FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis

Article

FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis Graphical Abstract

Authors Suyuan Ji, Qingxu Liu, Shihao Zhang, ..., Lanfen Chen, Fen Wang, Dawang Zhou

Correspondence [email protected]

In Brief The external factors that modulate Hippo signaling remain elusive. Ji et al. demonstrate that FGF15-Hippo signaling along the gut-liver axis acts as a sensor of bile acid availability for liver size control and tumor suppression.

Highlights d

FGF15 activates Mst1/2 through hepatic FGFR4 in response to increased bile acids

d

NF2 switches FGFR4’s role from pro-oncogenic to anti-tumor signaling via Mst1/2

d

Mst1/2 acts as a key negative feedback suppressor of bile acid synthesis via SHP

d

Depletion of bile acids retards Mst1/2-mutant-driven liver growth and oncogenesis

Ji et al., 2019, Developmental Cell 48, 1–15 February 25, 2019 ª 2018 Published by Elsevier Inc. https://doi.org/10.1016/j.devcel.2018.12.021

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

Developmental Cell

Article FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis Suyuan Ji,1,2,11 Qingxu Liu,1,2,11 Shihao Zhang,1,2,11 Qinghua Chen,1,11 Cong Wang,3,11 Weiji Zhang,1 Chen Xiao,1 Yuxi Li,1 Cheng Nian,1 Jiaxin Li,1 Junhong Li,1 Jing Geng,1 Lixin Hong,1 Changchuan Xie,1 Ying He,1 Xing Chen,4 Xun Li,4 Zhen-Yu Yin,5 Han You,1 Kwang-Huei Lin,6 Qiao Wu,1 Chundong Yu,1 Randy L. Johnson,7 Li Wang,8,9 Lanfen Chen,1 Fen Wang,10 and Dawang Zhou1,2,12,* 1State Key Laboratory of Cellular Stress Biology, Innovation Center for Cell Signaling Network, School of Life Sciences, Xiamen University, Xiamen, Fujian 361102, China 2Cancer Research Center of Xiamen University, Xiamen, Fujian 361102, China 3School of Pharmacy, Wenzhou Medical University, Wenzhou, Zhejiang 325030, China 4Department of Laboratory Medicine, The First Affiliated Hospital, Medical College of Xiamen University, Xiamen, Fujian 361003, China 5Department of Hepatobiliary Surgery, Zhongshan Hospital of Xiamen University, Xiamen, Fujian 361004, China 6Department of Biochemistry, College of Medicine, Chang Gung University, Liver Research Center, Chang Gung Memorial Hospital, TaoYuan 333, Taiwan 7Department of Biochemistry and Molecular Biology, University of Texas, M.D. Anderson Cancer Center, Houston, TX 77030, USA 8Department of Physiology and Neurobiology, University of Connecticut, Storrs, CT 06269, USA 9The Institute for Systems Genomics, University of Connecticut, Storrs, CT 06269, USA 10Center for Cancer and Stem Cell Biology, Institute of Biosciences and Technology, Texas A&M University, Houston, TX 77030, USA 11These authors contributed equally 12Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.devcel.2018.12.021

SUMMARY

The external factors that modulate Hippo signaling remain elusive. Here, we report that FGF15 activates Hippo signaling to suppress bile acid metabolism, liver overgrowth, and tumorigenesis. FGF15 is induced by FXR in ileal enterocytes in response to increased amounts of intestinal bile. We found that circulating enterohepatic FGF15 stimulates hepatic receptor FGFR4 to recruit and phosphorylate NF2, which relieves the inhibitory effect of Raf on the Hippo kinases Mst1/2, thereby switching FGFR4’s role from pro-oncogenic to anti-tumor signaling. The activated Mst1/2 subsequently phosphorylates and stabilizes SHP to downregulate the key bile acid-synthesis enzyme Cyp7a1 expression, thereby limiting bile acid synthesis. In contrast, Mst1/2 deficiency impairs bile acid metabolism and remarkably increases Cyp7a1 expression and bile acid production. Importantly, pharmacological depletion of intestinal bile abrogates Mst1/2-mutant-driven liver overgrowth and oncogenesis. Therefore, FGF15-Hippo signaling along the gut-liver axis acts as a sensor of bile acid availability to restrain liver size and tumorigenesis.

INTRODUCTION The liver generally maintains an appropriate size relative to the rest of the body (Forbes and Newsome, 2016; Taub, 2004). How the liver knows when to begin or stop growing is a funda-

mental unanswered question in liver development, regeneration, and cancer biology. The recently discovered Hippo pathway plays a critical role in controlling organ size and homeostasis in many organisms from Drosophila to mammals (Harvey et al., 2013; Moya and Halder, 2016; Pan, 2010; Yu et al., 2015). Central to this pathway is a kinase cascade formed by the kinases Mst1 and Mst2 (Mst1/2, mammalian ortholog of Hippo), upstream regulators including NF2/Merlin, scaffolding protein Salvador/ WW45, downstream NDR family kinases Lats1 and Lats2 (Lats1/2), and adaptor protein Mob1. Mst1/2 phosphorylates and activates Lats1/2-Mob1, which then phosphorylates Yap and its paralog Taz. Phospho-Yap/Taz is either degraded or sequestered in the cytoplasm by the 14-3-3 protein. When the Hippo pathway is off, Yap/Taz translocates to the nucleus and forms a functional hybrid transcriptional factor with TEAD to turn on pro-proliferative and pro-survival genes, thereby enabling cell proliferation. We and others have previously demonstrated that the genetic disruption of kinases Mst1/2 or the Yap transgene results in sustained liver growth, leading to the development of liver cancer within 5 months (Camargo et al., 2007; Dong et al., 2007; Lee et al., 2010; Lu et al., 2010; Song et al., 2010; Wu et al., 2015; Zhang et al., 2017; Zhou et al., 2009). Although kinases Mst1/2 could be regulated by Raf or other upstream factors (Avruch et al., 2012; O’Neill et al., 2004; Romano et al., 2014), the potential identity of extracellular ligands and their cognate receptors that regulate the Hippo pathway remains elusive. Recently, lysophosphatidic acid (LPA) and sphingosine-1-phosphate (S1P) have been shown to activate heterotrimeric Gs protein a-subunit (Gas)-coupled signals to repress Yap/Taz activity through their corresponding G protein-coupled receptors (GPCRs) (Yu and Guan, 2013). Moreover, the GPCR-mediated Yap/Taz activity occurs independent of Mst1/2 kinases. However, liver-specific deletion of GNAS

Developmental Cell 48, 1–15, February 25, 2019 ª 2018 Published by Elsevier Inc. 1

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

Figure 1. FGF15/19 Activates Mst1/2 through Hepatic Receptor FGFR4 (A) Diagram of the parabiosis model where two mice were surgically joined. Immunoblot analysis of phosphorylated (p-) Mob1, Mob1, p-Yap, Yap, Mst1, Mst2, and GAPDH in the liver lysates of the indicated parabionts. (B) Immunoblot analysis of p-Mob1, Mob1, p-Yap, Yap, and GAPDH in the lysates of primary hepatocytes treated with 15% WT or Mst1/2 DKO mouse normal or heat-denatured serum for indicated times. (C) Immunofluorescence microscopy of Yap (red), a-tubulin (green), and DAPI (for nuclear counterstain, blue) in primary hepatocytes treated with 15% WT or Mst1/2 DKO mouse serum for 20 min. Scale bars, 10 mm. (D) Schematic diagram of the experiments conducted to determine the potential Mst1/2-activating components in Mst1/2 DKO mouse serum. The assay was performed with Mst1/2 DKO mouse serum using size-exclusion gel-filtration FPLC to separate the serum proteins according to their size, and the different fractions were analyzed for their ability to induce Mob1 phosphorylation in hepatocytes. The active and inactive fractions were analyzed by liquid chromatography-tandem mass spectrometry (LC-MS/MS) to identify proteins that were more abundant in the active fractions than in the inactive fractions. (legend continued on next page)

2 Developmental Cell 48, 1–15, February 25, 2019

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

encoding Gas, which functions as a key molecular switch to transmit various GPCR signals to inhibit cell growth (He et al., 2014; Iglesias-Bartolome et al., 2015), did not result in enlarged liver sizes or phenocopy the effect of Yap overexpression (Chen et al., 2004). These findings indicate that GPCR signaling alone is not capable or is insufficient to induce Yap/Taz activity for liver size control. Thus, the external sensing or signaling factors that modulate the Hippo signaling cascade to restrain liver growth and oncogenesis remain unidentified. Bile acids synthesized in the liver are secreted into the intestinal tract to facilitate the digestion and absorption of nutrients. Most bile acids are reabsorbed by the ileum and are transported back to the liver via the portal blood circulation. Recently, bile acids have also been considered as hepatomitogens (Anakk et al., 2013; Huang et al., 2006; Huang et al., 2009; Otao et al., 2012; Ueda et al., 2002). Bile acid levels are tightly controlled by a feedback regulatory pathway in which activating the nuclear receptor FXR represses transcription of the Cyp7a1 gene, which encodes the rate-limiting enzyme in the classic bile acid synthesis pathway (Choi et al., 2006; Fon Tacer et al., 2010; Goodwin et al., 2000; Inagaki et al., 2005; Kerr et al., 2002; Lu et al., 2000; Parks et al., 1999; Wang et al., 2002). Two distinct mechanisms of Cyp7a1 repression by hepatic and intestinal FXR have been proposed. One involves the ability of the orphan nuclear receptor SHP in the liver, where its expression is regulated by FXR, to interact with the transcription factors LRH-1 and HNF4a to repress Cyp7a1 expression. The other mechanism is that intestinal bile acids act on FXR in ileal enterocytes to induce the expression of mouse fibroblast growth factor 15 (FGF15). FGF15 is exclusively induced by intestinal but not hepatic FXR and secreted into the enterohepatic circulation and downregulates Cyp7a1 expression in the liver to limit bile acid synthesis through hepatic FGFR4 receptor signaling (Kliewer and Mangelsdorf, 2015; Ornitz and Itoh, 2015). Interestingly, due to the lack of mouse FGF15 activity toward the human hepatic receptor FGFR4, the sizes of livers repopulated with human hepatocytes in immune-deficient Fah / , Rag2 / , Il2r / , NOD (FRGN) mice were almost three times bigger than those in FRGN19+ animals in which the human FGFR4 ligand FGF19 transgene, a human ortholog of mouse FGF15, was introduced (Naugler et al., 2015). These findings indicate that FGF15/19 could be a critical factor for liver size control. However, the mechanisms underlying bile acid-mediated liver growth and size control remain largely unknown. In the present study, we demonstrate that in response to increased amounts of intestinal bile, circulating enterohepatic

FGF15 stimulates hepatic receptor FGFR4 to recruit and phosphorylate tyrosine residue 207 of NF2, which disassembles the Raf-Mst1/2 complex and relieves the inhibitory effect of Raf on Mst1/2, thereby activating Mst1/2 kinases. The activated Mst1/2 subsequently phosphorylates and stabilizes SHP to downregulate the expression of the key bile acid-synthesis enzyme Cyp7a1, thereby limiting bile acid synthesis. In contrast, Mst1/2 deficiency impairs the negative feedback suppression of bile acid metabolism, remarkably reducing SHP and increasing Cyp7a1 expression and bile acid production. Importantly, pharmacological depletion of intestinal bile acids abrogates Mst1/ 2-mutant-driven liver overgrowth and oncogenesis. Thus, we revealed that FGF15-Hippo signaling along the gut-liver axis acts as a sensor of bile acid availability for liver size control and tumor suppression. RESULTS FGF15/19 Activates Mst1/2 through Hepatic Receptor FGFR4 To investigate a potential autocrine or paracrine mechanism underlying liver overgrowth driven by the Mst1/2-deficiency, we have created a parabiosis model of wild-type (WT) and liver-specific Mst1/2 double-knockout Mst1fl/flMst2fl/fl Alb-Cre (Mst1/2 DKO) mice (Figure 1A). This parabiosis model also provides an ideal tool for identifying potential extracellular factors for hepatic Mst1/2 activation because Mst1/2 deficiency may cause a feedback-upregulation of Mst1/2-activating factors in serum. Interestingly, we found that Hippo signaling was activated in WT liver as shown by the increased phosphorylation levels of Mob1 (p-Mob1) and Yap (p-Yap) (Figure 1A). In addition, the levels of p-Mob1 and p-Yap were highly increased in hepatocytes treated with Mst1/2 DKO mouse serum compared with those in hepatocytes treated with WT mouse serum (Figure 1B). Consistently, Mst1/2 DKO serum resulted in enhanced Yap phosphorylation and cytoplasmic translocation (Figure 1C). Furthermore, heat-denatured or pronase E-treated Mst1/2 DKO serum failed to promote Mst1/2 activation (Figures 1B and S1A), suggesting that the Mst1/2-activating factor(s) in Mst1/2 DKO serum are protein(s). To determine the potential components responsible for Mst1/2 activation, we performed size-exclusion gel-filtration fast protein liquid chromatography (FPLC) with Mst1/2 DKO mouse serum and tested the eluted fractions for their ability to enhance Mob1 phosphorylation in hepatocytes (Figure 1D). There was a peak of activity in the

(E) ELISA analysis of FGF15 levels in WT and Mst1/2 DKO mouse serum. (n = 3 mice per group). (F) Immunoblot analysis of p-Mob1, Mob1, p-Yap, Yap, and GAPDH in the lysates of primary hepatocytes treated with indicated concentration of FGF19 for 20 min. (G) Immunofluorescence microscopy of Yap (red), a-tubulin (green), and DAPI (blue) in primary hepatocytes treated with 100 ng/mL FGF19 or control for 20 min. Scale bars, 10 mm. (H) Immunoblot analysis of p-Mob1, Mob1, p-Yap, Yap, and GAPDH in primary hepatocytes treated with intact or FGF15-depleted Mst1/2 DKO serum. (I and J) Immunofluorescence microscopy of Yap (red), a-tubulin (green), and DAPI (blue) (I) and immunoblot analysis of p-Mob1, Mob1, p-Yap, Yap, FGFR4, and GAPDH (J) in the lysates of primary hepatocytes isolated from WT or FGFR4 KO mice treated with 15% WT or Mst1/2 DKO mouse serum for 20 min (I) or 0–20 min (J). Scale bars, 10 mm. (K–M) Liver-to-body weight ratio (n = 8 mice for AAV-CTR; n = 12 mice for AAV-FGF15) (K), immunofluorescence microscopy of Yap (red) and b-catenin (green), Scale bars, 20 mm (L), and Ki67-positive (Ki67+) and TUNEL+ cells quantification (n = 6) (M) by IHC staining in the liver sections of 1-month-old WT mice that were infected with AAV-FGF15 or AAV control (AAV-CTR) at post-natal day 5. The data were assessed by Student’s t test and represented as mean ± SD. ns, not significant (p > 0.05), *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001 compared between the indicated groups. See also Figure S1.

