FGF2 transcript levels are positively correlated with EGF and IGF-1 in the malignant endometrium

Available online at www.sciencedirect.com

Cancer Letters 259 (2008) 146–155 www.elsevier.com/locate/canlet

FGF2 transcript levels are positively correlated with EGF and IGF-1 in the malignant endometrium Giannoula Soufla a, Stavros Sifakis b, Demetrios A. Spandidos a

a,*

Department of Virology, Medical School, University of Crete, PO Box 1527, Heraklion 71003, Crete, Greece b Department of Obstetrics and Gynecology, University Hospital of Heraklion, Crete, Greece Received 13 August 2007; received in revised form 3 October 2007; accepted 3 October 2007

Abstract Background. Epidermal and insulin-like growth factors (EGF, IGFs) act as mitogens promoting endothelial cell proliferation and differentiation. Accumulating evidence for interactions between EGF and IGF signaling pathways has been reported. Fibroblast Growth Factor-2 (FGF2) is also mitogenic for various cell types and is associated with regulation of tumor angiogenesis and metastasis. However EGF, IGF-1 and FGF2 transcript levels have been scarcely investigated in endometrial carcinoma. Methods. In the present study, we evaluated the mRNA expression pattern of EGF, IGF-1 and FGF2 by using Comparative Quantitative real-time RT-PCR assay in 30 endometrial cancer specimens and an equal number of adjacent normal tissues. Results. Both overexpression and down-regulation of EGF, IGF-1 and FGF2 was demonstrated in endometrial cancer compared to the adjacent normal specimens; however the main features of cancer were IGF-1 and EGF down-regulation and FGF2 up-regulation. Different co-expression patterns of all three factors were displayed in normal and malignant endometrium. Interestingly, FGF2 mRNA was positively correlated with EGF and IGF-1 transcript levels in endometrial cancer (P = 0.024 and P = 0.006, respectively), while no co-expression was observed in the adjacent normal specimens. Furthermore, endometrial tissue-pair analysis revealed a significant positive correlation between EGF and IGF-1 (P = 0.010), supporting the hypothesis of a cross-talk between IGF- and EGF-mediated signaling pathways in endometrial cancer. EGF transcript levels were marginally higher in endometrioid than non-endometrioid tumors (P = 0.050), and in grade I compared to grade II tumors (P = 0.053). Conclusions. Up-regulation as well as down-regulation of EGF, IGF-1 and FGF2 transcript levels is observed in endometrial cancer; however IGF-1 and EGF down-regulation and FGF2 up-regulation seem to comprise the main features of endometrial carcinogenesis. The disruption of their mRNA co-expression pattern observed supports the hypothesis of a cross-talk between IGF- and EGF-mediated signaling pathways in promoting endothelial cell proliferation and differentiation in endometrial cancer.  2007 Elsevier Ireland Ltd. All rights reserved. Keywords: EGF; IGF-1; FGF2; Real-time PCR; Endometrial cancer

*

Corresponding author. Tel.: +30 2810 394631; fax: +30 2810 394759. E-mail address: [email protected] (D.A. Spandidos).

0304-3835/$ - see front matter  2007 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.canlet.2007.10.002

G. Soufla et al. / Cancer Letters 259 (2008) 146–155

1. Introduction Endometrial cancer is one of the most common gynaecological malignancies [1]. Tumor development and progression in the endometrium, as in most human carcinomas, is mediated by angiogenesis. This complex procedure is an indispensable requirement for tumor growth, as well as invasiveness and metastasis [2]. The uterine endometrium however, is a dynamic organ that undergoes periodic growth, remodeling and breakdown under hormonal influence during the menstrual cycle. Nevertheless induction of abnormal angiogenesis during endometrial cancer development has been well documented [1]. Tumor and stromal vascularization has been shown to provide prognostic information for patients with endometrial cancer [3,4]. Numerous growth factors and cytokines are involved in the angiogenic process accompanying endometrial carcinogenesis. Among them, Epidermal and Insulin growth factors (EGF, IGFs) act as mitogens promoting endothelial cell proliferation and differentiation. Fibroblast Growth Factor-2 (FGF2) is also mitogenic for various cell types and is associated with regulation of tumor angiogenesis and metastasis. EGF exerts its proliferative function through binding to its receptor EGFR, a 170-kDa transmembrane protein with tyrosine kinase action. Extracellular ligand binding induces dimerization and consequently activation of the intracellular tyrosine kinase. Limited information is available regarding EGF mRNA levels in the premalignant and malignant endometrium [5,6]. Previous studies on the field are suggestive of either higher or lower EGF transcript levels in endometrial cancer compared to normal endometrium, therefore they are not adequate to elucidate EGFs exact role in the malignant transformation of the endometrium. The IGF signaling pathway on the other hand is more complex. IGF-1 is a hormone-dependent growth factor with a molecular weight of 7650 kDa, which binds to its receptor IGFR-1 under the regulation of IGF binding proteins [7]. Estrogen has been shown to stimulate IGF-1 gene expression in the endometrium [7,8] and IGF-1 is assumed to mediate estrogen action through autocrine as well as paracrine mechanisms. Originally it was considered that these agents manifest their mitogenic functions through separate pathways, but a growing body of evidence supports the hypothesis of interactions between estrogen and

