In this experiment, cells were grown to confluence and an incision was made in the center of the plate. Equal number of live cells was seeded in 6 well plates. Ferulic acid and paclitaxel treatment was carried out, when cells were at 90% confluent. Then wounds were made in cells using a P-200 pipette tip. Microphotographs were taken at 0 and 24 h of incubation (Saxena et al., 2011). 2.7. Cell cycle analysis The cells (3.2×105 per well) were plated in 6-well plates and treated with combinations of ferulic acid and paclitaxel. Adherent and detached cells were harvested by trypsinization, and fixed in ice-cold 70% ethanol for at least 1h. The cell pellets were washed twice with cold phosphate-buffered saline (PBS) and incubated for 30 min at room temperature in 1 ml PBS containing 50 μg propidium iodide (Sigma-Aldrich), 0.1% Triton X-100, 1 mM EDTA and 0.5 mg RNaseA. After staining, the samples were analyzed using FACS Aria III (BD Biosciences). 2.8. Calcein-AM and rhodamine123 efflux assay The capability of the ferulic acid to inhibit the transport function of P-gp was analysed using calcein–AM and rhodamine-123, as described previously (Tiberghien et al., 1996). Briefly,
the drug resistant cells were trypsinized and incubated with different concentrations of ferulic acid subsequently incubated with calcein-AM (0.5 μM) for 10 min and rhodamine-123 for 45 min in the dark at 37 ○C. The cells were washed with cold PBS and fluorescence produced by intracellular calcein and rhodamine-123 was measured using a spectrofluorometer equipped with an excitation 488 nm and emission 530 nm, respectively (Tecan, Multimode Reader, Austria). The results are reported as an average of two independent experiments, each done in triplicates. The percentage calcein-AM and rhodamine-123 efflux remaining was analysed and the IC50 of ferulic acid was calculated. 2.9. Molecular docking All computational works were performed on Red Hat Enterprise Linux EL-5 workstation using the molecular modeling software Maestro (Schrodinger LLC 2009, USA). GLIDE-5.5 (Grid-based Ligand Docking with Energetics) searches were made for favorable docking interactions between ferulic acid with the homology modeled P-glycoprotein. The human P-gp homology model based on mouse P-gp in apoprotein state was generously provided by Dr. S. Aller (The University of Alabama at Birmingham, Birmingham, AL). All the molecular modeling simulations were carried out using OPLS-AA (Optimized Potential Liquid Simulation for All Atom) force field (Glide, 2009). PyMOL (Delano, 2002) software was used for graphical visualization, analyzing hydrogen bond interactions and producing quality images. Hydrophobic contacts were observed between protein and ligand using Ligplot software (Wallace et al., 1995). 2.10. Analysis of ferulic acid binding affinity with P-gp by tryptophan fluorescence quenching
DF / F0 ´100 =
DF / Fmax ´ (100) ´ [ S ] Kd + [S ]
The affinity of binding of ferulic acid to purified Pgp was determined using Trp quenching as described previously (Liu et al., 2000). Briefly, purified Pgp (50 μg in 0.5 ml) was titrated in 2 mM CHAPS buffer with increasing concentrations of ferulic acid, while quenching of Trp fluorescence was monitored at 330 nm following excitation at 290 nm. Kd and ΔFmax values were extracted following fitting of the data to an equation describing binding to a single affinity site.
Where, (ΔF/F0×100) represents the percent change in fluorescence intensity relative to the initial value after addition of ferulic acid at a concentration [S], and (ΔFmax/F0×100) is the maximum percent quenching of the fluorescence intensity that occurs upon saturation of the substrate binding site.
2.11. Transcriptional analysis of ABCB1 expression The total RNA was extracted from KB ChR8-5 cells using RNeasy Mini kit (Qiagen, USA) as per the recommended protocol by the manufacturer. The mRNA expression of ABCB1/MDR1, in KB ChR8-5 cells was determined using real-time PCR (Eppendorff, Thermocycler, USA). The primer sequence was F: 5’ TGGAGGTAAGTGACCCAGGGCTG 3’and R: 5’ AGGCAATCCGATGCAGAGCCCA 3’. The expression levels of genes were normalized to 18S mRNA in each sample. The mean Ct values from triplicate measurements were used to calculate the relative gene expression using the 2−ΔΔCt formula. 2.12. PCR array
The total RNA content of the cells were isolated from ferulic acid and/or paclitaxel treated KB ChR8-5 cells using RNeasy mini kit (Qiagen, India) according to the manufacturer’s instruction and stored at -80 °C until used for gene expression by qRT-PCR arrays. The purity of the freshly isolated total RNA was measured by Nanodrop (Thermo Scientific) and total RNA was employed for the gene expression analysis. The cDNA was reverse transcribed from RNA using the First Strand cDNA Synthesis Kit (Qiagen reverse transcriptase kit). The relative expression pattern of 13 genes related to drug resistance, apoptosis and cell cycle regulation was analyzed by PCR array using RT2 real-time SYBR Green PCR master mix (Qiagen) on eppondrof realplex. The fold changes of gene expressions were analyzed and plotted as clustergram using SA Biosciences PCR array data analysis online tool (pcrdataanalysis.sabiosciences.com/pcr/arrayanalysis.php).