Developmental Cell 48, 1–15, February 25, 2019 3

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

Figure 2. FGFR4 and WW45-Mediated Signals Synergistically Modulate Mst1/2 Activities (A) Immunoblot analysis of p-Mob1, Mob1, p-Yap, Yap, WW45, and GAPDH in the lysates of WT or WW45 KO hepatocytes treated for 20 min with indicated FGF19 concentration. (B) Liver-to-body weight ratios of 1-month-old WW45 KO and Mst1/2 DKO mice that were infected with AAV-CTR or AAV-FGF15 at post-natal day 5. (n = 8 mice WW45, Mst1/2 DKO for AAV-CTR; n = 9 mice WW45 for AAV-FGF15; n = 7 mice Mst1/2 DKO for AAV-FGF15). (C) Immunofluorescence microscopy of Yap (red), b-catenin (green), and DAPI (blue) in the liver sections of WT, FGFR4 KO, WW45 KO, and FGFR4 WW45 DKO mice. Scale bars, 20 mm. (D) Immunoblot analysis of p-Mob1, Mob1, p-Yap, Yap, SHP, FGFR4, WW45, and GAPDH in liver tissue lysates from WT, FGFR4 KO, WW45 KO, and FGFR4 WW45 DKO mice. (E) Ki67+ and CK19+ cells by IHC staining in the liver sections from WT, FGFR4 KO, WW45 KO, and FGFR4 WW45 DKO mice. (n = 6). (F and G) A representative liver image (F) and the liver-to-body weight ratios (n = 9 mice per group) (G) of 2-month-old WT, FGFR4 KO, WW45 KO, and FGFR4 WW45 DKO mice. (H and I) A representative liver image (H) and quantification of the size and number of liver tumors (n = 6 mice per group) (I) of 6-month-old WT, FGFR4 KO, WW45 KO, and FGFR4 WW45 DKO mice. (J and K) A representative liver image (J) and the liver-to-body weight ratios (n = 9 mice per group) (K) of 2-month-old WT, FGFR4 WW45 DKO, and FGFR4 WW45 DKO YAP+/ mice. (L) Ki67+ and CK19+ cell quantification by IHC staining in the liver sections from WT, FGFR4 WW45 DKO, and FGFR4 WW45 DKO YAP+/ mice. (n = 6). The data were assessed by Student’s t test and represented as mean ± SD (E, G, K and L) or ± SEM (B and I). ns, not significant (p > 0.05), *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001 compared between the indicated groups. See also Figure S2.

20–50 kDa range in three fractions (F47–F49) (Figure S1B). The active fraction F48 and the inactive fractions F43 and F51 were analyzed by liquid chromatography tandem mass spectrometry (LC-MS/MS) to identify which peptides were more abundant in F48 than in both F43 and F51. Peptides corresponding to 4 Developmental Cell 48, 1–15, February 25, 2019

FGF15 were present in the active fraction but not in the inactive fractions, implying that FGF15 may be a highly potent activator of Mst1/2 kinases (Figure S1C). Furthermore, we found that FGF15 is highly enriched in Mst1/2 DKO mouse serum but barely detectable in WT mouse serum using enzyme-linked

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

Figure 3. NF2 Acts as a Molecular Switch of FGFR4 Signaling to Activate Mst1/2 (A) Immunoblot analysis of co-immunoprecipitation of FGFR4 (a-Flag) with NF2 or total liver lysates (input) prepared from WT mice infected with AAVFlag-FGFR4. (B) FGFR4 and NF2 immune complex in vitro kinase assays. Flag-FGFR4 WT or kinase dead (KD) were immunoprecipitated from transfected 293T cells and incubated with His-NF2 substrate for 30 min at 30 C. Immunoblotting of the kinase assay sample as indicated. (C) Immunoblot analysis of co-immunoprecipitation of NF2 (a-Flag) with FGFR4 or total lysates (input) prepared from 293T cells expressing various combinations of HA-tagged FGFR4, Flag-tagged NF2, and treated with or without 100 ng/mL FGF19 for 30 min. (D) Immunoblot analysis of p-tyrosine (p-Tyr) and p-serine/threonine (p-S/T) levels of NF2 in the anti-Flag immunoprecipitates prepared from 293T cells expressing Flag-tagged-NF2 with or without co-transfection of HA-tagged FGFR4. (E) Immunoblot analysis of phospho-NF2 (p-Tyr), Raf1, and NF2 in the anti-NF2 immunoprecipitates or total lysates prepared from WT liver infected with AAVFlag-FGFR4 or AAV-CTR. (F) Immunoblot analysis of p-Mob1, Mob1, p-Yap, Yap, p-ERK, ERK, NF2, and GAPDH in HepG2 cells expressing control (shCTR) or shNF2 shRNA and treated for indicated times with or without 100 ng/mL FGF19. (G) Immunoblot analysis of p-Mob1, Mob1, p-Yap, Yap, p-ERK, ERK, FGFR4, NF2, and GAPDH in the lysates of 293T cells co-expressing HA-tagged FGFR4 with increasing doses of Flag-tagged NF2. (legend continued on next page)

Developmental Cell 48, 1–15, February 25, 2019 5

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

immunosorbent assay (ELISA) (Figure 1E). FGF19, the human ortholog of FGF15, exhibits activity similar to mouse FGF15 in mouse hepatocytes although mouse FGF15 does not work on human cells. Similar to Mst1/2 DKO mouse serum, FGF19 recombinant protein enhanced Mob1 and Yap phosphorylation in a dose- and time-dependent manner (Figures 1F and S1D), as well as promoted Yap cytoplasmic translocation in hepatocytes (Figure 1G). To further demonstrate that mFGF15 in Mst1/2 DKO serum plays a major role in hepatic Mob1 and Yap phosphorylation, hepatocytes were treated with mFGF15depleted Mst1/2 DKO serum and intact DKO serum, respectively, and the activation of Hippo signaling was determined. Notably, depletion of mFGF15 in DKO serum failed to increase p-Mob1 and p-Yap levels as well as Yap cytoplasmic retention, indicating that mFGF15 in Mst1/2 DKO serum is a critical factor for activating the Hippo signaling (Figures 1H, S1E, and S1F). FGF15/19 selectively binds to the cognate FGF receptor 4 (FGFR4) to induce downstream signaling. To determine whether FGFR4 is required for Mst1/2 DKO mouse serum-mediated Mst1/2 activation, we generated Fgfr4fl/fl mice. Interestingly, liver-specific deletion of FGFR4 (Fgfr4fl/fl Alb-Cre, FGFR4 KO) resulted in greatly reduced Hippo signaling cascade activation (Figure S1G). Moreover, the levels of phospho-Mob1 and Yap, as well as Yap cytoplasmic translocation were dramatically decreased in hepatocytes isolated from FGFR4 KO mice compared to those in WT cells after treatment with Mst1/2 DKO serum (Figures 1I and 1J). These data suggest that FGF15 activates Mst1/2 kinases through FGFR4 in mouse liver. Consistently, compared with those infected with adeno-associated control virus (AAV-CTR), the WT mouse livers infected with AAV expressing FGF15 (AAV-FGF15) for 3 weeks were significantly smaller (Figure 1K). Compared to mice infected with AAV-CTR, mice receiving AAV-FGF15 showed decreased nuclear Yap distribution in hepatocytes and significantly fewer Ki67-positive cells and more TUNEL-positive cells in their liver sections (Figures 1L, 1M, and S1H). Thus, FGF15-FGFR4 signal activates the Hippo signaling cascade to suppress liver growth. FGFR4 and WW45-Mediated Signals Synergistically Activate Mst1/2 WW45 has been generally considered as a scaffold protein to bring kinases Mst1/2 and Lats1/2 together so that Mst1/2 could phosphorylate Lats1/2 (Avruch et al., 2012). We found that liverspecific WW45 deletion (WW45fl/fl Alb-Cre, WW45 KO) also resulted in greatly reduced Mst1/2 activities as shown by the

decreased phosphorylation levels of Mob1, a physiological substrate of Mst1/2, whereas WW45 enhanced Mst1/2 kinase activities in a dose-dependent manner (Figures S2A and S2B). Thus, these data indicate that WW45 positively regulates Mst1/2 kinase activities. However, we found that upon FGF19 stimulation, the remaining Mst1/2 activities in WW45 KO hepatocytes were increased to similar levels as in WT, as shown by the increased p-Mob and p-Yap levels and Yap cytoplasmic translocation in WW45 KO hepatocytes, although WW45 KO hepatocytes exhibited decreased basal Mob1 and Yap phosphorylation (Figures 2A, S2C, and S2D). In addition, we found that early postnatal AAV-FGF15 infection resulted in smaller liver sizes in 4-weekold WW45 KO mice but not in Mst1/2 DKO mice (Figure 2B). These findings indicate that FGFR4 and WW45 signals modulate Mst1/2 activity in parallel. A previous study showed that WW45 deletion results in a modest enlargement of the liver, an approximately 1.5-fold increase compared with WT livers at 2 months of age and the late development of liver tumors at 9 months of age (Lu et al., 2010). In contrast, Mst1/2 DKO mice have 4- to 5-fold enlargement of the liver at 2 months of age and develop liver cancer at approximately 5 months of age (Zhang et al., 2017; Zhou et al., 2009). Interestingly, compared with their single gene-deficient WW45 KO or FGFR4 KO littermates, mice with liverspecific double deletion of the FGFR4 and WW45 genes (Fgfr4fl/flWW45fl/fl Alb-Cre, FGFR4 WW45 DKO) had diminished Yap and Mob1 phosphorylation, more condensed nuclear Yap (Figures 2C and 2D), and more Ki67-positive and CK19-positive cells(Figures 2E and S2E). Compared with WT, FGFR4 KO, and WW45 KO mice, FGFR4 WW45 DKO mice also exhibited significantly increased liver/body weight ratios and greatly accelerated liver tumor formation at 5 months of age (Figures 2F–2I), phenocopying the effect of Mst1/2 deficiency. Furthermore, knocking out one allele of the Hippo downstream gene Yap in FGFR4 WW45 DKO mice (Fgfr4fl/flWW45fl/flYapfl/+ Alb-Cre, FGFR4 WW45 DKO YAP+/ ) significantly abrogated the liver overgrowth phenotype (Figures 2J–2L and S2F). These results indicate that FGFR4 and WW45 signals orchestrate Hippo signaling to prevent liver enlargement and tumorigenesis. NF2 Acts as a Molecular Switch of FGFR4 Signaling to Turn on Mst1/2 To identify potential components downstream of FGFR4 signaling that regulate the Hippo signaling cascade, we infected WT mouse livers with an AAV expressing FLAG-FGFR4. Several binding partners of FGFR4, including NF2 (upstream regulator of

(H) Immunoblot analysis of Raf1 and NF2 in anti-Flag immunoprecipitates or total lysates prepared from 293T cells expressing various combinations of HA-tagged FGFR4, Flag-tagged NF2, and Myc-tagged Raf1. The immunoprecipitates were treated with or without calf-intestinal alkaline phosphatase (CIP). (I) His-pull-down assay of GST-Raf1 with His-NF2 or His-phospho-NF2 from Figure 3B. Immunoblotting of pull-down samples and Coomassie blue staining of input samples as indicated. (J) Immunoblot analysis of co-immunoprecipitation of Mst2 (a-HA) with Raf1 or total lysates (input) prepared from 293T cells expressing various combinations of Flag-tagged FGFR4, Flag-tagged NF2, HA-tagged Mst2, and Myc-tagged Raf1. (K) Immunoblot analysis of phospho-NF2 (p-Tyr) and total NF2 in the anti-Flag immunoprecipitates prepared from 293T cells expressing various combinations of HA-tagged FGFR4, Flag-tagged NF2 (WT), and non-phospho mutant NF2 (Y207F). (L) Immunoblot analysis of co-immunoprecipitation of Flag-tagged wild-type NF2 (WT) or phospho-mimic mutant NF2 (Y207D) with Raf1 or total lysates (input) prepared from 293T cells expressing various combinations of Myc-tagged Raf1, Flag-tagged NF2 (WT), and phospho-mimic mutant NF2 (Y207D). (M) Immunoblot analysis of p-Mob1, Mob1, p-Yap, and Yap in the lysates of 293T cells various combinations of HA-tagged FGFR4, Flag-tagged NF2 (WT), and non-phospho mutant NF2 (Y207F). The data were from one experiment representative of three independent experiments with similar results (A–M). See also Figure S3.