147

IGF signaling pathways. Increased levels of plasma IGF-1 in women have been associated with increased risk of developing cervical, ovarian or endometrial cancer [9,10]. Giudice et al. provided evidence of IGF-I involvement in endometrial growth regulation [11] but the underlying mechanism of its participation in endometrial carcinogenesis is not yet clarified. FGF2 can affect tumor vasculature not only through paracrine but also through autocrine or possibly intracellular signaling [12]. FGF2 exists as five distinct isoforms with distinct subcellular localizations. FGF2 is produced as a cytoplasmic 18-kDa isoform that can be released and as four high-molecular weight (HMW) isoforms that are nuclear. The 18kDa FGF2 is the predominant isoform released from cells, and enters the nucleus via a receptor-dependent pathway. FGF2 mediates tumor metastasis through the remodeling of the extracellular matrix. FGF2 has been proposed to be a key regulator of angiogenesis in prostate cancers [13,14], skin melanoma [15] and pancreatic cancer [16]. It has also been implicated in cervical cancer development by our research group [17], but its role in endometrial carcinogenesis has scarcely been examined. In the present study, we evaluated the mRNA expression pattern of the most important mitogens that regulate angiogenesis in endometrial cancer: EGF, IGF-1 and FGF2. Our goal was to examine their significance as possible markers of malignant transformation of the endometrium, as well as to investigate the underlying mechanism mediating their expression during endometrial cancer development and progression. Therefore, EGF, IGF-1 and FGF2 mRNA levels were assessed by quantitative real-time PCR analysis in endometrial cancer and adjacent normal tissue specimens. A few cases of atypical endometrial hyperplasia were additionally investigated. The expression profile of the above genes was correlated with clinical parameters. Moreover, the ratio of the transcript levels of each gene in the tumor specimen to that of the adjacent normal tissue was used to provide a distinct molecular portrait of each tumor that was subsequently compared with clinicopathological features. This is the first assessment according to our knowledge of the mRNA co-expression pattern of EGF, IGF-1 and FGF2 (pair-wise) in normal and malignant endometrium, with the scope of elucidating possible interactions between these mitogenic growth factors during the process of endometrial carcinogenesis.

148

G. Soufla et al. / Cancer Letters 259 (2008) 146–155

2. Materials and methods 2.1. Tissue specimens Specimens were surgically obtained from a total of 34 patients who underwent hysterectomy as a therapy at the Department of Obstetrics and Gynecology of PAGNH University Hospital Crete, from 2003 to 2004. Tissue specimens were obtained at the time of the surgery and each specimen was bisected. Half of the sample was snap frozen and stored at 80 C until required for RNA extraction. The other half was fixed in 10% formaldehyde solution for histopathological examination. Age at the time of surgery ranged from 31 to 88, mean (64.8 ± 14.1). Only one woman was in the reproductive period and the rest were in menopause. Staging was reviewed based on the International Federation of Obstetrics and Gynecology (FIGO) staging system: 14 cancer specimens were of stage I, 12 of stage II and 4 of stage III. Endometrial cancer patients were stratified according to tumor histological cell type and differentiation grade. In addition, four patients suffering from atypical endometrial hyperplasia (AEH) were also examined. Table 1 summarizes the clinical characteristics of the patients’ with endometrial cancer. Tissue biopsies had been previously received from all the patients with cancer to establish the diagnosis, but none of them had undergone any radiotherapeutic or chemotherapeutic treatment prior to hysterectomy and tissue biopsies for the present study. The Ethics Committee of the University of Crete approved the present study, and all participating patients gave written informed consent. 2.2. RNA extraction and reverse transcription (RT-PCR) Total RNA was isolated from fresh tissues using the Trizol reagent (Life Technologies Ltd., UK) according to the manufacturer’s instructions. Tissue specimens were homogenized in the TRIzol reagent (Invitrogen, Carlsbad, CA) using a power homogenizer and incubated at room temperature, followed by chloroform addition and centrifugation. Total RNA was precipitated from the supernatant with isopropanol, washed with 75% ethanol and resuspended in 50 ll DEPC-treated water. RNA concentration was calculated after measuring on a UV spectrophotometer (Hitachi Instruments Inc., USA) its 260nm absorbance and 260/280-nm absorbance ratio. One percent agarose gel electrophoresis and ethidium bromide staining were used to examine RNA integrity. Reverse transcription reactions for the preparation of first-strand cDNA from 2 lg of total RNA, were performed using the ‘‘Reverse transcription kit’’, according to the manufacturer’s protocol (Promega USA). Random hexamers were used as amplification primers. In detail, 2 lg of total RNA, 50 ng of random hexamers and 1 mM dNTPs were heated at 70 C for 10 min, in order