2.13. Western blotting KB or KB ChR8-5 cells were washed with ice-cold PBS, then cells were lysed with RIPA buffer for 30 min and centrifuged at 4 °C, 12,000 × g for 30 min. The supernatants were collected and protein concentration was determined using Nanodrop spectrophotometer (Thermo Scientific). Each sample with 50 μg protein was added with SDS sample buffer, and denatured at 95 °C for 5 min. Proteins were separated by 10 % SDS-PAGE electrophoresis and transferred to 0.45 μm nitrocellulose membrane. Membrane was blocked with 5 % bovine serum albumin for 1 h, and incubated with P-gp monoclonal antibodies at 4 °C overnight. Then the membrane was
incubated with secondary antibodies (Santa cruz, CA, USA) at room temperature for 1 h, washed with PBST three times, and detected with a chemiluminescent detecting system (Biorad). 3. Results 3.1. Paclitaxel sensitizing potential of ferulic acid in P-gp overexpressing KBChR 8-5 cell lines To determine whether ferulic acid could reverse P-gp mediated MDR, cell survival assays were performed in the presence or absence of ferulic acid using the parental KB and KB ChR 8-5 cell lines (Fig. 1A). KB ChR8-5 cell line showed 30 fold resistance to paclitaxel, as compared to the parental KB cell line (Table 1A). Ferulic acid significantly decreased the paclitaxel resistance in KB ChR8-5 cells as compared to the control KB cell line. The higher concentration of ferulic acid (30 μM) showed more potent reversal activity than 10 µM and 20 µM of ferulic acid. Similarly, we perfomed cell survival assays in the presence or absence of ferulic acid, using the parental HEK293 cell line and ABCB1-transfected HEK/ABCB1 cell line (Fig. 1B). HEK293/ABCB1 cell line showed 71 fold resistance to paclitaxel, as compared to the parental HEK293 cell line (Table 1B). Ferulic acid significantly decreased the paclitaxel resistance in HEK293/ABCB1 cells as compared to the control HEK293 cell line. The higher concentration of ferulic acid (30 μM) showed more potent reversal activity. 3.2. Effect of ferulic acid and paclitaxel on clonogenic cell survival and apoptotic morphological changes In KB cells paclitaxel alone treatment inhibits cell growth and decreases the colony formation. In KB ChR 8-5 cells paclitaxel alone treatment didn’t prevent the colony formation. Conversely, ferulic acid-paclitaxel combination significantly inhibits resistant cell survival and colony formation than paclitaxel alone treatment (Fig. 2). Further, we observed elevated apoptotic incidence (60%) during ferulic acid–paclitaxel treatment than ferulic acid alone (15%)
or paclitaxel alone treatment (20%). Further, ferulic acid-paclitaxel treated cells showed condensed nuclei, membrane blubbing and apoptotic bodies (Fig. 2). 3.3. Effect of ferulic acid and paclitaxel on cell migration in KB and KB ChR 8-5 cell lines Treatment with paclitaxel and paclitaxel-ferulic acid decreased cell migration in parental KB cells (Fig. 3). Whereas, paclitaxel alone treatment has not shown any inhibition of cell migration and wound healing in resistant cell lines. Conversely, ferulic acid–paclitaxel combination shown significant inhibition of cell migration in drug resistant KB ChR 8-5 cell lines. 3.4. Ferulic acid treatment potentiates G2/M arrest in paclitaxel-treated KB ChR 8-5 cells We examined the effect of ferulic acid on paclitaxel mediated cycle arrest at the G2/M phase in KB ChR8-5 cells. 0.1 µM of paclitaxel and 10 µM of ferulic acid showed no effect on the cell cycle at the G2/M phase (10.7% and 14.7%, respectively) in the drug resistant KB ChR8-5 cells. While ferulic acid pretreatment enhance the paclitaxel mediated arrest at G2/M phase of the cell cycle (up to 37.2%) in drug resistant KB ChR 8-5 cells (Fig. 4). 3.5. Calcein-AM and rhodamine-123 efflux assays Ferulic acid was evaluated for its capability to inhibit transport function of P-gp using calcein–AM and rhodamine123 efflux assays in KB ChR8-5 cells. Ferulic acid inhibits P-gp transport function in both the membrane efflux assays in a concentration dependant manner (Fig. 5). The higher concentration of ferulic acid (30 μM) showed 35% and 40% transport function inhibition in calcein–AM and rhodamine123 efflux assays, respectively. 3.6. Binding interaction of ferulic acid with P-glycoprotein The docking was carried out to understand binding interaction of ferulic acid with drug binding pocket of TMD region of homology modeled P-glycoprotein. Ferulic acid has showed inter- and