6 Developmental Cell 48, 1–15, February 25, 2019

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

Figure 4. Increased Bile Acid Metabolism in Mst1/2-Deficient Livers (A–C) Bile acid (BA) levels in the serum (A), liver (B), and feces (C) of 12-week-old male WT and Mst1/2 DKO mice. Hepatic BA levels were adjusted to nmol/g liver tissue (B), and fecal BA excretion was adjusted to mmol per 100 g body weight per day (C). n = 9 mice per group in (A) and (B); n = 6 mice per group in (C). (D) BA pool size of 12-week-old WT and Mst1/2 DKO mice. The BA pool size was adjusted to mmol per 100 g body weight. (n = 6 mice per group). (E) Quantitative real-time PCR (qPCR) analysis of the relative mRNA levels of Fxr, Shp, Cyp7a1, Cyp8b1, Cyp27a1, and Fgfr4 in the livers of 12-week-old WT or Mst1/2 DKO mice. (n = 3 mice per group). (F) Immunoblot analysis of Cyp7a1, SHP, FXR, Mst1, Mst2, and GAPDH in the liver lysates of 12-week-old WT and Mst1/2 DKO mice. (G) Immunofluorescence microscopy of FLAG-Cre (green), SHP (red), and DAPI (blue) in the liver sections of Mst1f/f Mst2f/f mice after the hydrodynamic delivery of the pscAAV-TBG-Cre plasmid. Top: scale bars, 50 mm. Bottom: scale bars, 10 mm. (H) Immunofluorescence microscopy of GS (green), Cyp7a1 (red), DAPI (blue), and IHC staining of Cyp7a1 in the liver sections from 2-month-old Mst1f/fMst2f/f mice infected with AAV-CTR or AAV-TBG-Cre for 1 month. Scale bars, 200 mm. (I) qPCR analysis of the relative Cyp7a1 mRNA levels in 2-month-old WT and Mst1/2 DKO mice livers at the indicated zeitgeber time (ZT, h). (n = 4 mice in each time point). (J) qPCR analysis of the relative Cyp7a1 mRNA levels in the livers of 2-month-old WT and Mst1/2 DKO mice treated with vehicle (Control) or 100 mg/kg GW4064 for 3 h. (n = 4 mice per group). (K) Immunoblot analysis of p-Mob1, Mob1, p-Yap, Yap, and GAPDH in the liver lysates of 2-month-old WT mice treated with vehicle (control) or GW4064 (100 mg/kg) for the indicated times. (legend continued on next page)

Developmental Cell 48, 1–15, February 25, 2019 7

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

Mst1/2), were identified by mass spectrometry analysis (Figures 3A, S3A, and S3B). Interestingly, we found that FGFR4 could directly bind to and phosphorylate tyrosine residue(s) on NF2, and the interaction between FGFR4 and NF2 was enhanced upon FGF19 stimulation (Figures 3B, 3C, and S3C). This in turn suppressed NF2’s serine and/or threonine phosphorylation (Figure 3D), which has been reported to destabilize and inactivate NF2 (Petrilli and Ferna´ndez-Valle, 2016). In contrast, increased tyrosine phosphorylation levels of NF2 were observed in the liver after AAV-FGFR4 infection (Figures 3E). These data indicate that FGFR4 promotes NF2 activity. We next sought to investigate whether NF2 is required for FGFR4-mediated Mst1/2 activation. To this end, we established HepG2-derived cell-lines with stable NF2 gene knockdown and showed that NF2 downregulation blocked Mst1/2 activation in HepG2 cells treated with FGF19 (Figures 3F, S3D, and S3E). Previous studies demonstrated that FGFR4 also activates the ERK pathway (Sandhu et al., 2014; Turner and Grose, 2010), indicating that FGFR4 could promote both pro-oncogenic and anti-oncogenic signaling. Indeed, FGFR4 expression activated both Mst1/2 and ERK, while co-transfection with NF2 significantly increased Mst1/2 activity but reduced ERK activity in a dose-dependent manner (Figure 3G). To determine the potential mechanism underlying FGFR4-NF2 signal-mediated Mst1/2 activation and ERK inactivation, we performed immunoprecipitation assays and found that among the upstream regulators of ERK, including Ras, Raf, and MEK1, only Raf1 could interact with NF2 (Figure S3F). It has been reported that Raf1 could bind to Mst1/2 and inhibit their activity (O’Neill et al., 2004). Notably, NF2 strongly interacted with Raf1 only when NF2 was phosphorylated by FGFR4 (Figures 3H and 3I) and that FGFR4-mediated NF2 phosphorylation disrupted the Raf1Mst2 complex to relieve the inhibitory effect of Raf1 on Mst1/2 kinases (Figure 3J). In addition, mass spectrometry and sitedirected mutagenesis further revealed that NF2 was phosphorylated by FGFR4 at tyrosine residue 207 (Tyr207) (Figures 3K and S3G). Immunoprecipitation and functional assays using the nonphospho mutant NF2 (Y207F) and the phospho-mimic mutant NF2 (Y207D) of NF2 showed that the phosphorylation of NF2 is required for NF2-Raf1 interaction and Mst1/2 activation (Figures 3L and 3M). Collectively, our data demonstrate that NF2 acts as a molecular switch of FGFR4’s role from promoting ERK to Mst1/ 2-mediated signaling (Figure S3H). Mst1/2 Modulate Bile Acid Metabolism through the SHP-Cyp7a1 Axis FGF15-FGFR4 signaling acts as a critical negative feedback suppressor of bile acid synthesis through downregulating the

expression of the key bile acid-synthesis enzyme Cyp7a1(Inagaki et al., 2005). We next sought to determine whether Mst1/2 is involved in bile acid metabolism. Indeed, the serum and hepatic bile acid concentrations were approximately 3- to 6-fold higher in 12-week-old Mst1/2 DKO mice than in WT mice. Furthermore, the bile acid pool size was significantly higher in Mst1/2 DKO mice than in WT mice, and the bile acid excretion rate was approximately 1-fold higher than that in WT mice (Figures 4A–4D). These data indicate that bile acid synthesis rate is increased in Mst1/2-deficient livers. We then investigated the role of Mst1/2 in regulating the expression of genes involved in bile acid synthesis, including Fxr, Shp, Cyp7a1, Cyp8b1, and Cyp27a1, in the livers of WT and Mst1/2-deficient mice using quantitative PCR (qPCR) analysis (Figure 4E). As shown in Figure 4E, Cyp7a1 and Cyp8b1 expression levels were significantly higher in Mst1/2-deficient livers than in WT mouse livers, mimicking the phenotype of FGFR4 KO mice (Figure S4A). Interestingly, the mRNA expression of SHP, a key suppressor of Cyp7a1 expression, did not differ in Mst1/2 DKO versus WT livers. However, its protein levels were significantly downregulated in Mst1/2-deficient livers compared with those in WT livers (Figures 4E and 4F). Immunofluorescent staining confirmed that SHP protein levels were significantly lower in hepatocytes with Cre-mediated Mst1/2 deletion than in adjacent WT hepatocytes (Figures 4G and S4B). These findings suggest that Mst1/2 may control SHP protein stability. Liver bile acids are produced in pericentral hepatocytes, and Cyp7a1 expression displays a pericentral bias. Interestingly, acute Mst1/2 deletion by AAV-Cre infection in Mst1f/f Mst2f/f mice led to an enlarged pericentral area of Cyp7a1 expression compared to that in control mice, as shown in the Cyp7a1 immunofluorescent or immunohistochemistry staining of the corresponding mice liver sections (Figure 4H). In addition, compared with the circadian profile of Cyp7a1 expression in WT mice, Cyp7a1 mRNA levels were arrhythmic and increased at most times during the 12 h/12 h light-dark cycle in the livers of Mst1/2 DKO mice (Figure 4I). These results indicate that loss of Mst1/2 activity increases Cyp7a1 expression by downregulating SHP protein levels, resulting in enhanced bile acid synthesis. Previous studies showed that SHP knockout prevented FXR agonist GW4064-mediated repression of liver Cyp7a1 gene expression in mice (Kerr et al., 2002; Wang et al., 2002). Consistently, compared with that in WT control livers, Cyp7a1 mRNA expression in Mst1/2 deficient livers was resistant to repression by GW4064 treatment (Figures 4J and S4C). Furthermore, GW4064 treatment also greatly enhanced the phosphorylation of Mob1 and Yap, as GW4064 could induce FGF15 expression in ileal enterocytes through FXR activation (Figures 4K and

(L) Immunoblot analysis of p-Mob1, Mob1, p-Yap, Yap, and GAPDH in the liver lysates of 2-month-old WT and FXR KO mice. (M) Hepatic and serum BA levels of 12-week-old WT, FXR KO, WW45 KO, and FXR WW45 DKO mice. Hepatic BA levels were adjusted to nmol/g of liver tissue. (n = 4 mice per group). (N) The liver-to-body weight ratios of 2-month-old WT, FXR KO, WW45 KO, and FXR WW45 DKO mice. (n = 6 mice WT, FXR KO, WW45 KO; n = 5 mice FXR WW45 DKO). (O) qPCR analysis of the relative Cyp7a1 mRNA levels in the livers of 3-month-old Mst1/2 DKO mice infected with AAV-CTR or AAV-SHP for 2 months. (n = 5 mice per group). (P) A proposed working model for how Mst1/2 modulates bile acid metabolism through the SHP-Cyp7a1 axis. The data were assessed by Student’s t test and represented as mean ± SEM (A-D, I, M and N) or ±SD (E, J, and O). ns, not significant (p > 0.05), *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001 compared between the indicated groups. See also Figure S4.

8 Developmental Cell 48, 1–15, February 25, 2019

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

Figure 5. Mst1/2 Phosphorylate and Stabilize SHP (A) Immunoblot analysis of co-immunoprecipitation of SHP (a-Flag) with Mst1, Mst2, and WW45 or total liver lysates (input) prepared from WT mice infected with AAV-FLAG-SHP. (B) His-pull-down assay of His-SHP with GST-Mst2 or GST-WW45. Immunoblotting of pull-down samples and Coomassie blue staining of input samples. (C) Immunoblot analysis of co-immunoprecipitation of SHP with Mst1, Mst2, and WW45 or total liver lysates (input) prepared from WT and WW45 KO hepatocytes. (D) Phos-tag and immunoblot analysis of HA-tagged SHP in the anti-HA immunoprecipitates prepared from 293T cells expressing various combinations of Flag-tagged wild-type Mst2 (WT), kinase-inactive Mst2 (K/R), or WW45. (E) Phos-tag analysis of HA-tagged SHP (WT), SHP (S26A), SHP (T58A), SHP (S28A), or SHP (S26A/S28A/T58A, TripA) co-expressed with Flag-Mst2 and Flag-WW45 in anti-HA immunoprecipitates. (F) Immunoblot analysis of p-SHP (S28), Mst2, Mst2 (K/R), and WW45 in the lysates of 293T cells expressing various combinations of HA-tagged SHP or SHP (S28A), with Flag-tagged Mst2, Mst2(K/R), or WW45. (G) Immunoblot analysis of p-SHP (S28), SHP, p-Mob1, Mob1, and GAPDH in the lysates of hepatocytes treated with or without 3 mM XMU-MP-1 (Mst1/2 inhibitor) for 6 h, 100 ng/mL FGF19 for 20 min or combined. (H) Immunoblot analysis of the ubiquitination of SHP (detected with a-Myc antibody) in the anti-HA immunoprecipitates prepared from 293T cells expressing various combinations of Myc-ubiquitin, HA-SHP, Flag-WW45, and Flag-Mst2. (legend continued on next page)

Developmental Cell 48, 1–15, February 25, 2019 9

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

S4D). On the other hand, our above results indicated that FGF15/ FGFR4 and WW45 signals orchestrate Hippo signaling to prevent liver enlargement and tumorigenesis. FGF15 expression is induced by FXR in ileal enterocytes in response to increased intestinal bile acid levels. Similar to FGFR4 knockout, loss of FXR reduced Mst1/2 activity as shown by decreased phsopho-Mob1 and phosopho-Yap levels (Figure 4L). We speculated that FXR and WW45 signals may synergistically modulate Mst1/2 activity to control bile acid metabolism. To this end, we generated Fxr / Ww45 fl/fl Alb-Cre mice (FXR WW45 DKO), and compared with WT, FXR KO, and WW45 KO mice, FXR WW45 DKO mice also exhibited significantly increased bile acid production and liver/ body weight ratios at 2 months of age (Figures 4M and 4N). Further analysis revealed less Yap phosphorylation and more Ki67-positive or CK19-positive cells in FXR WW45 DKO liver (Figures S4E–S4G), phenocopying the effect of Mst1/2 deficiency. To test whether Mst1/2 regulates Cyp7a1 through SHP in vivo, we infected Mst1/2-deficient mouse livers with an AAV expressing SHP (AAV-SHP) or AAV-CTR; compared to AAVCTR infection, AAV-SHP greatly reduced Cyp7a1 expression in Mst1/2-deficient livers (Figure 4O). Collectively, FXR and WW45 signals synergistically activate Mst1/2, and the Mst1/ 2-SHP axis acts as an essential regulator in the FXR-mediated negative feedback suppression of Cyp7a1 expression and bile acid metabolism (Figure 4P). Mst1/2 Phosphorylate and Stabilize SHP To identify the potent factors that are involved in Hippo signalingmediated SHP protein stability, we infected WT mouse livers with an AAV expressing FLAG-SHP. Interestingly, mass spectrometry analysis showed several Hippo signaling components, including Mst1, Mst2, and WW45 in the immunoprecipitates (Figures 5A, S5A, and S5B). According to the immunoprecipitation assay, only WW45 could interact directly with SHP (Figure S5C). Utilizing mutagenesis experiments, we found that the N terminus of WW45 was essential for its interaction with SHP (Figures S5E and S5D). Interestingly, although Mst1 and Mst2 did not bind directly to SHP, recombinant protein His-SHP incubated with GST-Mst2 and GST-WW45, or the co-expression of SHP with WW45 and Mst1 or Mst2 in 293T cells resulted in the assembly of Mst1/2WW45-SHP complex (Figures 5B and S5F). Consistently, either Mst1 or Mst2 was co-immunoprecipitated with SHP in the lysate of WT hepatocytes, whereas the Mst1/2-SHP complex was not detected in the lysate of WW45-deficient hepatocytes (Figure 5C). These data demonstrate that WW45 acts as a scaffold protein to promote the interaction between Mst1/2 and SHP. To determine whether kinases Mst1/2 regulate SHP stability through phosphorylation, we performed ‘‘phos-tag’’ SDSPAGE assay to analyze the phosphorylation status of SHP with Mst2 co-transfection. Indeed, there was an ‘‘up-shifted’’ band