Table 1 Clinical and histological characteristics of patients with endometrial carcinoma Characteristic

No. of patients

Total no. of patients AEH Endometrial cancer

34 4 30

Age Mean ± SEM Range

64.8 ± 14.1 31–88

Menopausal status Pre Post

1 29

Histological cell type Endometrioid Non-endometrioid Serous papillary Clear cell Mixed

23 7 2 1 4

Histological grade G1 G2 G1–G2 G3

6 17 2 5

FIGO stage I II III

14 12 4

Myometrial invasion <50% >50%

16 14

Cervical involvement Positive Negative

10 20

Extra-uterine disease Positive Negative

6 24

LVS involvement Positive Negative

0 30

to remove RNA secondary structures, and placed on ice until the addition of cDNA synthesis mix, which contained 1· cDNA synthesis buffer (50 mM Tris–acetate, pH 8.4, 75 mM potassium acetate, 8 mM magnesium acetate), 5 mM dithiothreitol (DTT), 40 U RNasinTM (Promega) and 15 U reverse transcriptase (Promega). The final mix (volume 20 ll) was incubated for 10 min at 25 C for primer extension, and cDNA synthesis was conducted at 42 C for 60 min. The reaction was terminated by heating at 95 C for 5 min. In order to remove the RNA template, cDNA was incubated at 37 C for 20 min with 2 U of Escherichia coli RNaseH, and stored at 20 C until use.

G. Soufla et al. / Cancer Letters 259 (2008) 146–155

2.3. Real-time PCR Real-time PCRs were carried out in the Mx3000P RealTime PCR system (Stratagene, USA) by using the SYBR Green I Master Mix (Stratagene, USA) according to the manufacturer’s instructions. Data were collected and analysed with the use of the Mx3000P Real-Time PCR software version 2.00, Build 215 Schema 60 (Stratagene, La Jolla, CA). Specifically all growth factors’ mRNA expression was measured using a real-time RT-PCR assay with SYBR Green I. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as internal control, in order to normalize EGF, IGF-1 and FGF2 mRNA expression levels. The mRNA-specific primers used are listed in Table 2. After initial experiments, in order to optimize primers’ concentration and annealing temperature, 1 ll cDNA from normal, hyperplasia or malignant endometrial samples was amplified in a PCR containing 2· Brilliant SYBR Green QPCR Master Mix (containing 2.5 mM MgCl2), 300 nM of each primer and 30 lM Rox passive reference dye, in a final volume of 20 ll. To ensure the accuracy of quantification measurements, a representative pool of all samples was diluted in a series of seven 2· dilutions, and was run in the same plate, in order to construct a standard curve for the quantification process. After initial denaturation at 95 C for 10 min, samples were subjected to 45 cycles of amplification, comprised of denaturation at 95 C for 30 s, annealing at 60 C for 30 s and elongation at 72 C for 30 s, followed by a melt curve analysis, in which the temperature was increased from 55 to 95 C at a linear rate of 0.2 C/s. Data collection was performed both during annealing and extension, with two measurements at each step, and at all times during melt curve analysis. To verify the results of the melt curve analysis, PCR products were analyzed by electrophoresis in 2% agarose gels, stained with ethidium bromide and photographed on a UV light transilluminator. The PCR product length of all growth factors analyzed is presented in Table 2. In each PCR two negative controls were included, one with no cDNA template and one with no reverse transcription treatment. Peptide growth factor transcription levels were calculated using

149

the following formula: NormalizedSample=Control ¼ ð1 þ EGF ÞDCt GF=ð1 þ EGAPDH ÞDCt GAPDH. Twofold increased or decreased expression was considered significant. Representative examples of real-time quantitative PCR amplification plots and dissociation curves corresponding to the target genes or internal control (GAPDH) are presented in Fig. 1. Procedures were repeated with cDNA template synthesized 3 times from the same RNA. Each sample’s mRNA levels for every growth factor tested represent the mean value of data acquired from three independent RT-PCR experiments. 2.4. Statistical analysis One sample Kolmogorov–Smirnov test was employed to assess the normal distribution of the mRNA expression values of all genes studied. The mRNA expression of EGF, IGF-1 and FGF2 was compared between the groups of normal and pathological samples, as well as between the groups of different clinicopathological features (histological cell type, differentiation grade, myometrial invasion, etc.) by the use of non-parametric procedures (Kruskal Wallis and Mann–Whitney test). The Spearman rank correlation (non-parametric test) was employed to examine the growth factor mRNA correlation pair-wise. Finally the Chi-Square (v2) test was used to assess differences in EGF, IGF-1 and FGF2 mRNA expression status (overexpression or down-regulation) in the groups of endometrial cancer and endometrial atypical hyperplasia cases. Probability values less than 0.05 were considered statistically significant. Statistical calculations were performed using the SPSS software, version 11. 3. Results