intra molecular interaction with active site residues of P-gp (Fig. 6 A). Induced Fit Docking (IFD) and glide energy of FA with P-gp was found to be -6.30 kcal/mol and -28.75 kcal/mol, respectively. The amino acid residue Tyr-310 shows hydrogen bond interaction (O-H...O) with ferulic acid whereas Phe 72, Met 69, Phe 732, Leu 975, Phe 336, Phe 983 shows hydrophobic bond interaction with ferulic acid. Trp quenching experiments were carried out using ferulic acid with purified P-gp. The results displayed considerable Trp quenching and the Kd values for binding of ferulic acid with P-gp was foud to be 10 µM (Fig. 6B). 3.7. Ferulic acid and/or PTX on ABCB1 and apoptotic gene expression in KB ChR 8-5 cells We observed overexpression of ABCB1in KB ChR8-5 cells when compared with parental KB cells (Fig. 7). Further, ferulic acid downregulates the expression pattern of ABCB1, at mRNA as well as protein level, in a dose dependent manner (Fig. 7). We also observed that ABC transporters such as ABCC1, ABCC2, ABCC3, ABCC5 and ABCG2 were not expressed in KB ChR8-5 cells (Fig. 8). Treatment with ferulic acid alone or paclitaxel alone did not alter the mRNA expression pattern of apoptotic and cell cycle signaling molecules such as p53, CDKN1A, CDK2, BCL-XL, BAX (Fig. 8) in drug resistant cell lines. The combination of paclitaxel and ferulic acid treatment downregulates CDK2, BCL-XL gene expression. Further, this combination upregulates p53, CDKN1A, BAX expression in KB ChR8-5 cells. 4. Discussion Multidrug resistance is a major barrier in cancer chemotherapy. The ATP-dependent efflux pump, primarily P-gp, decreases the intracellular concentration of various anticancer drugs in drug resistant cells (Gottesman et al., 2002). Downregulation of P-gp expression or inhibition of its transport function would be a novel approach to reverse multidrug resistance. In this study, we analyzed the chemosensitizing potential of ferulic acid in colchicine-selected drug resistant
KB cell line. Colchicine-selected KB ChR8-5 cell line is a typical P-gp overexpressing cell line (Shen et al., 1986). Further we analysed the chemosensitizing potential of ferulic acid with ABCB1 transfected HEK/ABCB1 cells. In this study, we observed ferulic acid pretreatment significantly induced paclitaxel mediated cell death in drug resistant KB ChR8-5 cells and transfected HEK/ABCB1 cells. It has been already documented that nanoformulations of ferulic acid could reduce the doses and improves the therapeutic efficacy (Trombino et al., 2013). Further, ferulic acid pretreatment promotes paclitaxel’s mediated apoptotic cell death and inhibits resistant cell colony formation. The induction of apoptosis in tumor cells plays a major role in chemotherapy induced cancer cell killing and blockade of the apoptosis might be a one of the mechanism for MDR of chemotherapy (Tsuruo et al., 2003). Apart from drug efflux mechanism, P-gp regulates the export of signaling molecules that assist tumor cell migration (Saxena et al., 2011). It has been well documented that ABC transporters have a direct role during tumor progression through cancer cell migration and invasion (Velasco-Velázquez et al., 2011). Overexpression of P-gp confers survival advantage against chemotherapeutic agents encountered in the transiting tumor microenvironments. P-gp regulates the export of signaling molecules that may assist their migration (Saxena et al., 2011). Present study confers survival advantage of KB ChR8-5 cells against paclitaxel treatment due to P-gp overexpression. Conversely, ferulic acid and paclitaxel combination effectively inhibits cell migration in resistant KB ChR8-5 cells indicates the chemosensitizing potential of ferulic acid. In this study, the combination of ferulic acid-paclitaxel treatment induced significant cell cycle arrest at G2/M phase. This strongly advocates that ferulic acid treatment potentiate the capability of paclitaxel to induce G2/M arrest to overcome the P-gp mediated drug resistance. Similarly, dietary phytochemicals like resveratrol and curcumin analogs increase the availability