of SHP with WT Mst2 co-expression but not with kinase-dead Mst2 (Figure 5D), indicating that SHP is a substrate of the Mst2 kinase. Mass spectrometry and site-directed mutagenesis analysis revealed that SHP was phosphorylated at serine 28 by Mst2 (Figures 5E and S5H). Consistently, in vitro kinase assay and phospho-tag analysis confirmed the phosphorylation of SHP at serine 28 by Mst2 using recombinant proteins GST-Mst2, GST-WW45, His-tagged WT SHP (His-SHP), and non-phospho S28A mutant (His-SHP S28A) (Figure S5I). Notably, the Ser28 is well conserved in various species, suggesting that phosphorylation at Ser28 of SHP may be functionally important (Figure S5J). A homemade polyclonal antibody against Ser28phosphorylated SHP further validated SHP phosphorylation by Mst1/2 in vivo (Figures 5G and S5K). Consistently, FGF19 activated Mst1/2 to phosphorylate SHP at Ser 28, which was blocked by the Mst1/2 inhibitor XMU-MP-1 (Figure 5G). We next sought to determine whether Mst1/2-mediated SHP phosphorylation affects its protein stability. Indeed, SHP ubiquitination was remarkably attenuated and degraded slower in cells overexpressing Mst2 and WW45 (Figures 5H and 5I). In contrast, co-expression of Mst2 and WW45 could not stabilize the nonphospho-mimetic mutant SHP S28A, which was ubiquitinated and degraded faster than WT SHP protein, while the phosphomimetic mutant SHP S28D was much more stabilized (Figures 5J and 5K). Taken together, these results indicate that kinases Mst1/2 phosphorylate and stabilize SHP to downregulate Cyp7a1 expression (Figure 5L). Depletion of Intestinal Bile Retards Mst1/2-Deficient Liver Overgrowth and Tumorigenesis To further determine whether reduced SHP levels are responsible for increasing bile acid metabolism in Mst1/2 DKO mice, we reintroduced SHP to Mst1/2 DKO liver via AAV-SHP infection, and the result showed AAV-SHP infection significantly decreased hepatic and serum bile acid levels in Mst1/2-deficient mice (Figures 6A and 6B). Interestingly, we observed greatly reduced liver size in Mst1/2 DKO mice at 2 months after early postnatal AAV-SHP infection indicating that higher bile acid levels might be responsible for Mst1/2-deficient liver overgrowth (Figures 6C and 6D). Since cholestyramine resin binds to bile acids to prevent their ileal reabsorption and increases their fecal discharge, it is commonly used to reduce the bile acid pool size in mice (Grundy et al., 1971). As expected, cholestyramine treatment dramatically decreased bile acid levels in both the sera and livers of Mst1/2-deficient mice (Figures 6E and 6F). Interestingly, cholestyramine treatment enhanced Yap phosphorylation and cytoplasmic retention and reduced the expression of Yap target genes, such as Ctgf and Cyr61, in mouse livers (Figures 6G–6I). Furthermore, cholestyramine treatment also reduced liver masses and the numbers of BrdU-positive cells, CK19-positive

(I) Immunoblot analysis of SHP protein stability in the lysates of 293T cells transfected with various combinations of HA-SHP, Flag-WW45, or Flag-Mst2 and treated with 10 mg/mL of cycloheximide (CHX) for the indicated times. (J) Immunoblot analysis of the ubiquitination of SHP, SHP (S28A), and SHP (S28D) (detected with a-Myc antibody) in the anti-HA immunoprecipitates prepared from 293T cells expressing Myc-ubiquitin with HA-tagged SHP, SHP (S28A), or SHP (S28D). (K) Immunoblot analysis of SHP (S28A) protein stability in the lysates of 293T cells transfected with various combinations of HA-SHP (S28A), Flag-WW45, or FlagMst2 and treated with 10 mg/mL of CHX for the indicated times. (L) A proposed working model for how FGFR4 modulates bile acid synthesis through Mst1/2-WW45-SHP-Cyp7a1 axis. See also Figure S5.

10 Developmental Cell 48, 1–15, February 25, 2019

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

Figure 6. Intestinal Bile Depletion Retards Mst1/2-Deficient Liver Overgrowth and Tumorigenesis (A–D) Bile acid (BA) levels in liver (A) and serum (B) with n = 4 mice per group in (A) and (B), a representative liver image (C), and the liver-to-body weight ratios (D) (n = 4 mice per group) of 3-month-old WT and Mst1/2 DKO mice infected with AAV-CTR or AAV-Flag-SHP. Hepatic BA levels were adjusted to nmol/g of liver tissue (A). (E and F) BA levels in serum (E) and liver (F) from 10-week-old WT and Mst1/2 DKO mice receiving a chow or 2% cholestyramine (resin) diet for 4 weeks. Hepatic BA levels were adjusted to nmol/g of liver tissue (F) (n = 4 mice per group). (legend continued on next page)

Developmental Cell 48, 1–15, February 25, 2019 11

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

cells, and HCC tumors in Mst1/2 DKO mice (Figures 6J–6M). Collectively, our results indicate that Mst1/2 is a critical regulator of the negative feedback suppression of bile acid synthesis for liver size control and tumor prevention. Dysregulation of FGFR4-Mst1/2 Signaling in Human HCC Development We analyzed the serum bile acid concentrations from healthy and HCC patients by LC/MS (n = 53/69) and found that in HCC patients serum bile acids were significantly increased (Figure 7A). It has been reported that FGFR4 expression is upregulated in a variety of cancers, including liver cancer, while FGFR4 knockout in mice resulted in a high incidence of liver cancer (Huang et al., 2009; Luo et al., 2010; Sandhu et al., 2014; Sawey et al., 2011; Turner and Grose, 2010). Our above data demonstrate that FGFR4 could turn on both pro-oncogenic ERK and anti-oncogenic Hippo signals, while NF2 functions to switch off FGFR4induced ERK signaling and activate Mst1/2 kinases. To determine the pathological relevance between FGFR4 and NF2 signals in HCC patients, we have examined 60 pairs of liver-derived tumorous and adjacent non-tumorous tissues (Figures 7B–7D and S6). The intensities of the immunoblot bands of paired samples of adjacent tissue (N) and tumor tissue (T) were quantified using ImageJ software. The relative ratios of NF2, p-Mob1, p-Yap, FGFR4, and p-Erk in paired samples were calculated. A heatmap was used to represent the ratio of the relative expression of the proteins NF2, p-Mob1, p-Yap, FGFR4, and p-Erk in the T and N sample from each patient. Notably, the significant upregulation of FGFR4 (i.e., ratios of T/N > 2) and the robust reduction of NF2 (i.e., ratios of T/N < 0.5) were observed in 68.3% (41 of 60) and 63.3% (38 of 60) tumorous tissues, respectively. Among the 41 samples with the significant upregulation of FGFR4 (i.e., ratios of T/N > 2), increased p-ERK (40 of 41), reduced NF2 (30 of 41), reduced p-Mob1 (32 of 41), and p-Yap (21 of 41) were observed, whereas decreased p-Mob1 (32 of 38) and p-Yap (28 of 38) and increased p-ERK (32 of 38) and FGFR4 (32 of 38) were found in the 38 samples with the robust reduction of NF2 (i.e., ratios of T/N < 0.5). These data suggest that FGFR4 elevation and NF2 reduction may contribute to the activation of Yap and Erk in a substantial fraction of HCC. Thus, we conclude that the enhancement of bile acid metabolism resulting from the disruption of Hippo signaling could be a common occurrence and likely a pathogenetic factor in human HCC (Figure 7E). DISCUSSION The external factors that modulate the Hippo signaling cascade to restrain liver size remain elusive. In this study, we demon-

strated that FGF15 activates Hippo signaling to suppress bile acid metabolism and liver tumorigenesis. Importantly, Hippo downstream effector Yap activation and enhanced bile acid metabolism were found in a substantial fraction of human HCCs. Therefore, enterohepatic FGF15-Hippo signaling is a critical suppressor of bile acid synthesis for liver size control and cancer prevention. A previous study demonstrated that lacking human FGFR4 ligand, FGF19, larger livers were found in FRGN mice repopulated with human hepatocytes (Naugler et al., 2015). Loss of FGFR4 in mouse liver results in liver cancer formation (Luo et al., 2010). Similarly, we found that an AAV expressing FGF15 significantly reduced liver growth and size, indicating that FGF15/19 is a critical factor for liver growth and size control. In contrast, FGFR4 was shown to be upregulated in human liver cancers where FGFR4 could induce several oncogenic signaling pathways including Ras-Raf-MapK and PI3K-Akt (Sandhu et al., 2014; Sawey et al., 2011; Turner and Grose, 2010). These findings indicate that FGFR4 could promote pro-oncogenic and antioncogenic signaling. We demonstrate that NF2 functions as a molecular switch to turn on FGF15/FGFR4-induced Mst1/2 activation and attenuate ERK signaling. We further identified FGFR4mediated phosphoryation of tyrosine residue 207 of NF2 as a key tumor suppression mechanism. NF2 is implicated in the development of multiple cancers in humans and mice (Benhamouche et al., 2010; Curto et al., 2007; Giovannini et al., 2000; Hamaratoglu et al., 2006; McClatchey et al., 1998). Importantly, we found that NF2 expression was commonly downregulated in human HCC, implying that NF2-mediated Mst1/2 activation is a key tumor suppressor mechanism of FGF15/FGFR4 signaling; upregulated FGFR4 expression might be a negative feedback signal due to the loss of NF2 in human HCC. Thus, enterohepatic FGF15FGFR4-Mst1/2 signaling is critical for liver size control and cancer suppression. It will be interesting to determine the underlying mechanism by which NF2 gene expression and its protein stability are regulated in normal liver tissue and HCC and whether an AAV expressing NF2 could block liver cancer formation. Bile acids are the end products of cholesterol catabolism and have also been considered as hepatomitogens. Recently, Yap has been shown to be activated by the mevalonate pathway, which is essential for the biosynthesis of isoprenoids and downstream cholesterol and bile acids (Sorrentino et al., 2014; Wang et al., 2014). The loss of both FXR and SHP led to enlarged livers, Yap activation, and spontaneous liver tumorigenesis (Anakk et al., 2013). Yap was shown to be important for bile duct and hepatocyte proliferation after cholestatic injury (Bai et al., 2012). These findings are in accordance with our data and support the interplay between bile acids and Yap. The bile acid sequestrant cholestyramine resin

(G–I) Immunofluorescence microscopy of Yap (red), b-catenin (green), and DAPI (blue) in liver sections (G), immunoblot analysis of p-Yap, Yap, p-Mob1, Mob1, Mst1, Mst2, GAPDH, and Phos-tag analysis of Yap (H) in liver tissue lysates, and qPCR analysis of the relative mRNA levels of the Yap target genes Ctgf and Cyr61 in livers (n = 3 mice per group) (I) from 10-week-old WT and Mst1/2 DKO mice received a chow or 2% resin diet for 4 weeks. Scale bars, 50 mm. (J) A representative liver image and the liver-to-body weight ratios of 10-week-old WT and Mst1/2 DKO mice received a chow or 2% resin diet for 4 weeks (n = 6 mice per group). (K) A representative liver image and quantification of the size and number of liver tumors in 5-month-old WT and Mst1/2 DKO mice received a chow or 2% resin diet for 2 months (n = 5 mice for chow group; n = 6 mice for resin group). (L and M) H&E staining and IHC staining of CK19 and BrdU (L) and BrdU+ and CK19+ (n = 6) (M) cell quantification in the liver sections from 10-week-old WT and Mst1/2 DKO mice received a chow or 2% resin diet for 4 weeks. Scale bars, 100 mm. The data were assessed by Student’s t test and represented as mean ± SEM (A, B, D-F, J and K) or ± SD (I and M). ns, not significant (p > 0.05), *p < 0.05; **p < 0.01; ***p < 0.001 compared between the indicated groups.