Growth factor

Primer pair sequence (5 0 –3 0 )

Product size

EGF

CTTGTCATGCTGCTCCTCCTG TGCGACTCCTCACATCTCTGC

118

IGF-1

CCTCCTCGCATCTCTTCTACCTG CTGCTGGAGCCATACCCTGTG

166

In the present study, we evaluated the mRNA expression profile of EGF, IGF-1 and FGF2 using a quantitative real-time RT-PCR method. FGF2 and GAPDH amplification plots and dissociation curves are representative examples of the analysis and are presented in Fig. 1. Our study group consisted of 30 endometrial cancer tissues, and adjacent normal tissue specimens of all subjects. We additionally examined four atypical endometrial hyperplasia (AEH) and adjacent normal specimens. Transcript levels of the housekeeping gene GAPDH were also evaluated in all samples by real-time PCR analysis, in order to be used as an internal control. The ratio of each growth factor’s (EGF or IGF-1 or FGF2) transcript levels, versus GAPDH mRNA levels of the same specimen served as its normalized mRNA levels.

FGF2

CTGGCTATGAAGGAAGATGGA TGCCCAGTTCGTTTCAGTG

149

3.1. Transcript levels of EGF, IGF-1 and FGF2

GAPDH

GGAAGGTGAAGGTCGGAGTCA GTCATTGATGGCAACAATATCCACT

101

Table 2 Primer sequences used for quantitative real-time RT-PCR

Transcript levels of all three mitogenic growth factors studied (normalized to GAPDH) were found to be similar in normal and malignant endometrial speci-

150

G. Soufla et al. / Cancer Letters 259 (2008) 146–155

Fig. 1. Representative examples of real-time quantitative PCR using SYBR Green I detection dye. (a) Amplification plots of target gene (FGF2 in this case), (b) dissociation curves of target gene (FGF2), (c) standard curve of target gene (FGF2), (d) amplification plots of internal control (GAPDH), (e) dissociation curves of internal control (GAPDH), (f) standard curve of internal control (GAPDH).

mens. Specifically mRNA levels of all three genes were not found to be significantly different between pathological (hyperplasia or cancer) and adjacent normal specimens. Furthermore, no significant differences in mRNA levels of EGF, IGF-1, or FGF2 were observed between cancer and endometrial hyperplasia specimens. Fig. 2 depicts the mRNA expression profile of EGF, IGF-1 and FGF2 in the normal and the malignant endometrium. EGF transcript levels were found to be higher in endometrial cancer tissues of grade 1 (mean = 2.73 ± 1.10), than grade 2 tumors (0.73 ± 0.30), but the difference was marginally non-significant (P = 0.053, Mann–Whitney test) (Fig. 3). IGF-1 and FGF2 mRNA levels were not found to be associated with any clinicopathological feature of the specimens examined such as tumor histological type, grade, or FIGO stage. Furthermore, the transcript

levels of all three growth factors studied were not associated with parameters such as myometrial invasion, cervical involvement or the presence of extra-uterine disease. 3.2. mRNA co-expression analysis pair-wise Spearman correlations for evaluation of EGF, IGF-1 and FGF2 co-expression patterns in the groups of cancer and adjacent normal endometrial tissue specimens are demonstrated in Table 3 (A and B, respectively). Different co-expression patterns of all genes were displayed in normal and malignant endometrium. In normal specimens, no correlations were observed between the three mitogenic growth factors studied. However in the group of endometrial cancer specimens FGF2 mRNA levels were found to be positively correlated with EGF and IGF-1 transcript levels (P = 0.024 and P = 0.006, respectively)

G. Soufla et al. / Cancer Letters 259 (2008) 146–155

151

Table 3 Spearman correlation q and P values

mRNA expression in endometrium

FGF2

Fig. 2. EGF, IGF-1 and FGF2 transcript levels’ profile in the groups of malignant endometrium and adjacent normal specimens.

EGF mRNA in endometrial cancer tissues Fig. 3. EGF mRNA levels in endometrial cancer specimens in respect to tumor grade (Grade 1 specimens exhibit marginally higher mRNA levels than Grade 2 tumors, P = 0.055, Mann– Whitney test).