of paclitaxel to induce G2/M arrest of drug resistant cells (Lee, K et al., 2014; Gupta et al., 2011). Paclitaxel sensitizing effect of ferulic acid may be due to modulating one or more mechanisms of chemoresistance i.e. inducing apoptotic pathways, downregulating P-gp expression and inhibiting its transport function. In this study, we found that ferulic acid inhibits the transport function of P-gp in KB ChR8-5 cells. Further, docking studies reveals that ferulic acid interacts weakly within the drug binding pocket of homology modeled P-gp. Hence, ferulic acid was unable to completely inhibit its transport function and this may be probably due to its smaller molecular size and lipophilicity. However, curcumin, a dimer of ferulic acid, has been reported to inhibit P-gp transport function in drug resistant KB cell lines which may be due to its dimer size (Anuchapreeda et al., 2002). The tryptophan fluorescence measurement data indicate that ferulic acid can interact with P-gp. The 3-methoxy and more importantly 4-hydroxyl group of ferulic acid may be involved in polar interactions with P-gp (Klopman et al., 1997). Ferulic acid possesses different structural motifs that can interact with enzymes, transcription factors and transporters. The inhibitory effects of ferulic acid with cyclooxygenase-2 through the phenolic hydroxyl bond were previously studied by bond dissociation enthalpy (BDE) and semi-empirical molecular orbital and ab initio methods (Murakami et al., 2005) The expression pattern of major drug resistance ABC transporters i.e. ABCB1, ABCC1, ABCC2, ABCC3, ABCCC5 and ABCG2 among all the 48 ABC transporters were analyzed in KB ChR8-5 cell line. It has been found that only ABCB1was overexpressed in KB ChR8-5 cells. Generally, colchicines resistant KB cells typically overexpress P-gp and no other ABC transporters (Shen et al., 1986). Phytochemicals can overcome chemoresistance in tumor cells by down-regulating drug transporters (Kitagawa, 2006; Fantini et al., 2015). In this study, ABCB1 overexpression, both mRNA as well as protein level, was downregulated by ferulic acid
treatment in a concentration dependent manner in the resistant cells. Ferulic acid might modulate transcription factors which are involved in the P-gp overexpression. Previously it has been reported that curcumin decreased MDR1 mRNA levels through modulating transcription factors in KB cells (Kitagawa et al., 2004). Ferulic acid is a potential transcriptional regulator, apart from its antioxidant potential, involved in the modulation of variety of cellular stress response elements (Fetoni et al., 2010). The mechanism by which ferulic acid downregulates P-gp expression might be due to the activation of Nrf2 and its translocation from cytosol to the nucleus. Previsously, ferulic acid modulates hemeoxygenase-1 (HO-1) expression through activation of Nrf2 and its translocation from cytosol to the nucleus (Catino et al., 2016). Apart from downregulation of P-gp overexpression, ferulic acid pretreatment also induces paclitaxel-mediated apoptosis in drug resistant cell lines. Paclitaxel can induce apoptosis by activating signal transduction factors besides its effect on cell cycle arrest (Sakai et al., 2014). Paclitaxel triggers apoptosis mainly through CDKN1A, which encodes a strong cyclin-dependent kinase inhibitor; it binds to and inhibits the activity of CDK2 and CDK4 activities and behaves as a regulator of cell cycle progression (Shah et al., 2011). The expression of CDKN1A is regulated by the tumor suppressor protein p53. In this study, either paclitaxel alone or ferulic acid alone treatments does not induce the expression of either CDKN1A or p53 in the drug resistant cells. Conversely, combination of ferulic acid-paclitaxel treatment upregulates p53, CDKN1A expression and downregulates Bcl-xL expression in KB resistant cells. The overexpression of CDKN1A in tumor cells, suppresses colony formation in resistant cancer cells related to that p53 overexpression (Liu et al., 2003). It has been previously reported that the MDR1 promoter be able to affected by p53 and downregulates endogenous MDR1 gene expression (Zastawny, 1993). In this study, ferulic acid
sensitizes paclitaxel mediated p53 expression which subsequently downregulates ABCB1 expression and induces apoptotic events. Thus, ferulic acid enhanced paclitaxel cytotoxicity in Pgp overexpressing multidrug resistant KB ChR8-5 cell lines by downregulating ABCB1 expression and promoting paclitaxel mediated G2/M arrest and apoptotic cell death. To date there are no sufficient clinical studies demonstrating the efficacy and safety of new formulations based on natural phytochemicals and therapeutic drugs (Mancuso and Santangelo, 2014; Mancuso et al., 2015). The potential interaction of ferulic acid with drug metabolizing enzymes, which is a common feature of phenolic acid derivatives, has to be investigated before claiming this phenolic acid as a potential chemosensitizing agent. Moreover, further studies required to reveal the mechanism of downregulation of ABCB1 expression by ferulic acid in drug resistant cancer cell lines.
Conflict of interest None declared. Acknowledgement This research was supported by the Department of Science and Technology, New Delhi. DST Grant no. SR/SO/BB – 0034.