12 Developmental Cell 48, 1–15, February 25, 2019

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

Figure 7. Dysregulation of FGFR4-Mst1/2 Signaling in Human HCC Development (A) TBA levels of serum samples of 53 healthy without HCC and 69 patients with HCC. (n = 53 healthy; n = 69 HCC). The data were assessed by Mann-Whitney t test, and represented as mean ± SEM, **p < 0.01 compared between the indicated groups. (B and C) Immunoblot analysis of FGFR4, NF2, p-Yap, p-Mob1, p-ERK, and GAPDH in HCC tissue (T) and adjacent non-tumorous liver tissue (N) isolated from one patient. A total of 6 representative paired samples are shown (B). See Figure S6 for the remaining 54 paired samples. The intensities of the immunoblot bands were quantified using ImageJ software. A heatmap representation of the ratio of the relative expression of the proteins p-Mob1, p-Yap, NF2, FGFR4, or p-ERK in the T and N samples from one patient. Clustering was performed by using Pearson correlation metric and centroid linkage (C). (D) Schematic diagram of the analyses of FRGR4 and NF2 signals in 60 HCC patients. (E) A proposed working model for bile acid metabolism and tumor suppression mediated by the FGF15/19-Hippo signaling. See also Figure S6.

binds to intestinal bile acids inhibiting their lipid solubilizing activity and bile acid reabsorption. This action causes a decrease in the bile acid pool. We found that bile acid depletion by cholestyramine abrogates Mst1/2-mutant-driven liver overgrowth and oncogenesis. Moreover, NTCP, a major bile acid transporter, was identified as an HBV entry receptor (Yan et al., 2012). HBV-bound NTCP could not transport bile acids, so chronic HBV infections cause cholestatic liver diseases, which eventually lead to HCC development (Oehler et al., 2014). A recent study showed that obesityinduced gut microbial bile metabolite changes promote liver cancer (Yoshimoto et al., 2013). Thus, it will be interesting to determine the role of gut microbial bile metabolite changes in bile acidinduced Mst1/2-deficient liver growth by transferring WT or Mst1/2 DKO fecal microbiota into Mst1/2-deficient germ-free mice. Taken

together, our study revealed that enhancing bile acid metabolism by disrupting Hippo signaling could be a common occurrence and likely a pathogenetic factor in human HCC. The proper control of bile acid metabolism by therapeutically targeting FGF15-Hippo signaling might be crucial for liver growth control and cancer prevention. STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d

KEY RESOURCES TABLE CONTACT FOR REAGENT AND RESOURCE SHARING Developmental Cell 48, 1–15, February 25, 2019 13

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

d

d

d d

EXPERIMENTAL MODEL AND SUBJECT DETAILS B Animals B Generation of Fgfr4 Floxed Mice METHOD DETAILS B Parabiosis Surgery B Chemicals, Drugs, Supplements and Other Materials B Cell Culture B Separation of Plasma Proteins Using FPLC B Mass Spectrometry B GST/His Pull-down Assays B In Vitro Kinase Assay B FGF15 ELISA Assay B Immunohistochemistry B Immunofluorescent Staining B In Vivo Ubiquitination Assay B Generation and Delivery of Recombinant AAV8 Virus B Hepatocyte Isolation B shRNA and Lentiviral Infection B Hydrodynamic Gene Delivery B FXR Agonist GW4064 Treatment B Circadian Studies B Quantitative Real-time PCR B Measurement of Total Bile Acids B Human Liver and HCC Samples B Cholestyramine Resin Treatment QUANTIFICATION AND STATISTICAL ANALYSIS B Statistics and Reproducibility DATA AND SOFTWARE AVAILABILITY

SUPPLEMENTAL INFORMATION Supplemental Information includes six figures and can be found with this article online at https://doi.org/10.1016/j.devcel.2018.12.021. ACKNOWLEDGMENTS This work was supported by grants from National Key R&D Program of China (2017YFA0504502 to D.Z. and L.C.), The National Natural Science Foundation of China (31625010, 81790254, and U1505224 to D.Z.; 81830046 and U1405225 to L.C.; 81472229 to L.H. 81871973 to S.Z; 31600698 to J.G.), the 111 Project (BC2018027) and the Fundamental Research Funds for the Central Universities of China-Xiamen University, China (20720180047 to L.C., 20720160071 to D.Z., and 20720160054 to L.H.). National Postdoctoral Program for Innovative Talents (BX201700143 to S.Z.), Young Elite Scientist Sponsorship Program by CAST (2017QNRC001 to J.G.), and China Postdoctoral Science Foundation (2016M602072, 2017T100470 to J.G.). We thank Mr. Funiu Qin for technical support and the State Key Laboratory of Marine Environmental Science for the HPLC-MS bile acids profiling analysis. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. AUTHOR CONTRIBUTIONS D.Z. and L.C. conceived the project, with input from L.W., C.Y., Q.W., H.Y., and K.-H.L. S.J., Q.L., S.Z., Q.C., W.Z., C.X., Y.L., Jiaxin L., J.G., L.H., Z.L., C.X., Junhong L., and Q.L. performed experimental biological research. Z.-Y.Y., X.C., and X.L. provided human HCC samples. R.L.J., F.W., and C.W. provided mutant mice. D.Z. and L.C. co-wrote the paper. All authors edited the manuscript. DECLARATION OF INTERESTS The authors declare no competing interests.

14 Developmental Cell 48, 1–15, February 25, 2019

Received: August 16, 2018 Revised: November 13, 2018 Accepted: December 26, 2018 Published: February 7, 2019 REFERENCES Anakk, S., Bhosale, M., Schmidt, V.A., Johnson, R.L., Finegold, M.J., and Moore, D.D. (2013). Bile acids activate YAP to promote liver carcinogenesis. Cell Rep. 5, 1060–1069. Avruch, J., Zhou, D., Fitamant, J., Bardeesy, N., Mou, F., and Barrufet, L.R. (2012). Protein kinases of the Hippo pathway: regulation and substrates. Semin. Cell Dev. Biol. 23, 770–784. Bai, H., Zhang, N., Xu, Y., Chen, Q., Khan, M., Potter, J.J., Nayar, S.K., Cornish, T., Alpini, G., Bronk, S., et al. (2012). Yes-associated protein regulates the hepatic response after bile duct ligation. Hepatology 56, 1097–1107. Benhamouche, S., Curto, M., Saotome, I., Gladden, A.B., Liu, C.H., Giovannini, M., and McClatchey, A.I. (2010). Nf2/Merlin controls progenitor homeostasis and tumorigenesis in the liver. Genes Dev. 24, 1718–1730. Camargo, F.D., Gokhale, S., Johnnidis, J.B., Fu, D., Bell, G.W., Jaenisch, R., and Brummelkamp, T.R. (2007). YAP1 increases organ size and expands undifferentiated progenitor cells. Curr. Biol. 17, 2054–2060. Chen, M., Haluzik, M., Wolf, N.J., Lorenzo, J., Dietz, K.R., Reitman, M.L., and Weinstein, L.S. (2004). Increased insulin sensitivity in paternal Gnas knockout mice is associated with increased lipid clearance. Endocrinology 145, 4094–4102. Choi, M., Moschetta, A., Bookout, A.L., Peng, L., Umetani, M., Holmstrom, S.R., Suino-Powell, K., Xu, H.E., Richardson, J.A., Gerard, R.D., et al. (2006). Identification of a hormonal basis for gallbladder filling. Nat. Med. 12, 1253–1255. Curto, M., Cole, B.K., Lallemand, D., Liu, C.H., and McClatchey, A.I. (2007). Contact-dependent inhibition of EGFR signaling by Nf2/Merlin. J. Cell Biol. 177, 893–903. Dong, J., Feldmann, G., Huang, J., Wu, S., Zhang, N., Comerford, S.A., Gayyed, M.F., Anders, R.A., Maitra, A., and Pan, D. (2007). Elucidation of a universal size-control mechanism in Drosophila and mammals. Cell 130, 1120–1133. Fon Tacer, K., Bookout, A.L., Ding, X., Kurosu, H., John, G.B., Wang, L., Goetz, R., Mohammadi, M., Kuro-o, M., Mangelsdorf, D.J., et al. (2010). Research resource: comprehensive expression atlas of the fibroblast growth factor system in adult mouse. Mol. Endocrinol. 24, 2050–2064. Forbes, S.J., and Newsome, P.N. (2016). Liver regeneration - mechanisms and models to clinical application. Nat. Rev. Gastroenterol. Hepatol. 13, 473–485. Giovannini, M., Robanus-Maandag, E., van der Valk, M., Niwa-Kawakita, M., Abramowski, V., Goutebroze, L., Woodruff, J.M., Berns, A., and Thomas, G. (2000). Conditional biallelic Nf2 mutation in the mouse promotes manifestations of human neurofibromatosis type 2. Genes Dev. 14, 1617–1630. Goodwin, B., Jones, S.A., Price, R.R., Watson, M.A., McKee, D.D., Moore, L.B., Galardi, C., Wilson, J.G., Lewis, M.C., Roth, M.E., et al. (2000). A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol. Cell 6, 517–526. Grundy, S.M., Ahrens, E.H., Jr., and Salen, G. (1971). Interruption of the enterohepatic circulation of bile acids in man: comparative effects of cholestyramine and ileal exclusion on cholesterol metabolism. J. Lab. Clin. Med. 78, 94–121. Hamaratoglu, F., Willecke, M., Kango-Singh, M., Nolo, R., Hyun, E., Tao, C., Jafar-Nejad, H., and Halder, G. (2006). The tumour-suppressor genes NF2/ Merlin and Expanded act through Hippo signalling to regulate cell proliferation and apoptosis. Nat. Cell Biol. 8, 27–36. Harvey, K.F., Zhang, X., and Thomas, D.M. (2013). The Hippo pathway and human cancer. Nat. Rev. Cancer 13, 246–257. He, X., Zhang, L., Chen, Y., Remke, M., Shih, D., Lu, F., Wang, H., Deng, Y., Yu, Y., Xia, Y., et al. (2014). The G protein a subunit Gas is a tumor suppressor in sonic hedgehog-driven medulloblastoma. Nat. Med. 20, 1035–1042.

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

Huang, W., Ma, K., Zhang, J., Qatanani, M., Cuvillier, J., Liu, J., Dong, B., Huang, X., and Moore, D.D. (2006). Nuclear receptor-dependent bile acid signaling is required for normal liver regeneration. Science 312, 233–236. Huang, X., Yang, C., Jin, C., Luo, Y., Wang, F., and McKeehan, W.L. (2009). Resident hepatocyte fibroblast growth factor receptor 4 limits hepatocarcinogenesis. Mol. Carcinog. 48, 553–562. Iglesias-Bartolome, R., Torres, D., Marone, R., Feng, X., Martin, D., Simaan, M., Chen, M., Weinstein, L.S., Taylor, S.S., Molinolo, A.A., et al. (2015). Inactivation of a Ga(s)-PKA tumour suppressor pathway in skin stem cells initiates basal-cell carcinogenesis. Nat. Cell Biol. 17, 793–803. Inagaki, T., Choi, M., Moschetta, A., Peng, L., Cummins, C.L., McDonald, J.G., Luo, G., Jones, S.A., Goodwin, B., Richardson, J.A., et al. (2005). Fibroblast growth factor 15 functions as an enterohepatic signal to regulate bile acid homeostasis. Cell Metab. 2, 217–225.

(1999). Bile acids: natural ligands for an orphan nuclear receptor. Science 284, 1365–1368. Petrilli, A.M., and Ferna´ndez-Valle, C. (2016). Role of Merlin/NF2 inactivation in tumor biology. Oncogene 35, 537–548. Romano, D., Nguyen, L.K., Matallanas, D., Halasz, M., Doherty, C., Kholodenko, B.N., and Kolch, W. (2014). Protein interaction switches coordinate Raf-1 and MST2/Hippo signalling. Nat. Cell Biol. 16, 673–684. Sandhu, D.S., Baichoo, E., and Roberts, L.R. (2014). Fibroblast growth factor signaling in liver carcinogenesis. Hepatology 59, 1166–1173. Sawey, E.T., Chanrion, M., Cai, C., Wu, G., Zhang, J., Zender, L., Zhao, A., Busuttil, R.W., Yee, H., Stein, L., et al. (2011). Identification of a therapeutic strategy targeting amplified FGF19 in liver cancer by Oncogenomic screening. Cancer Cell 19, 347–358.

Kamran, P., Sereti, K.I., Zhao, P., Ali, S.R., Weissman, I.L., and Ardehali, R. (2013). Parabiosis in mice: a detailed protocol. J. Vis. Exp. https://doi.org/ 10.3791/50556.

Sinal, C.J., Tohkin, M., Miyata, M., Ward, J.M., Lambert, G., and Gonzalez, F.J. (2000). Targeted disruption of the nuclear receptor FXR/BAR impairs bile acid and lipid homeostasis. Cell 102, 731–744.

Kerr, T.A., Saeki, S., Schneider, M., Schaefer, K., Berdy, S., Redder, T., Shan, B., Russell, D.W., and Schwarz, M. (2002). Loss of nuclear receptor SHP impairs but does not eliminate negative feedback regulation of bile acid synthesis. Dev. Cell 2, 713–720.

Song, H., Mak, K.K., Topol, L., Yun, K., Hu, J., Garrett, L., Chen, Y., Park, O., Chang, J., Simpson, R.M., et al. (2010). Mammalian Mst1 and Mst2 kinases play essential roles in organ size control and tumor suppression. Proc. Natl. Acad. Sci. USA 107, 1431–1436.

Kliewer, S.A., and Mangelsdorf, D.J. (2015). Bile acids as hormones: the FXRFGF15/19 pathway. Dig. Dis. 33, 327–331.

Sorrentino, G., Ruggeri, N., Specchia, V., Cordenonsi, M., Mano, M., Dupont, S., Manfrin, A., Ingallina, E., Sommaggio, R., Piazza, S., et al. (2014). Metabolic control of YAP and TAZ by the mevalonate pathway. Nat. Cell Biol. 16, 357–366.

Lee, K.P., Lee, J.H., Kim, T.S., Kim, T.H., Park, H.D., Byun, J.S., Kim, M.C., Jeong, W.I., Calvisi, D.F., Kim, J.M., et al. (2010). The Hippo-Salvador pathway restrains hepatic oval cell proliferation, liver size, and liver tumorigenesis. Proc. Natl. Acad. Sci. USA 107, 8248–8253. Lu, L., Li, Y., Kim, S.M., Bossuyt, W., Liu, P., Qiu, Q., Wang, Y., Halder, G., Finegold, M.J., Lee, J.S., et al. (2010). Hippo signaling is a potent in vivo growth and tumor suppressor pathway in the mammalian liver. Proc. Natl. Acad. Sci. USA 107, 1437–1442. Lu, T.T., Makishima, M., Repa, J.J., Schoonjans, K., Kerr, T.A., Auwerx, J., and Mangelsdorf, D.J. (2000). Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors. Mol. Cell 6, 507–515. Luo, Y., Yang, C., Lu, W., Xie, R., Jin, C., Huang, P., Wang, F., and McKeehan, W.L. (2010). Metabolic regulator betaKlotho interacts with fibroblast growth factor receptor 4 (FGFR4) to induce apoptosis and inhibit tumor cell proliferation. J. Biol. Chem. 285, 30069–30078. McClatchey, A.I., Saotome, I., Mercer, K., Crowley, D., Gusella, J.F., Bronson, R.T., and Jacks, T. (1998). Mice heterozygous for a mutation at the Nf2 tumor suppressor locus develop a range of highly metastatic tumors. Genes Dev. 12, 1121–1133. Moya, I.M., and Halder, G. (2016). The Hippo pathway in cellular reprogramming and regeneration of different organs. Curr. Opin. Cell Biol. 43, 62–68. Naugler, W.E., Tarlow, B.D., Fedorov, L.M., Taylor, M., Pelz, C., Li, B., Darnell, J., and Grompe, M. (2015). Fibroblast growth factor signaling controls liver size in mice with humanized livers. Gastroenterology 149, 728–740. O’Neill, E., Rushworth, L., Baccarini, M., and Kolch, W. (2004). Role of the kinase MST2 in suppression of apoptosis by the proto-oncogene product Raf-1. Science 306, 2267–2270. Oehler, N., Volz, T., Bhadra, O.D., Kah, J., Allweiss, L., Giersch, K., Bierwolf, J., Riecken, K., Pollok, J.M., Lohse, A.W., et al. (2014). Binding of hepatitis B virus to its cellular receptor alters the expression profile of genes of bile acid metabolism. Hepatology 60, 1483–1493.