EGF

0.189 0.499

(B) Endometrial cancer specimens FGF2 Spearman’s q 1.000 Sig. 2-tailed IGF-1 Spearman’s q 0.635b Sig. 2-tailed 0.006c EGF Spearman’s q 0.621a Sig. 2-tailed 0.024c

1.000 – 0.178 0.543

1.000 –

(C) Endometrial tissue-pairs FGF2 Spearman’s q Sig. 2-tailed IGF-1 Spearman’s q Sig. 2-tailed EGF Spearman’s q Sig. 2-tailed

1.000 – 0.800b 0.010c

1.000 –

a b

(Table 3A and B). Due to the limited number of atypical endometrial hyperplasia (AEH) cases included in the study (N = 4), the co-expression pattern of the growth factors studied in AEH cases could not be evaluated.

IGF-1

(A) Normal endometrial specimens GF2 Spearman’s q 1.000 Sig. 2-tailed IGF-1 Spearman’s q 0.125 Sig. 2-tailed 0.622 EGF Spearman’s q 0.143 Sig. 2-tailed 0.626

c

1.000 1.000

1.000 0.668b 0.007c 0.333 0.381

Correlation is significant at the 0.05 level (2-tailed). Correlation is significant at the 0.01 level (2-tailed). P values (Sig. 2-tailed) in bold, are statistically significant.

3.3. Endometrial tissue-pair analysis In the present study, adjacent normal endometrial tissue specimens were available for all pathological specimens (cancer or hyperplasia). We therefore considered it more appropriate to compare each pathological sample’s mRNA levels with those of its adjacent normal specimen. Consequently, we calculated the ratio of the transcript levels of each gene to GAPDH in the tumor sample to that of the adjacent normal tissue, for example ((EGF/ GAPDH) tumor/(EGF/GAPDH) normal). This ratio was used to provide a distinct molecular portrait of each tumor that was subsequently compared with clinicopathological features. A twofold increased or decreased expression ratio was considered to reflect overexpression or down-regulation of the gene of interest. Transcript levels of EGF were found to be significantly elevated in 33% of endometrial cancer cases while EGF down-regulation was observed in 56% of cancer cases. Interestingly, EGF down-regulation is significantly more frequent in endometrial cancer than up-regulation (P = 0.001, odds ratio (OR) = 0.39, CI = 0.21–0.71). IGF-1 exhibited mRNA overexpression as well as downregulation in 39% and 56% of cancer cases correspondingly. This difference was also statistically significant (P = 0.016, odds ratio (OR) = 0.50, CI = 0.27–0.92). FGF2 expression was found to be up-regulated in 75% of cancer cases, and down-regulated in 25% of the cancer specimens compared to controls. In the latter case FGF2

G. Soufla et al. / Cancer Letters 259 (2008) 146–155

overexpression is significantly more frequent in endometrial cancer than reduced expression (P < 104, odds ratio (OR) = 3, CI = 1.71–5.29) (Table 4A). Concerning the few cases of atypical endometrial hyperplasia that we examined we observed EGF overexpression in 3/4 cases (75%) and down-regulation in 1/4 case (25%). IGF-1 up-regulation was demonstrated in 1/ 4 cases (25%) and down-regulation in 1/4 case (25%). Finally, FGF2 mRNA was found to be overexpressed in 2/4 cases (50%) and down-regulated in 1/4 cases (25%). Although the number of hyperplasia cases is small, when we compared the frequency of overexpression or downregulation observed for each growth factor, between the groups of endometrial cancer and AEH, significant differences were demonstrated. Table 4B summarizes our results. Specifically EGF down-regulation was more common in endometrial cancer while up-regulation was significantly more common in the hyperplasia cases. Our results were the same regarding IGF-1 expression, while FGF2 mRNA overexpression was significantly more common in endometrial cancer than hyperplasia cases. Following this analysis, we correlated the tissue-pairs’ expression ratio for each growth factor included in our study with clinicopathological parameters. According to our findings, EGF transcript levels in endometrial cancer tissue-pairs of endometrioid type were found to be higher than in non-endometrioid tumors, this difference however was borderline non-significant (P = 0.050, Mann–Whitney test) (Fig. 4). Spearman correlations for evaluation of EGF, IGF-1 and FGF2 co-expression patterns in endometrial tissuepairs revealed significant positive correlations between IGF-1 and FGF2 (P = 0.007), as well as IGF-1 and EGF (P = 0.010) (Table 3C).

4. Discussion Angiogenesis has been shown to play a major role in endometrial cancer development. Among the growth factors implicated in neovascularization, EGF, FGF2 and IGF have been recognized as

EGF mRNA in tissues-pairs

152

Tumor Histological type Fig. 4. EGF mRNA levels in endometrial tissue-pairs (ratio of EGF transcript levels in cancer versus normal specimens from the same patient) are marginally higher in endometrioid than nonendometrioid tumors (P = 0.050, Mann–Whitney test).

important mitogens, which promote endothelial cell proliferation and differentiation [18]. In the present study, we evaluated the combined mRNA expression of EGF, FGF2 and IGF-1 in cancer, hyperplasia and adjacent normal endometrial tissues. The mRNA expression levels obtained were associated with clinicopathological features followed by pairwise co-expression analysis. This is the first time according to our knowledge that mRNA expression profiles and co-expression patterns have been evaluated in endometrial pathological samples (hyperplasia or cancer) and compared to normal tissue specimens of the same patients, reflecting each tumors’ molecular portrait (endometrial tissue-pair analysis). So far the transcript levels of the genes studied were assessed and compared to the mean value of the mRNA levels

Table 4 Relative mRNA expression of mitogenic growth factors

", over-expression; -, normal expression; #, reduced expression, *v2 test, (df = 2).