References Anuchapreeda, S., Leechanachai, P., Smith, M.M., Ambudkar, S.V., Limtrakul, P., 2002. Modulation of P-glycoprotein expression and expression by curcumin in multidrug resistant human KB cells. Biochemical Pharmacology 64, 573-582. Baguley, B.C., 2010. Multidrug resistance in cancer. Methods Mol. Biol. 596, 1−14. Barbuti, Z. M., Chen, Z. S., 2015. Paclitaxel Through the Ages of Anticancer Therapy: Exploring Its Role in Chemoresistance and Radiation Therapy. Cancers (Basel) 7(4): 2360– 2371. Baskic, D., Popović, S., Ristić, P., Arsenijević, N.N., 2006. Analysis of cyclohexamide-induced apoptosis in human leukocytes: Fluorescence microscopy using annexin V/propidium iodide versus acridine orange/ethidium bromide. Cell Biol. Int. 30, 924–932. Binkhathlan, Z., Lavasanifar, A. P-glycoprotein inhibition as a therapeutic approach for overcoming multidrug resistance in cancer: current status and future perspectives. Curr Cancer Drug Targets. 2013 Mar;13(3):326-46. Catino, S., Paciello, F., Miceli, F., Rolesi, R., Troiani, D., Calabrese, V., Santangelo, R., Mancuso, C., 2016. Ferulic Acid Regulates the Nrf2/Heme Oxygenase-1 System and Counteracts Trimethyltin-Induced Neuronal Damage in the Human Neuroblastoma Cell Line SH-SY5Y. Front Pharmacol. 8, 6:305. Coley, H.M., 2010. Overcoming multidrug resistance in cancer: clinical studies of p-glycoprotein inhibitors. Methods Mol. Biol. 596, 341−358. Dean, M., Hamon, Y., Chimini, G., 2001. The human ATP-binding cassette (ABC) transporter super family. J. Lipid Res. 42, 1007− 1017.
DeLano, W.L., 2002. PYMOL- a molecular graphics system. DeLano Scientific: San Carlos, CA, USA. Di Domenico, F., Foppoli, C., Coccia, R., Perluigi, M., 2012. Antioxidants in cervical cancer: chemopreventive and chemotherapeutic effects of polyphenols. Biochim. Biophys. Acta. 1822(5), 737-47. Doyle, L.A., Yang, W., Abruzzi, L.V., Krogmann, T., Gao, Y., Rishi, A.K., Ross, D.A., 1998. Multidrug resistance transporter from human MCF-7 breast cancer cells. Proc. Natl. Acad. Sci. USA. 95 (26), 15665-70. Fanale, d., Bronte, G., Passiglia, F., Calò, V., et al., 2015. Stabilizing versus Destabilizing the Microtubules: A Double-Edge Sword for an Effective Cancer Treatment Option?. Anal Cell Pathol (Amst) 19, 204. Fantini, M., Benvenuto, M., Masuelli, L., Frajese, G.V., Tresoldi, I., Modesti, A., Bei, R., 2015. In vitro and in vivo antitumoral effects of combinations of polyphenols, or polyphenols and anticancer drugs: perspectives on cancer treatment. Int. J. Mol. Sci. 16(5), 9236-82. Fetoni, A.R., Mancuso, C., Eramo, S.L., Ralli, M., Piacentini, R., Barone, E., Paludetti, G., Troiani, D., 2010. In vivo protective effect of ferulic acid against noise-induced hearing loss in the guinea-pig. Neuroscience 169(4), 1575-88. Franken, N.A., Rodermond, H.M., Stap, J., Haveman, J., van Bree, C., 2006. Clonogenic assay of cells in vitro. Nat. Protoc. 1(5), 2315-9. Glide. Version 5.5. 2009, Schrodinger, LLC, New York, NY. Gottesman, M.M., Fojo, T., Bates, S.E., 2002. Multidrug resistance in cancer: role of ATPdependent transporters. Nat. Rev. Cancer 2(1),48-58.
Gupta, S. C., Kannappan, R., Reuter, S., Kim, J.H., Aggarwal, B.B., 2011. Chemosensitization of tumors by resveratrol. Ann. N. Y. Acad. Sci. 1215, 150–160. Hossam M. A., Ahmed M. A., El-Dine, R. S., El-Halawany, A. M., 2015. P-glycoprotein inhibitors of natural origin as potential tumor chemo-sensitizers: A review. J Adv Res. 6(1), 45–62. Hudson, E.A., Dinh, P.A., Kokubun, T., Simmonds, M.S., Gescher, A.C., 2000. Characterization of potentially chemopreventive phenols in extracts of brown rice that inhibit the growth of human breast and colon cancer cells. Cancer Epidemiol. Biomark. Prev. 9, 1163–1170 Jayaprakasam, B., Vanisree, M., Zhang, Y., Dewitt, D.L., Nair, M.G., 2006. Impact of alkyl esters of caffeic and ferulic acids on tumor cell proliferation, cyclooxygenase enzyme, and lipid peroxidation. J. Agric. Food Chem. 54, 5375–5381. Juliano, R.L., Ling, V.A., 1976. Surface glycoprotein modulating drug permeability in Chinese hamster ovary cell mutants. Biochim. Biophys. Acta. 455, 152−162. Karthikeyan, S., Kanimozhi, G., Prasad, N.R., Mahalakshmi, R., 2011. Radiosensitizing effect of ferulic acid on human cervical carcinoma cells in vitro. Toxicol In Vitro 25(7), 1366-75. Kitagawa, S., Nabekura, T., Kamiyama, S., 2004. Inhibitions of P-glycoprotein function by tea catechins in KB-C2 cells. J. Pharm. Pharmacol. 56(8), 1001-5. Kitagawa. S., 2006. Inhibitory Effects of Polyphenols on P-Glycoprotein-Mediated Transport. Biol. Pharm. Bull. 29(1), 1- 6. Klopman, G., Shi, L.M., Ramu, A. 1997. Quantitative structure-activity relationship of multidrug resistance reversal agents. Mol Pharmacol. 52(2), 323-34.