Taub, R. (2004). Liver regeneration: from myth to mechanism. Nat. Rev. Mol. Cell Biol. 5, 836–847. Turner, N., and Grose, R. (2010). Fibroblast growth factor signalling: from development to cancer. Nat. Rev. Cancer 10, 116–129. Ueda, J., Chijiiwa, K., Nakano, K., Zhao, G., and Tanaka, M. (2002). Lack of intestinal bile results in delayed liver regeneration of normal rat liver after hepatectomy accompanied by impaired cyclin E-associated kinase activity. Surgery 131, 564–573. Wang, L., Lee, Y.K., Bundman, D., Han, Y., Thevananther, S., Kim, C.S., Chua, S.S., Wei, P., Heyman, R.A., Karin, M., et al. (2002). Redundant pathways for negative feedback regulation of bile acid production. Dev. Cell 2, 721–731. Wang, Z., Wu, Y., Wang, H., Zhang, Y., Mei, L., Fang, X., Zhang, X., Zhang, F., Chen, H., Liu, Y., et al. (2014). Interplay of mevalonate and Hippo pathways regulates RHAMM transcription via YAP to modulate breast cancer cell motility. Proc. Natl. Acad. Sci. USA 111, E89–E98. Wu, H., Wei, L., Fan, F., Ji, S., Zhang, S., Geng, J., Hong, L., Fan, X., Chen, Q., Tian, J., et al. (2015). Integration of Hippo signalling and the unfolded protein response to restrain liver overgrowth and tumorigenesis. Nat. Commun. 6, 6239. Yan, H., Zhong, G., Xu, G., He, W., Jing, Z., Gao, Z., Huang, Y., Qi, Y., Peng, B., Wang, H., et al. (2012). Sodium taurocholate cotransporting polypeptide is a functional receptor for human hepatitis B and D virus. Elife 1, e00049. Yoshimoto, S., Loo, T.M., Atarashi, K., Kanda, H., Sato, S., Oyadomari, S., Iwakura, Y., Oshima, K., Morita, H., Hattori, M., et al. (2013). Obesity-induced gut microbial metabolite promotes liver cancer through senescence secretome. Nature 499, 97–101. Yu, F.X., and Guan, K.L. (2013). The Hippo pathway: regulators and regulations. Genes Dev. 27, 355–371.

Ornitz, D.M., and Itoh, N. (2015). The fibroblast growth factor signaling pathway. Wiley Interdiscip. Rev. Dev. Biol. 4, 215–266.

Yu, F.X., Zhao, B., and Guan, K.L. (2015). Hippo pathway in organ size control, tissue homeostasis, and cancer. Cell 163, 811–828.

Otao, R., Beppu, T., Isiko, T., Mima, K., Okabe, H., Hayashi, H., Masuda, T., Chikamoto, A., Takamori, H., and Baba, H. (2012). External biliary drainage and liver regeneration after major hepatectomy. Br. J. Surg. 99, 1569–1574.

Zhang, S., Chen, Q., Liu, Q., Li, Y., Sun, X., Hong, L., Ji, S., Liu, C., Geng, J., Zhang, W., et al. (2017). Hippo signaling suppresses cell ploidy and tumorigenesis through Skp2. Cancer Cell 31, 669–684.

Pan, D. (2010). The hippo signaling pathway in development and cancer. Dev. Cell 19, 491–505.

Zhou, D., Conrad, C., Xia, F., Park, J.S., Payer, B., Yin, Y., Lauwers, G.Y., Thasler, W., Lee, J.T., Avruch, J., et al. (2009). Mst1 and Mst2 maintain hepatocyte quiescence and suppress hepatocellular carcinoma development through inactivation of the Yap1 oncogene. Cancer Cell 16, 425–438.

Parks, D.J., Blanchard, S.G., Bledsoe, R.K., Chandra, G., Consler, T.G., Kliewer, S.A., Stimmel, J.B., Willson, T.M., Zavacki, A.M., Moore, D.D., et al.

Developmental Cell 48, 1–15, February 25, 2019 15

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Antibodies Phospho-MOB1 (Thr35) (D2F10) Rabbit mAb

Cell Signaling Technology

Cat#8699; RRID:AB_11139998

MOB1 (E1N9D) Rabbit

Cell Signaling Technology

Cat#13730

Phospho-Yap (S127) (rabbit)

Cell Signaling Technology

Cat#4911S; RRID: AB_2218913

Yap (rabbit)

Cell Signaling Technology

Cat#4912S; RRID:AB_10694682

GAPDH [D16H11] (rabbit)

Cell Signaling Technology

Cat#5174; RRID:AB_10622025

a-Tubulin [11H10] (rabbit)

Cell Signaling Technology

Cat#2125; RRID:AB_2619646

Merlin (rabbit)

Cell Signaling Technology

Cat#6995; RRID:AB_10828709

p44/42 MAPK (Erk1/2) (3A7) Mouse

Cell Signaling Technology

Cat#9107; RRID:AB_10695739

HA-Tag [C29F4] (rabbit)

Cell Signaling Technology

Cat#3724; RRID:AB_1549585

HA-Tag (rabbit)

Proteintech

Cat#51064-2-AP RRID: AB_11042321

Flag-Tag (rabbit)

Proteintech

Cat#20543-1-AP RRID:AB_11232216

Myc-Tag (rabbit)

Proteintech

Cat# 16286-1-AP RRID:AB_11182162

phospho-Erk1/2 (rabbit)

Cell Signaling Technology

Cat#4370; RRID:AB_2315112

Myc-Tag (rabbit)

Cell Signaling Technology

Cat#2278; RRID:AB_10693332

Phospho-Tyrosine (Mouse)

Cell Signaling Technology

Cat#9411; RRID:AB_331228

Mst1(rabbit)

Cell Signaling Technology

Cat#3682; RRID: AB_2144632

Mst2 (rabbit)

Cell Signaling Technology

Cat#3952; RRID: AB_2196471

Lats1 [C66B5] (rabbit)

Cell Signaling Technology

Cat#3477; RRID: AB_2133513

SAV1 [M02] (mouse)

Abnova

Cat#H00060485-M02 RRID: AB_547968

FGFR4 (rabbit)

Abcam

Cat#ab178396; RRID:N/A

b-catenin [15B8] (mouse)

Abcam

Cat#ab6301; RRID:AB_305406

Phospho-Ser/Thr antibody (rabbit)

Abcam

Cat#ab17464; RRID:AB_443891

Glutamine synthase (rabbit)

Abcam

Cat#ab49873; RRID:AB_880241

Cyp7a1 (mouse)

Millipore

Cat#MABD42

Brdu [BU-1] (mouse)

Thermo Fisher

Cat#MA3-071; RRID:AB_10986341

Flag-Tag (mouse)

Sigma-Aldrich

Cat#F1804; RRID: AB_262044

6X His-Tag antibody (mouse)

Abcam

Cat#ab18184; RRID:AB_444306

GST-Tag (mouse)

Proteintech

Cat#66001-2-Ig RRID:N/A

Ki67

Cell Signaling Technology

Cat#12202; RRID:AB_2620142

CK19

DSHB

AB_2133570; RRID:AB_2133570

SHP (Rabbit)

This paper

N/A

Phospho-SHP (S28) (Rabbit)

This paper

N/A (Continued on next page)

e1 Developmental Cell 48, 1–15.e1–e9, February 25, 2019

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

The first affiliated hospital and Zhongshan Hospital of Xiamen University

N/A

DMEM

Invitrogen

Cat#41966052

Williams’ Medium E

Invitrogen

Cat#32551087

Fetal Bovine Serum (heat-inactivated)

Sigma-Aldrich

Cat#F-9665

Trypsin

Gibco

Cat#15400054

Lipofectamine 2000

Invitrogen

Cat#11668019

FGF19 Recombinant Protein

Thermo

Cat#PHG0244

GW4064

MCE

Cat#HY-50108

Cholestyramine resin

Sigma-Aldrich

Cat#C4650

Sodium taurocholate hydrate

Sigma-Aldrich

Cat#86339

Anti-FLAG M2 Affinity Gel

Sigma-Aldrich

Cat#A2220

Protein G Sepharose

GE Healthcare

Cat#17061801

Cycloheximide

MCE

Cat#HY12320

Biological Samples Human serums and HCC samples

Chemicals, Peptides, and Recombinant Proteins

His-select Nickel Affinity Gel

Sigma-Aldrich

Cat#P6611

Glutathione Sepharose

GE Healthcare

Cat#17513201

Pronase E

Sigma-Aldrich

Cat#P8811

phos-tag acrylamid aal-107

Nard

Cat#aal-107

RNAeasy Mini Kit

Qiagen

Cat#74104

PrimeScript RT reagent Kit with gDNA Eraser

Takara

Cat#RR047A

Total Bile Acids Assay Kit

Crystal chem

Cat#80470

Mouse FGF15 ELISA kit

Wuhan USCN Business Co. Ltd

Cat#MEL154Mu

293T

ATCC

N/A

HepG2

ATCC

N/A

Mouse:Mst1fl/fl

From R. L. Johnson, University of Texas, M.D. Anderson Cancer Center, Houston, USA

N/A

Mouse:Sav1(Ww45)fl/fl

From R. L. Johnson, University of Texas, M.D. Anderson Cancer Center, Houston, USA

N/A

Mouse: Yap1fl/fl

From R. L. Johnson, University of Texas, M.D. Anderson Cancer Center, Houston, USA

N/A

Mouse: Mst2fl/fl

Zhou et al., (2009)

N/A

Mouse: Fgfr4fl/fl

This paper

N/A

Mouse: Fxr KO

Sinal et al., (2000)

N/A

Mouse: Tg(Alb-Cre)21Mgn/J

Jackson Laboratory

JAX:00357

Critical Commercial Assays

Experimental Models: Cell Lines

Experimental Models: Organisms/Strains

Oligonucleotides m.Fxr qPCR Forward primer: TGTGAGGGCT GCAAAGGTTT

This paper

N/A

m.Fxr qPCR Reverse primer: ACATCCCCAT CTCTCTGCAC

This paper

N/A

m.Shp qPCR Forward primer: GTCTTTCTGGAGCCTTGAGCTG

This paper

N/A

m.Shp qPCR Reverse primer: GTAGAGGCCATGAGGAGGATTC

This paper

N/A

m.Cyp7a1 qPCR Forward primer: CAAGAACCTGTACATGA GGGAC

This paper

N/A (Continued on next page)

Developmental Cell 48, 1–15.e1–e9, February 25, 2019 e2

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

m.Cyp7a1 qPCR Reverse primer: CACTTCTTCAGAGGCT GCTTTC

This paper

N/A

m.Cyp7b1 qPCR Forward primer: GGAGCCACGACCCT AGATG

This paper

N/A

m.Cyp7b1 qPCR Reverse primer: TGCCAAGATAAGGAA GCCAAC

This paper

N/A

m.Cyp27a1 qPCR Forward primer: CCTCACCTATGGGAT CTTCATC

This paper

N/A

m.Cyp27a1 qPCR Reverse primer: TTTAAGGCATCCGTG TAGAGC

This paper

N/A

m.Cyp8b1 qPCR Forward primer: CCTCTGGACAAGGGT TTTGTG

This paper

N/A

m.Cyp8b1 qPCR Reverse primer: GCACCGTGAAGACA TCCCC

This paper

N/A

m.Fgfr4 qPCR Forward primer: GGCTGTATTCCCCTCC ATCG

This paper

N/A

m.Fgfr4 qPCR Reverse primer: CCAGTTGGTAACAATG CCATGT

This paper

N/A

m.Fgf15 qPCR Forward primer: ACGTCCTTGATGGCA ATCG

This paper

N/A

m.Fgf15 qPCR Reverse primer: GAGGACCAAAACGAA CGAAATT

This paper

N/A

m.Yap1 qPCR Forward primer: GCGGTTGAAACAACA GGAAT

This paper

N/A

m.Yap1 qPCR Reverse primer: TGCTCCAGTGTAGGC AACTG

This paper

N/A

m.Cyr61 qPCR Forward primer: GGATGAATGGTGCC TTGC

This paper

N/A

m.Cyr61 qPCR Reverse primer: GTCCACATCAGCCC CTTG

This paper

N/A

m.Ctgf qPCR Forward primer: AAGACACATTTGGCC CAGAC

This paper

N/A

m.Ctgf qPCR Reverse primer: GACAGGCTTGGCGA TTTTAG

This paper

N/A

m.Gapdh qPCR Forward primer: CGTCCCGTAGACAA AATGGT

This paper

N/A

m.Gapdh qPCR Reverse primer: GAATTTGCCGTGAG TGGAGT

This paper

N/A

m. Shp (S26A) plasmid Forward primer: TGTATGCACTTCTGGCCCCCAGCCCCAGGAC

This paper

N/A

m. Shp (S26A) plasmid Reverse primer: GGTCCTGGGGCTGGGGGCCAGAAGTGCATAC

This paper

N/A

m. Shp (S28A) plasmid Forward primer: CACTTCTGAGCCCCGCCCCCAGGACCAGGC

This paper

N/A

m. Shp (S28A) plasmid Reverse primer: GGCCT GGTCCTGGGGGCGGGGCTCAGAAGT

This paper

N/A

m. Shp (S26/28A) plasmid Forward primer: ATGCACTTCTGGCCCCCGCCCCCAGGACCAG

This paper

N/A

m. Shp (S26/28A) plasmid Reverse primer: CTGG TCCTGGGGGCGGGGGCCAGAAGTGCAT

This paper

N/A

m. Shp (S28D) plasmid Forward primer: CACTTCTGAGCCCCGACCCCAGGACCAGGC

This paper

N/A (Continued on next page)

e3 Developmental Cell 48, 1–15.e1–e9, February 25, 2019

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

m. Shp (S28D) plasmid Reverse primer: GGCCT GGTCCTGGGGTCGGGGCTCAGAAGT

This paper

N/A

m.Shp (Sal1) liC plasmid Forward primer: TAGTGAATTCGTCGACGCCACCATGAGCTCCGGCCAGTCAG