G. Soufla et al. / Cancer Letters 259 (2008) 146–155

of normal pre- and post-menopausal endometrium derived from a different set of patients. Following this approach we compared the mean values of the growth factor transcript levels with the mean values of the group of normal specimens (regarded as a whole) from our patients. In this case we observed no differences in EGF, IGF-1 or FGF2 transcript levels between normal and pathological samples. This finding however cannot lead to the assumption that the growth factors studied are not implicated in endometrial carcinogenesis because this approach does not take into account the molecular characteristics of each patient’s specimen. The latter could explain the discrepancies in other investigators’ findings regarding mRNA levels of EGF, IGF-1 or FGF2 in comparison to normal endometrial tissues. For example the expression of the IGF system, even though it has been evaluated only in a limited number of studies, is reported to be either overexpressed or down-regulated in endometrial cancer compared to normal endometrium [9–11]. EGF as well as its receptor (EGFR) expression has been investigated in normal human endometrium and its presence has been verified [19–22]. The expression of the EGF system in endometrial cancer has mainly been investigated by immunohistochemistry on archive material [23–28]. There are only two evaluations of EGF mRNA in endometrial cancer [29,30] and a study of EGF transcript levels in endometrial cancer cell lines [31] that report the absence of differences in EGF transcript levels between normal and pathological samples, which is consistent with our findings. Our finding that EGF mRNA levels in endometrial tissue-pairs are higher in endometrioid than non-endometrioid tumors suggest that these tumors may comprise different entities with distinct molecular characteristics, thus EGF transcription differs in these systems. The elevated EGF transcript levels observed in Grade 1 tumors compared to Grade 2 endometrial tumors reinforces the hypothesis that the EGF system potentially plays a role in the malignant transformation of the endometrium. According to our endometrial tissue-pair analysis, EGF mRNA is overexpressed in 33% and down-regulated in 56% of the endometrial tissue-pairs. The latter indicated that down-regulation is more frequent in endometrial cancer specimens; however reduced EGF expression cannot be blamed entirely for abnormal endometrial growth and differentiation. Therefore the role of the EGF system in endometrial cancer development is complicated and not yet clear.

153

Previous studies stressed a role for the IGF-1 system (IGF-1, IGFR-1, IGF binding proteins) in endometrial carcinogenesis [32,33]. Furthermore, evidence has been provided that the expression of IGF-1 positively correlated with tumor grade [34]. These findings are also supported by the active involvement of IGF-1 in the genesis of other gynecological malignancies [35,36]. Maiorano et al. showed that IGF-1 mRNA expression in endometrial carcinomas is significantly reduced when compared with proliferative endometria which were considered as normal controls [37]. Post-menopausal normal endometrial specimens however had also low IGF-1 mRNA levels that were comparable to the levels of the cancer specimens. This is in agreement with our evaluation where all patients (apart from one who was excluded from this analysis) were post-menopausal and no statistical differences were observed between normal and malignant endometrial specimens. Based on our endometrial tissue-pair evaluation, our results show IGF-1 mRNA up-regulation in 39% and reduced expression in 56% of endometrial cancer specimens. Again IGF-1 down-regulation is observed more frequently than up-regulation confirming partly Maiorano’s results. Nevertheless, IGF-1 overexpression seems to be an almost equally important event in endometrial cancer specimens, supporting the complex role of the IGF-1 system in angiogenesis of the malignant endometrium. FGF2 has been proposed to comprise an indicator for advancement of endometrial cancers [38,39]. Our endometrial tissue-pair analysis exhibits FGF2 mRNA overexpression in 75%, and down-regulation in 25% of cancer specimens, respectively, suggesting that high levels of FGF2 potentially play a role in endometrial carcinogenesis. Although the number of endometrial hyperplasia cases and adjacent normal specimens that we examined is very small (4 cases), our evaluation provides indications that AEH and cancer cases could possibly comprise distinct entities. The main features of endometrial cancer were IGF-1 and EGF down-regulation and FGF2 up-regulation, whereas hyperplasia cases were mostly characterized by IGF-1 normal expression and EGF and FGF2 up-regulation. Further investigation is needed and in a larger set of specimens in order to reveal whether and how EGF, IGF-1 and FGF2 are implicated in the molecular pathways involved in the development of the hyperplastic endometrium.