Lee, K et al., 2014 Effect of coumarin derivative-mediated inhibition of P- glycoprotein on oral bioavailability and therapeutic efficacy of paclitaxel. Eur. J. Pharmacol. 723: 381-8. Liu, R., Siemiarczuk, A., Sharom, F.J. 2000 . Intrinsic fluorescence of the P-glycoprotein multidrug transporter: sensitivity of tryptophan residues to binding of drugs and nucleotides. Biochemistry 39(48), 14927-38. Liu, S, Bishop, W.R., Liu, M., 2003. Differential effects of cell cycle regulatory protein p21 (WAF1/Cip1) on apoptosis and sensitivity to cancer chemotherapy. Drug Resist. Updat. 6(4),183-95. Mancuso, C., 2015. Key factors which concur to the correct therapeutic evaluation of herbal products in free radical-induced diseases. Front Pharmacol. 22, 6:86. Mancuso, C., Santangelo, R., Ferulic acid: pharmacological and toxicological aspects. Food Chem Toxicol. 65, 185-95. Mori, H., Kawabata, K., Yoshimi, N., Tanaka, T., Murakami, T., Okada, T., Murai, H., 1999. Chemopreventive effects of ferulic acid on oral and rice germ on large bowel carcinogenesis. Anticancer Res. 19, 3775-3778. Murakami, Y., Ito, S., Atsumi, T., Fujisawa, S. 2005. Theoretical prediction of the relationship between phenol function and COX-2/AP-1 inhibition for ferulic acid-related compounds. In Vivo 19(6), 1039-43. Orr, G.A., Verdier-Pinard, P., McDaid, H., Horwitz, S.B., 2003. Mechanisms of Taxol resistance related to microtubules. Oncogene 22, 7280-7295. Prasad, N.R., Muthusamy, G., Shanmugam, M., Ambudkar, S.V., 2016 South Asian Medicinal Compounds as Modulators of Resistance to Chemotherapy and Radiotherapy. Cancers 8, 32.
Ramanathan, B., Jan, K.Y., Chen, C.H., Hour, T.C., Yu, H.J., Pu, Y.S., 2005. Resistance to paclitaxel is proportional to cellular total antioxidant capacity. Cancer Res. 65, 8455-8460. Rowinsky, E.K., Donehower, R.C., 1995. Paclitaxel (taxol). N. Engl. J. Med. 332, 1004-1014. Sakai, R., Morikawa, Y., Kondo, C., Oka, H., Miyajima, H., Kubo, K., Uehara, T., 2014. Combinatorial measurement of CDKN1A/p21 and KIF20A expression for discrimination of DNA damage-induced clastogenicity. Int. J. Mol. Sci. 15(10), 17256-69. Sarkadi, B., Homolya, L., Szakács, G., Váradi, A., 2006. Human multidrug resistance ABCB1 and ABCG2 transporters: participation in a chemoimmunity defense system. Physiol. Rev. 86, 1179−1236. Saxena, M., Stephens, M.A., Pathak, H., Rangarajan, A., 2011. Transcription factors that mediate epithelial-mesenchymal transition lead to multidrug resistance by upregulating ABC transporters. Cell Death Dis. 7, 2:e179. Schrodinger Suite. The induced Fit Docking protocol Schrodinger, LLC, New York, NY. (2009). Shah, M.A., Schwartz, G.K., 2011. Cell cycle-mediated drug resistance: an emerging concept in cancer therapy. Clin. Cancer Res. 7(8), 2168-81. Shanthakumar, J., Karthikeyan, A., Bandugula, V.R., Rajendra Prasad N., 2012. Ferulic acid, a dietary phenolic acid, modulates radiation effects in Swiss albino mice. Eur. J. Pharmacol. 691(1-3), 268-74. Shen, D.W., Fojo, A., Chin, J.E., Roninson, I.B., Richert, N., Pastan, I., Gottesman, M.M., 1986. Human multidrug-resistant cell lines: increased mdr1 expression can precede gene amplification. Science 232(4750), 643-5. Singh, S., Prasad, N,R., Chufan, E,E., Patel, B.A., Wang, Y,J., Chen, Z,S., Ambudkar, S,V., Talele, T.T., 2014. Design and synthesis of human ABCB1 (P-glycoprotein) inhibitors by