This paper

N/A

m. Shp (Xho1)liC plasmid Reverse primer: GCCGCAAGCTTCTCGAGCCCCTCAGCAAAAGCATGTC

This paper

N/A

m. Shp (T58A) plasmid Forward primer: GTGTGCTCCGCACCGCGCCTGCAGGGAGGCCTTGG

This paper

N/A

m. Shp (T58A) plasmid Reverse primer: CCAAGGC CTCCCTGCAGGCGCGGTGCGGAGCACAC

This paper

N/A

h.shNF2-1 plasmid primer: AAAAGGAAAGGGAAGGACC TCTTTGTTGGATCCAACAAAGAGGTCCTTCCCTTTCC

This paper

N/A

h.shNF2-2 plasmid primer: AAAAGGACAAGAAGGTACTGGATCATTGGATCCAATGAT CCAGTACCTTCTTGTCC

This paper

N/A

h.shNF2-3 plasmid primer: AAAAGGTACTGGATCATGATGTTTCTTGGATCCAAGAAA CATCATGATCCAGTACC

This paper

N/A

h.shNF2-4 plasmid primer: AAAAGGTTCAGGAGATCACACAACATTGGATCCAATGT TGTGTGATCTCCTGAACC

This paper

N/A

h.WW45 GST plasmid Forward primer AAAAGAATTCATGCTGTCCCGACAGAAAAC

This paper

N/A

h.WW45 GST plasmid lic Reverse primer AAAACTCGAGTCAAAAATTTTTTCCATGTTG

This paper

N/A

h.Mst1 GST plasmid Forward primer AAAAGAATTCATGGAGACGGTACAGCTG

This paper

N/A

h.Mst1 GST plasmid Reverse primer AAAACTCGAGTCAGAAGTTTTGTTGCCGTC

This paper

N/A

h.FGFR4.C GST plasmid Forward primer AAAAGAATTCCGAGGGCAGGCGCTCCAC

This paper

N/A

h.FGFR4.C GST plasmid Reverse primer AAAACTCGAGTCATGTCTGCACCCCAGAC

This paper

N/A

m.Shp His plasmid lic Forward primer ATGGGTCGCGGATCCATGAGCTCCGGCCAGTCAG

This paper

N/A

m.Shp His plasmid lic Reverse primer TGCGGCCGCAAGCTTTCACCTCAGCAAAAGCATG

This paper

N/A

m.Raf GST plasmid Forward primer AAAAGAATTCATGGAGCACATACAGGGAG

This paper

N/A

m.Raf GST plasmid Reverse primer AAAACTCGAGCTAGAAGACAGGCAGCCTC

This paper

N/A

h.NF2 His plasmid lic Forward primer ATGGGTCGCGGATCCATGGCCGGGGCCATCGCTTC

This paper

N/A

h.NF2 His plasmid lic Reverse primer TGCGGCCGCAAGCTTCTAGAGCTCTTCAAAGAAGG

This paper

N/A

h.FGFR4 (K503M) mutant Forward primer CCAGCACTGTGGCCGTCATGATGCTCAAAGACAAC

This paper

N/A

h.FGFR4 (K503M) mutant Reverse primer CGTTGTCTTTGAGCATCATGACGGCCACAGTGCTG

This paper

N/A

h.FGFR4 (E681K) mutant Forward primer TGGGATCCTGCTATGGAAGATCTTCACCCTCGG

This paper

N/A

h.FGFR4 (E681K) mutant Reverse primer CCGAGGGTGAAGATCTTCCATAGCAGGATCCCA

This paper

N/A (Continued on next page)

Developmental Cell 48, 1–15.e1–e9, February 25, 2019 e4

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

h.NF2 (Y207F) mutant Forward primer GAAGCTGAAATGGAATTTCTGAAGATAGCTCAGGAC

This paper

N/A

h.NF2 (Y207F) mutant Reverse primer GTCCTGAGCTATCTTCAGAAATTCCATTTCAGCTTC

This paper

N/A

Recombinant DNA Plasmid:pscAAV-Flag-FGF15

This paper

N/A

Plasmid:pscAAV-luciferase

This paper

N/A

Plasmid:pscAAV-Flag-FGFR4

This paper

N/A

Plasmid:pCMV-HA-FGFR4

This paper

N/A

Plasmid:pCMV-Flag-NF2

This paper

N/A

Plasmid:pCMV-Myc-Raf1

This paper

N/A

Plasmid:pCMV-HA-MST2

This paper

N/A

Plasmid:pCMV-Flag-FGFR4

This paper

N/A

Plasmid:pscAAV-TBG-CRE

This paper

N/A

Plasmid:pscAAV-GFP

This paper

N/A

Plasmid:pCMV-Flag-SHP

This paper

N/A

Plasmid:pscAAV-Flag-SHP

This paper

N/A

Plasmid:pscAAV-HA-SHP

This paper

N/A

Plasmid:pCMV-Flag-MST1

This paper

N/A

Plasmid:pCMV-Flag-MST2

This paper

N/A

Plasmid:pCMV-Flag-WW45

This paper

N/A

Plasmid:pCMV-HA-WW45

This paper

N/A

Plasmid:pCMV-Flag-MST2(K/R)

This paper

N/A

Plasmid:pCMV-HA-SHP(S28A)

This paper

N/A

Plasmid:pCMV-HA-SHP(S28D)

This paper

N/A

Plasmid:pCMV-HA-SHP(S26A)

This paper

N/A

Plasmid:pCMV-HA-SHP(T58A)

This paper

N/A

Plasmid:pCMV-HA-SHP(TripA)

This paper

N/A

Plasmid:pscAAV-Flag-SHP

This paper

N/A

Plasmid:pscAAV-shScrambled

This paper

N/A

Plasmid:pCMV-HA-WW45(DSarah)

This paper

N/A

Plasmid:pCMV-HA-WW45(DWW)

This paper

N/A

Plasmid:pCMV-HA-WW45(184-383)

This paper

N/A

Plasmid:pLV-H1-EF1a-puro-shNF2 1

This paper

N/A

Plasmid:pLV-H1-EF1a-puro-shNF2 2

This paper

N/A

Plasmid:pLV-H1-EF1a-puro-shNF2 3

This paper

N/A

Plasmid:pLV-H1-EF1a-puro-shNF2 4

This paper

N/A

Plasmid:pGEX-2TM-Mst1

This paper

N/A

Plasmid:pGEX-2TM-WW45

This paper

N/A

Plasmid:pET-28a-His-SHP

This paper

N/A

Plasmid:pET-28a-His–SHP(S28A)

This paper

N/A

Plasmid:pGEX-2TM-Raf1

This paper

N/A

Plasmid:pGEX-2TM-FGFR4.C

This paper

N/A

Plasmid:pET-28a-His-NF2

This paper

N/A

Plasmid:pCMV-Flag-NF2(Y207F)

This paper

N/A

Plasmid:pCMV-Flag-FGFR4(KD)

This paper

N/A

Prism5

GraphPad

www.graphpad.com/ scientificsoftware/pri-sm

R version 3.1.2

https://www.r-project.org

N/A

Software and Algorithms

(Continued on next page)

e5 Developmental Cell 48, 1–15.e1–e9, February 25, 2019

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

ImageJ

https://imagej.nih.gov/ij

N/A

Agilent Masshunter Qualitative Analysis and QQQ Qualitative Analysis

Agilent

https://www.agilent.com

ProteinPilot

Proteinpilot

Version 4.5

CONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for reagents should be directed to and will be fulfilled by the Lead Contact, Dawang Zhou (dwzhou@ xmu.edu.cn). EXPERIMENTAL MODEL AND SUBJECT DETAILS Animals The mice WW45fl/fl, Mst1 fl/fl, Yapfl/fl (Lu et al., 2010), and Mst2 fl/fl (Zhou et al., 2009), and Fxr knockout (Sinal et al., 2000) were obtained as indicated. Wild-type C57BL/6, Tg (Alb-Cre)21Mgn/J (stock number 003574) mice were originally purchased from the Jackson Laboratory. All mice were maintained under specific pathogen-free conditions at the Xiamen University Labortory Animal Center. These mouse experiments were approved by the Institutional Animal Care and Use Committee and were in strict accordance with good animal practice as defined by the Xiamen University Laboratory Animal Center. Generation of Fgfr4 Floxed Mice To construct the Fgfr4 floxed allele, we built a targeting vector that contained two LoxP sites flanking exons 9-11, which encode the transmembrane, intracellular juxtamembrane, and a part of the tyrosine kinase domains. Deletion of these exons will lead to an inactivated allele. Mouse embryonic stem (ES) cells were transfected with the targeting vector via electroporation. The correctly targeted ES cell clones were identified by Southern hybridization. The positive ES cells were microinjected to blastocysts harvested from albino C57 mice according to standard protocols. The chimeric mice were crossed with C57/BL6 mice for generation of agouti F1 mice, which were analyzed by Southern blot with the 3’ and 5’ external probes to validate germ line transmission of the Fgfr4 floxed allele. METHOD DETAILS Parabiosis Surgery Parabiosis surgery followed previously described procedures (Kamran et al., 2013). Mirror-image incisions at the left and right flanks were made through the skin, and shorter incisions were made through the abdominal wall. The peritoneal openings of the adjacent parabionts were sutured together. Elbow and knee joints from each parabiont were sutured together and the skin of each mouse was sutured to the skin of the adjacent parabiont with absorbable 4-0 suture. Each mouse was injected subcutaneously with Baytril antibiotic and Buprenex as directed for pain and monitored during recovery. For overall health and maintenance behavior, several recovery characteristics were analyzed at various times after surgery, including paired weights and grooming behavior. Chemicals, Drugs, Supplements and Other Materials DMEM (#41966052), Williams’Medium E (#32551087), Trypsin (#15400054), Lipofectamine 2000 (#11668019), and FGF19 Recombinant Protein (#PHG0244) were obtained from Thermofisher scientific. Fetal bovine serum (#F-9665), Cholestyramine resin (#C4650), were purchased from Sigma-Aldrich. Cycloheximide (#HY12320) and FXR angonist GW4064 (#HY-50108) was obtained from MCE. Sphingosine-1-phosphate (#1370) was obtained from TOCRIS. Cell Culture The 293T, HeLa and HepG2 cell lines (from the American Type Culture Collection) were tested for mycoplasma contamination and were found to be negative, then were cultured in DMEM supplemented with 10% FBS and 13 penicillin-streptomycin (Invitrogen). Separation of Plasma Proteins Using FPLC Mst1/2 DKO mouse serum (0.2 ml) was diluted 1:1 with PBS and injected onto a Superdex 200 Increase 10/300GL FPLC column (GE Healthcare, 28990944). Serum proteins were eluted from the column at a constant flow of 0.3 ml/min with PBS (pH 7.4). The effluent was collected in 0.25-ml fractions. The collected fractions were frozen in dry ice and kept at –80 C until further processing.