154

G. Soufla et al. / Cancer Letters 259 (2008) 146–155

The most interesting finding of our evaluation is the disruption of the mRNA co-expression profile of the angiogenic factors studied in the group of endometrial tumor specimens compared to the group of adjacent normal specimens. No correlations were observed between EGF, IGF-1 and FGF transcript levels in normal endometrium, while FGF2 mRNA was significantly correlated with EGF and IGF-1 in the malignant endometrium. This leads us to the assumption that the deregulation of the mRNA expression profile of the mitogenic growth factors included in our study may be the actual mediator of the tumorigenic process in the endometrium. Furthermore, the co-expression pattern provided by our endometrial tissue analysis indicates significant positive correlations between IGF-1 and FGF2, as well as IGF-1 and EGF. This finding supports the hypothesis of a cross-talk between IGF- and EGF-mediated signaling pathways in endometrial cancer. Conclusively, our evaluation provides indirect evidence that EGF, IGF-1 and FGF2 potentially act synergistically in the tumorigenic process of the endometrium. References [1] O. Abulafia, W.E. Triest, D.M. Sherer, Angiogenesis in malignancies of the female genital tract, Gynecol. Oncol. 72 (2) (1999) 220–231. [2] J. Folkman, Angiogenesis, J. Biol. Chem. 267 (1992) 10931– 10934. [3] H.B. Salvesen, O.E. Iversen, L.A. Akslen, Independent prognostic importance of microvessel density in endometrial carcinoma, Br. J. Cancer 77 (1998) 1140–1144. [4] C.V. Kirschner, J.M. Alanis-Amezcua, V.G. Martin, et al., Angiogenesis factor in endometrial carcinoma: a new prognostic indicator?, Am J. Obstet. Gynecol. 174 (1996) 1879– 1882. [5] L.I. Gold, B. Saxena, K.R. Mittal, et al., Increased expression of transforming growth factor beta isoforms and basic fibroblast growth factor in complex hyperplasia and adenocarcinoma of the endometrium: evidence for paracrine and autocrine action, Cancer Res. 1 54 (9) (1994) 2347–2358. [6] D. Pfeiffer, J. Spranger, M. Al Deiri, et al., mRNA expression of Ligands of the epidermal-growth-factor receptor in the uterus, Int. J. Cancer 72 (1997) 581–586. [7] E.M. Rutanen, Insulin like growth factors in endometrial function, Gynecol. Endocrinol. 12 (1998) 399–406. [8] E.M. Rutanen, Insulin-like growth factors and insulin-like growth factor binding proteins in the endometrium. Effect of intrauterine levonorgestrel delivery, Hum. Reprod. 15 (2000) 173–181. [9] R. Druckmann, U.D. Rohr, IGF-1 in gynaecology and obstetrics: update 2002, Maturitas 41 (2002) S65– S83.

[10] S. Hirano, N. Ito, S. Takahashi, T. Tamaya, Clinical implications of insulin-like growth factors through the presence of their binding proteins and receptors expressed in gynecological cancers, Eur. J. Gynaecol. Oncol. 25 (2) (2004) 187–191. [11] L.W. Giudice, J.C. Irwin, B.A. Dsupin, et al., Insulin-like growth factor (IGF), IGF binding protein (IGFBP), and IGF receptor gene expression and IGFBP synthesis in human uterine leiomyomata, Hum. Reprod. 8 (11) (1994) 1796–1806. [12] S. Javerzat, S. Auguste, A. Bikfalvi, The role of fibroblast growth factors in vascular development, Trends Mol. Med. 8 (2002) 483–489. [13] N. Soulitzis, I. Karyotis, D. Delakas, D.A. Spandidos, Expression analysis of peptide growth factors VEGF, FGF2, TGFB1, EGF and IGF1 in prostate cancer and benign prostatic hyperplasia, Int. J. Oncol. 29 (2) (2006) 305–314. [14] J.A. Doll et al., Thrombospondin-1, vascular endothelial growth factor and fibroblast growth factor-2 are key functional regulators of angiogenesis in the prostate, Prostate 49 (2001) 293–305. [15] O. Straume, L.A. Akslen, Importance of vascular phenotype by basic fibroblast growth factor, and influence of the angiogenic factors basic fibroblast growth factor/fibroblast growth factor receptor-1 and EphA1/EphA2 on melanoma progression, Am. J. Pathol. 160 (2002) 1009–1019. [16] A. Compagni et al., Fibroblast growth factors are required for efficient tumor angiogenesis, Cancer Res. 60 (2000) 7163–7169. [17] G. Soufla, S. Sifakis, S. Baritaki, A. Zafiropoulos, E. Koumantakis, D.A. Spandidos, VEGF, FGF2, TGFB1 and TGFBR1 mRNA expression levels correlate with the malignant transformation of the uterine cervix, Cancer Lett. 221 (2001) 105–118. [18] P. Carmeliet, J. Rakesh, Angiogenesis in cancer and other diseases, Nature 407 (2000) 249–257. [19] T. Imai, H. Kurachi, K. Adachi, et al., Changes in epidermal growth factor receptor and the levels of its ligands during menstrual cycle in human endometrium, Biol. Reprod. 52 (1995) 928–938. [20] J.H. McBean, J.R. Brumsted, W.S. Stirewalt, In vitro estrogen regulation of epidermal growth factor receptor in human endometrium, J. Clin. Endocrinol. Metabol. 82 (1997) 1467–1471. [21] H. Niikura, H. Sasano, K. Kaga, et al., Expression of epidermal growth factor family proteins and epidermal growth factor receptor in human endometrium, Hum. Pathol. 27 (1996) 282–289. [22] B. Moller, C. Rasmussen, M. Olovsson, Expression of the angiogenic growth factors VEGF, FGF-2, EGF and their receptors in normal human endometrium during the menstrual cycle, Mol. Hum. Reprod. 7 (2001) 65–72. [23] A. Berchuck, G. Rodriguez, R.B. Kinney, et al., Overexpression of HER-2/neu in endometrial cancer is associated with advanced stage disease, Am. J. Obstet. Gynecol. 164 (1991) 15–21. [24] M.A. Khalifa, R.S. Mannel, S.D. Haraway, J. Walker, K.W. Min, Expression of EGFR, HER-2/neu, P53, and PCNA in endometrioid, serous papillary, and clear cell endometrial adenocarcinomas, Gynecol. Oncol. 53 (1994) 84–92. [25] A. Mariani, T.J. Sebo, J.A. Katzmann, D.L. Riehle, S.C. Dowdy, G.L. Keeney, et al., HER-2/neu overexpression and hormone dependency in endometrial cancer: analysis of