peptide coupling of diverse chemical scaffolds on carboxyl and amino termini of (S)-valinederived thiazole amino acid. J. Med. Chem. 57(10), 4058-72. Sodani, K., Patel, A., Kathawala, R.J., Chen, Z.S., 2012. Multidrug resistance associated proteins in multidrug resistance. Chin. J. Cancer 31, 58−72. Tiberghien, F., Loor, F., 1996. Ranking of P-glycoprotein substrates and inhibitors by a calceinAM fluorometry screening assay. Anticancer Drugs 7, 568-578. Trombino, S., Cassano, R., Ferrarelli, T., Barone, E., Picci, N., Mancuso, C., 2013. Trans-ferulic acid-based solid lipid nanoparticles and their antioxidant effect in rat brain microsomes. Colloids Surf. B Biointerfaces 109, 273-9. Tsuruo, T., Iida, H., Tsukagoshi, S., Sakurai, Y., 1981. Overcoming of vincristine resistance in P388 leukemia in vivo and in vitro through enhanced cytotoxicity of vincristine and vinblastine by verapamil. Cancer Res. 41: 1967−1972. Velasco-Velázquez, M.A., Popov, V.M., Lisanti, M.P., Pestell, R.G., 2011. The role of breast cancer stem cells in metastasis and therapeutic implications. Am. J. Pathol. 179(1), 2-11. Wallace, A.C., Laskowski, R.A., Thornton, J.M., 1995. LIGPLOT: A program to generate schematic diagrams of protein-ligand interactions. Prot. Eng. 8(2), 127-34. Yang, X., Feng, Y., Gao, Y., Shen, J., Choy, E., Cote, G., Harmon, D., Zhang, Z., Mankin, H., Hornicek, F.J., Duan, Z., 2015. NSC23925 prevents the emergence of multidrug resistance in ovarian cancer in vitro and in vivo. Gynecol Oncol. 137(1), 134-42. Zambetti, G.P., Levine, A.J., 1993. A comparison of the biological activities of wild-type and mutant p53. FASEB J. 7(10), 855-65.
Zastawny, R.L., Salvino, R., Chen, V., Benchimol, S., Ling, V., 1993. The core promoter region of the P-glycoprotein gene is sufficient to confer differential responsiveness to wild-type and mutant p53. Oncogene 8(6), 1529-35. Zhang, D.M., Shu, C., Chen, J.J., Sodani, K., Wang, J., Bhatnagar, J., Lan, P., Ruan, Z.X, Xiao, Z.J., Ambudkar, S.V., Chen, W.M., Chen, Z.S., Ye, W.C., 2012. BBA, a derivative of 23hydroxybetulinic acid, potently reverses ABCB1-mediated drug resistance in vitro and in vivo. Mol Pharm. 9(11), 3147-59.
Fig. 1 (A). Ferulic acid pretreatment enhances the cytotoxicity of paclitaxel in KB ChR8-5 cells. KB and KB ChR8-5 cells were treated with various concentrations of paclitaxel in the presence or absence of ferulic acid for 72 h. Concentration-dependent curves of paclitaxel with or without ferulic acid in KB and drug resistant KB ChR8-5 cells. Points with error bars represent the mean ± S.E.M. Fig. 1 (B). Ferulic acid pretreatment enhances the cytotoxicity of paclitaxel in HEK293 and HEK293/ABCB1 cells. HEK293 and HEK293/ABCB1 cells were treated with various concentrations of paclitaxel in the presence or absence of ferulic acid for 72 h. Concentrationdependent curves of paclitaxel with or without ferulic acid in HEK293 and transfected HEK293/ABCB1 cells. Points with error bars represent the mean ± S.E.M. Fig. 2 Effect of ferulic acid and paclitaxel on (A). Clonogenic cell survival (B). Apoptotic incidence by ethidium bromide and acridine orange staining. Values are given as means ± S.E.M. of six experiments in each group. Values not sharing a common marking (*, **, ***. . .) differ significantly at P < 0.05 vs. control (DMRT).