Developmental Cell 48, 1–15.e1–e9, February 25, 2019 e6

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

Mass Spectrometry After staining of gels with Coomassie blue, excised gel segments were subjected to in-gel trypsin digestion and dried. Peptides were dissolved in 10 ul 0.1% formic acid and were auto-sampled directly onto a C18 PepMap (75 mm x 15 cm,2mm,100A˚). Samples were then eluted for 60mins with linear gradients of 3–35% acetonitrile in 0.1% formic acid at a flow rate of 300 nl/min. Mass spectra data were acquired with a Orbitrap Fusion Lumos mass spectrometer (Thermo Fisher) equipped with a nanoelectrospray ion source. Data were collected at an IDA mode. The Raw files were searched with Proteome Discoverer 2.2or Maxquant against uniprot database. GST/His Pull-down Assays His-tagged and GST-tagged plasmids were transformed and amplified in BL21 bacteria, and protein production was induced by IPTG. His-tagged proteins were purified by using nickel affinity gel (Sigma), and GST-tagged proteins were purified from bacteria by using glutathione Sepharose (GE Healthcare). For GST pull-down experiments, His-tagged proteins were eluted with a 10 mM imidazole buffer; For His pull-down experiments, GST-tagged proteins were eluted with elution buffer (50 mM Tris–HCl (pH 8.0), 100 mM NaCl, 10 mM glutathione). Then the purified proteins were incubated with the beads binding proteins in pull-down buffer (20 mM Tris, 1 mM EDTA, 1% Triton X-100, 1 mM b-meraptoethanol) for 2 hr at 4 C. Beads were then washed three times in pulldown buffer before adding the sample SDS buffer. In Vitro Kinase Assay For FGFR4 kinase assay, WT and kinase dead FGFR4 were isolated from transfected 293T cells lysed, and immunoprecipitated with anti-Flag M2 beads. Immunoprecipitates were washed 2–3 times with cell lysate buffer (20 mM Tris, pH 7.5, 137 mM NaCl, 1% Triton X-100, 1 mM sodium vanadate, 5 mM EDTA, 10% glycerol, 10 mg/ml Aprotinin). Equal amounts of His-NF2 protein, either alone or in complex with various forms of FGFR4 kinase, as visualized by Coomassie blue, were incubated in kinase assay buffer (20 mM Tris, pH 7.5, 10 mM MnCl2, 5 mM MgCl2, 1 mM ATP) at 30 C for 30min. The reaction was terminated by adding 43 SDS sample buffer and followed by boiling for 5 min in 100 C water bath. The mixture was separated by SDS-PAGE and analyzed by WB. For Mst1 kinase assay, equal amounts of purified GST-SHP and GST-SHP (S28A) protein, either alone or in complex with His-Mst1 kinase and His-WW45, were incubated in kinase assay buffer and analyzed in the same way as described above. FGF15 ELISA Assay Mice serums were collected and snap-frozen with liquid nitrogen, and then stored at -80 C, thawed before using. The concentrations of mouse FGF15 in serum were measured with Mouse FGF15 ELISA kit (MEL154Mu, Wuhan USCN Business Co. Ltd) according to the manufacturer’s instructions. Immunohistochemistry The tissue specimens were fixed overnight in 10% neutral-buffered formalin and then were dehydrated in increasing concentrations of isopropyl alcohol, followed by clearing of alcohol by xylene. The specimens were subsequently embedded in paraffin wax in cassettes for facilitation of tissue sectioning. Standard staining with hematoxylin and eosin was performed on sections 5 mm in thickness from each specimen block. For immunohistochemistry, liver sections were deparaffinized and incubated in citrate buffer at 95 C for 40 min for antigen retrieval and then blocked with 5% horse serum for 30 min followed by incubating overnight at 4 C with the primary antibodies including anti-BrdU (1:100 dilution, life technologies, MA3-071), anti-CK19 (1:50 dilution, Boster, BM3267), anti-Ki67 (1:100 dilution, Cell signaling, 12202). After three washes, tissue sections were incubated with biotinylated anti-mouse IgG (1:200 dilution, Vector Laboratories) at room temperature (RT) for 1 hr and then washed three times followed with streptavidin– horseradish peroxidase conjugates (Vector Laboratories) incubation for 45 min. After three washes with PBS, the slides were incubated with DAB solution (Vector Laboratories) and then counterstained with haematoxylin. Immunofluorescent Staining For preparation of tissue sections, the liver sections were deparaffinized and incubated in citrate buffer at 95 C for 40 min for antigen retrieval and then blocked with 5% BSA for half an hour followed by incubation overnight at 4 C with the primary antibodies including anti-SHP (1:200 dilution, homemade), anti-Cyp7a1(1:100 dilution, Millipore, MABD42), anti-Yap (1:500 dilution, Cell signaling, 14074), anti-b-catenin (1:200 dilution; Abcam, AB6301) and anti-Flag (1:400 dilution, Sigma-Aldrich, F1804). After three washes with PBS, tissue sections were incubated for 1 hr with secondary antibodies (Alexa Fluor 488-conjugated anti–mouse IgG (A21202), Alexa Fluor 488–conjugated anti–rabbit IgG (A21206) or Alexa Fluor 555–conjugated anti–mouse IgG (A31570), all from Invitrogen). Subsequently, the sections were washed three times with PBS and mounted with Vectashield mounting medium containing DAPI (Vector Laboratories). For preparation of cellular samples, the cells were washed three times with PBS and were fixed for 15 min at RT with 4% (vol/vol) paraformaldehyde, after which additional immunofluorescence staining was applied. The primary antibodies anti-a-tubulin (1:250 dilution; Cell signaling, 2125), and anti-Yap (1:500 dilution, Cell signaling, 14074) were used. Fixed cells were rinsed with PBS and then incubated for 10 min on ice with 0.2% TritonX-100 and 0.2% BSA in PBS. Following permeabilization, nonspecific binding in the cells was blocked by incubation for 30 min at room temperature with 0.02% Triton X-100 and 5% BSA in PBS and cells were incubated for 1 hr with specific primary antibodies (identified above). After three washes with PBS, the cells were incubated for another 1 hr with secondary antibodies (Alexa Fluor 488-conjugated anti–mouse IgG (A21202), Alexa Fluor 488–conjugated anti–rabbit IgG (A21206) or Alexa Fluor 555–conjugated anti–mouse IgG (A31570), all from Invitrogen). Subsequently, the e7 Developmental Cell 48, 1–15.e1–e9, February 25, 2019

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

cells were washed three times with PBS and were mounted with Vectashield mounting medium containing DAPI. All images were collected with a confocal microscope (Zeiss LSM 780). In Vivo Ubiquitination Assay For the in vivo ubiquitination assay, 293T cells were transfected for 36 h with the appropriate plasmids and were lysed in ice-cold lysis buffer (‘‘TNTE 0.5%’’: 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA and 0.5% Triton X-100, containing 10 mM NaF, 2 mM Na3VO4, 10 mg/ml leupeptin and 1 mM PMSF). The cell lysates were then subjected to immunoprecipitation with anti-Flag, then were eluted by being boiled for 10 min in 1% SDS, were diluted 10 times in lysis buffer ‘TNTE 0.5%’ and then were re-immunoprecipitated with anti-Flag (two immunoprecipitations). The ubiquitin-conjugated proteins were detected by immunoblot analysis with the appropriate antibodies. Generation and Delivery of Recombinant AAV8 Virus To generate adeno associated virus of serotype 8, 293T cells were cotransfected with scAAV plasmid containing the gene of interest (FGF15, FGFR4 kinase domain, SHP, SHP (S28D) or luciferase), S1PR2 shRNA or shscrambled, adenovirus helper, plasmid PXX6 and AAV8 helper plasmid p5E18-VD28. Cells were harvested at 60 hr post transfection. The crude virus were released from 293T cells after 3 times of freeze and thaw, and then further purified with chloroform treatment and PEG8000-(NH4)2SO4 partition. The virus fraction were dialyzed in PBS solution and concentrated by Amicon Ultra centrifugal filter. The AAV titer was determined by RT-PCR using primers against the CMV or TBG promoter on the AAV vector. For adult mice AAV infection, animals received a tail vein injection of 1x1011 genome copies of AAV per mouse. For neonatal mice AAV infection, animals received a superficial temporal vein injection of 2x1010 genome copies of AAV per mouse. AAV-luciferase (AAV-CTR) was used as the infection control for experiments involving gene overexpression in the liver, and AAV-shscrambled (AAV-shCTR) was used as infection control for experiments involving gene knockdown in the liver. Hepatocyte Isolation Mouse primary hepatocytes were isolated by the two-step liver perfusion method. Briefly, the mouse was anesthetized with intraperitoneal injection of pentobarbital sodium (10 mg/kg body weight). The abdomen was then cut open, and the portal vein was catheterized. The liver was first perfused in situ with D-Hank’s buffered solution (containing 0.5 mM EGTA, pre-warmed to 37 C) for 8-10 min with the inferior vena cava cut for drainage and then perfused for 5 min with 0.12 PZ-U/ml collagenase perfusate (containing 2 mM Ca2+). The livers were extirpated and transferred into plates filled with DMEM at 4 C. The hepatic capsules were torn, and the livers were gently shaken to help the cells detach. The cell suspension was collected and filtered through 40 mm cell strainers (BD Falcon), resuspended in Percoll/ DMEM/PBS (1:1:0.3) mixture and centrifuged at 50g for 15 min at RT. Cell viability was examined by the Trypan blue exclusion test (generally >90%). shRNA and Lentiviral Infection The shRNA-targeted sequences were synthesized. Oligo pairs were annealed and subcloned into the polylinker region of the pLVH1-EF1a-puro vector (Biosettia, SORT-B19). Lentivirus was produced by cotransfecting 293T cells with the shRNA in the vector, VSV-G and delta 8.9 plasmids using Lipofectamine 2000 (Invitrogen). Viral supernatant was harvested at 48-72 h post-transfection, passed through a 0.45 mmfilter, diluted 2:3 with fresh medium containing 8 mg/ml polybrene and used to infect the target cells at 80% confluence. Protein expression was visualized by immunoblotting. Hydrodynamic Gene Delivery Hydrodynamic delivery of 100mg of pscAAV-TBG-Flag-Cre or control pscAAV-GFP plasmid in 2 ml of Ringer’s solutions (147 mM NaCl, 4 mM KCl, 1.13 mM CaCl2) was performed via tail vein injections within 5 s. FXR Agonist GW4064 Treatment For FXR agonist GW4064 treatment, GW4064 was dissolved in 1% (v/v) sodium carboxymethylcellulose and 1% Tween-80 and mice were administered by oral gavage at 100mg/kg body weight. The control group received the solvent only. Liver tissues were harvested for RNA purification, protein extraction or histology at the indicated times. Circadian Studies Age-matched wild-type and Mst1/2 DKO male mice were housed under light-dark (12 h/12 h) conditions: lights on at 06:00 (ZT0) and lights off at 18:00 (ZT12). For circadian studies, 8-12-week-old male mice were killed with isoflurane every 4 h for 24 h. Liver tissues were harvested for mRNA assay of Cyp7a1. Quantitative Real-time PCR Following isolation with TRIzol reagent (Invitrogen), mRNA was specifically purified with a RNAeasy Mini Kit (Qiagen). First-strand cDNA was then obtained with the PrimeScript RT reagent Kit with gDNA Eraser (Takara). Real-time quantitative PCR was performed using SYBR Premix Ex TaqII (Takara) and the Bio-Rad iCycler iQ system (Bio-Rad, Hercules, CA, USA). All runs were accompanied by the internal control gene Gapdh. The samples were run in triplicate and normalized to Gapdh using a DD cycle threshold-based Developmental Cell 48, 1–15.e1–e9, February 25, 2019 e8

Please cite this article in press as: Ji et al., FGF15 Activates Hippo Signaling to Suppress Bile Acid Metabolism and Liver Tumorigenesis, Developmental Cell (2018), https://doi.org/10.1016/j.devcel.2018.12.021

algorithm, to provide arbitrary units representing relative expression levels. The primer sequences for specific genes are in Key Resources Table. Measurement of Total Bile Acids Human serums were obtained with informed consent from human tissue banks of the first affiliated hospital and Zhongshan Hospital of Xiamen University. Total bile acids in serums were measured enzymatically using the Total Bile Acids Assay Kit (#80470, Crystal Chem). Human and mouse serum samples were measured directly according to the manufacturer’s instructions. For measurement of bile acids in liver, intestine (with contents), gallbladder and feces, biological samples were minced, and extracted in 75% ethanol at 50  C for 2 h, and then the bile acid concentration was measured enzymatically. The total bile acid pool size was determined as total bile acid amount in the small intestine, gallbladder, liver, and their contents. After the mice were weighed, anesthetized, and exsanguinated, the fresh organs were collected, minced together, and extracted in 75% ethanol at about 50  C for 2 h. The extract was centrifuged, and the bile acid pool size of the supernatant was determined enzymatically. Human Liver and HCC Samples Human samples for western blot analysis were obtained with informed consent from the human tissue banks of the first affiliated hospital and Zhongshan Hospital of Xiamen University. Regarding correlation analysis, we took binary logarithm ratio of the protein’s expression in the cancer tissue and the matched paracancerous tissue. The intensities of the immunoblot bands of paired samples of adjacent tissue (N) and tumor tissue (T) were quantified using ImageJ software. The relative ratios of NF2, p-Mob1, p-YAP, FGFR4 and p-Erk in paired samples were calculated. A heatmap was used to represent the ratio of the relative expression of the proteins NF2, p-Mob1, p-YAP, FGFR4 and p-Erk in the T and N sample from each patient. Clustering was performed by using centroid linkage with Euclidean distance. We used ‘‘Pearson correlation coefficient’’ to evaluate the correlation of the log-ratios of paired proteins among FGFR4, NF2, p-Yap, p-Mob1 and p-Erk. Then the significance of correlation coefficients was tested against the null hypothesis of zero-correlation, using two-sided t test. We adjusted the p value using ’’Holm–Bonferroni’’ method and set 0.05 to the significance level. The tools for correlation analysis are available from R version 3.5.0, which can be downloaded from https:// www.r-project.org. All experiments were performed with the approval of the Xiamen University Review Board. Snap-frozen biopsies from specimens of normal liver tissue (distant from the tumor) and HCC were collected. The diagnosis of HCC or normal liver was confirmed based on histological findings by independent pathologists. Cholestyramine Resin Treatment Cholestyramine resin feeding experiments were performed with experimental diets consisting of the control diet supplemented with 2% (w/w) Cholestyramine resin. For short-term treatment, 6-week-old WT or Mst1/2 DKO mice were fed for 4 weeks. For long-term therapy, 12-week-old WT or Mst1/2 DKO mice were fed for 8 weeks. Liver tissues used for RNA purification, protein extraction, or histology were harvested at the indicated times. QUANTIFICATION AND STATISTICAL ANALYSIS Statistics and Reproducibility All data are representative of at least three independent experiments. All statistical analyses were performed using Prism5 (GraphPad). The data are presented as the mean± SD and Student’s t test was used for comparisons between two groups. A p value 0.05 was considered statistically significant. In the graphed data *, **, *** and **** denote p values of < 0.05, 0.01, 0.001 and 0.0001, respectively. Most experiments were carried out at least three times, and the findings of all key experiments were reliably reproduced. All replicates and precise P values are documented in figure legends and reporting summary. DATA AND SOFTWARE AVAILABILITY All data generated or analysed during this study are included in this manuscript (and its supplementary information files).

e9 Developmental Cell 48, 1–15.e1–e9, February 25, 2019