Fig. 3 Effect of ferulic acid and paclitaxel on cell migration assay. Photomicrographs represents distance migrated by cells during different experimental conditions. Images of the wounds were taken at 0 and 24 h. Fig. 4 Ferulic acid treatment potentiates G2/M arrest in paclitaxel-treated KB ChR8-5 cells. (A, B) KB ChR8-5 cells were treated with 0.1 µM of paclitaxel alone or in combination with 10 µM ferulic acid for 24 h. After staining with propidium iodide, cell cycle stages were analyzed by FACS. Fig. 5 Analysis of P-gp mediated membrane transport function. (A). Fluorescent images of calcein-AM and rhodamine-123 accumulation in KB ChR8-5 cells. (B). KB ChR8-5 cells were assayed for calcein-AM and rhodamine-123 transport in the presence of increasing concentrations of ferulic acid. Fig. 6 (A). Molecular docking of ferulic acid with P-gp. The docking score of FA was found to be -6.305182 and Glide energy was observed as -28.753043. Ferulic acid shows hydrogen bonding and hydrophobic interaction with TMD region of P-gp. (B). Binding interaction of ferulic acid with purified P-gp by tryptophan fluorescence quenching. The data represent mean ± S.E.M. of three independent experiments. Fig. 7 (A) (i) ABCB1 gene expression in KB and KB ChR8-5 cells (ii) Effect of ferulic acid on ABCB1 expression in KB ChR8-5 cells (iii) Expression are normalized with GAPDH and β -actin, respectively. (B) (i) P- gp protein expression in KB and KBChR8-5 cells (ii) Effect of ferulic acid on P-gp expression in KB ChR8-5 cells. (iii) Expression are normalized with GAPDH and β- actin, respectively. Values are given as means ± S.E.M. of three experiments in each group. Values not sharing a common marking (*,**,***. . .) differ significantly at P < 0.05 vs. control (DMRT).
Fig. 8 Effect of ferulic acid and/or paclitaxel in KB ChR8-5 cells. After different treatment condition total cellular mRNA was isolated and reverse transcribed. The mRNA levels of 13 genes involved in drug resistance, apoptosis and cell cycle mediated pathway were detected using custom PCR array by following the manufacturer’s instructions. The clustergram results were analyzed using the SA Biosciences online tool. The mRNA expression levels were analyzed three independent experiments. Fig. 9 The proposed mechanism for chemosensitizing potential of ferulic acid in drug resistant KB ChR8-5 cells. Ferulic acid downregulates P-gp expression thereby induces paclitaxel mediated cell cycle arrest and induces apoptotic cell death.
Arrows indicate upregulation of
expression. Arrows indicate downregulation of expression. -Ferulic acid,
- Paclitaxel
Table: 1A Compound
KB ChR8-5
KB FRb
IC50 ± S.E.M.α (μM)
IC50 ± S.E.M.α (µΜ)
FRb
Paclitaxel
0.1 ± 0.01
[ 1.0]
3 ± 0.20
[ 30.0]
+ FA (10 uM)
0.09 ± 0.03
[ 0.9]
1.6 ± 0.05
[ 16.0]
+ FA (20 uM)
0.08 ± 0.01
[ 0.8]
0.14 ± 0.01
[ 1.4]
+ FA (30 uM)
0.08 ± 0.05
[ 0.8]
0.09 ± 0.01
[0.9]
α
IC50, concentration of ferulic acid required for 50% inhibition of cell survival were calculated
from the killing curves shown in table. Mean values ± S.E.M. are from six independent experiments, each performed in triplicate. bFR: fold-resistance was calculated by dividing the IC50 value for paclitaxel of KB and KB ChR8-5 cells in the absence or presence of ferulic acid by IC50 value for paclitaxel of parental KB cells.
Table: 1B Compound
HEK293 IC50 ± S.E.M.α (μM)
HEK293/ABCB1 FRb
IC50 ± S.E.M.α (µΜ)
FRb
Paclitaxel
0.065 ± 0.003
[ 1.0]
4.67± 0.20
[ 71.53]
+ FA (10 uM)
0.065 ± 0.003
[ 1.0]
2.5 ± 0.05
[ 38.46]
+ FA (20 uM)
0.064 ± 0.001
[ 1.0]
1.14 ± 0.01
[ 17.53]
+ FA (30 uM)
0.065 ± 0.003
[ 1.0]
0.51 ± 0.01
[7.84]
α
IC50, concentration of ferulic acid required for 50% inhibition of cell survival were calculated
from the killing curves shown in table. Mean values ± S.E.M. are from six independent experiments, each performed in triplicate. bFR: fold-resistance was calculated by dividing the IC50 value for paclitaxel of HEK293 and HEK293/ABCB1 cells in the absence or presence of ferulic acid by IC50 value for paclitaxel of parental HEK293 cells.
Figure Click here to download high resolution image
Figure Click here to download high resolution image
Figure Click here to download high resolution image
Figure Click here to download high resolution image
Figure Click here to download high resolution image
Figure Click here to download high resolution image
Figure Click here to download high resolution image
Figure Click here to download high resolution image
Figure Click here to download high resolution image
Figure Click here to download high resolution image
Figure Click here to download high resolution image