G. Soufla et al. / Cancer Letters 259 (2008) 146–155

[26]

[27]

[28]

[29]

[30]

[31]

[32]

cohort and review of literature, Anticancer Res. 25 (2005) 2921–2927. C.D. Rolitsky, K.S. Theil, V.R. McGaughy, L.J. Copeland, T.H. Niemann, HER- 2/neu amplification and overexpression in endometrial carcinoma, Int. J. Gynecol. Pathol. 18 (1999) 138–143. J. Backe, A.M. Gassel, S. Krebs, T. Muller, H. Caffier, Immunohistochemically detected HER-2/neu-expression and prognosis in endometrial carcinoma, Arch. Gynecol. Obstet. 259 (1997) 189–195. J.J. Reinartz, E. George, B.R. Lindgren, G.A. Niehans, Expression of p53, transforming growth factor alpha, epidermal growth factor receptor, and cerbB-2 in endometrial carcinoma and correlation with survival and known predictors of survival, Hum. Pathol. 25 (1994) 1075–1083. D. Pfeiffer, J. Spranger, M. Al Deiri, R. Kimmig, A. FisselerEckhoff, P. Scheidel, et al., mRNA expression of ligands of the epidermal-growth factor-receptor in the uterus, Int. J. Cancer 72 (1997) 581–586. K. EjskJaer, B.S. Sorensen, S.S. Poulsen, et al., Expression of the epidermal growth factor system in endometrioid endometrial cancer, Gynecol. Oncol. 104 (2007) 158–167. R.K. Reynolds, H. Changzhi, V. Backer, Transforming growth factor-a and insulin like growth factor-I, but not epidermal growth factor, elicit autocrine stimulation of mitogenesis in endometrial cancer cell lines, Gynecol. Oncol. 70 (1998) 202–209. E.M. Rutanen, T. Nyman, P. Lehtovirta, et al., Suppressed expression of insulin like growth factor binding protein 1

[33]

[34]

[35]

[36]

[37]

[38]

[39]

155

mRNA in the endometrium: a molecular mechanism associating endometrial cancer with its risk factors, Int. J. Cancer 59 (1994) 307–312. R.K. Reynolds, C.A. Owens, J.A. Roberts, et al., Cultured endometrial cells exhibit autocrine growth factor stimulation that is not observed in cultured normal endometrial cells, Gynecol. Oncol. 60 (1996) 380–386. F. Talavera, R.K. Reynolds, J.A. Roberts, et al., Insulinlike growth factor-I receptors in normal and neoplastic human endometrium, Hum. Reprod. Update 9 (1994) 936–946. D. Yee, S. Paik, G.S. Lebovic, et al., Analysis of insulin like growth factor-I gene expression in malignancy: evidence for a paracrine role in human breast cancer, Mol. Endocrinol. 3 (1989) 509–517. D. Yee, F.R. Morales, T.C. Hamilton, et al., Expression of insulin like growth factor-1, its binding proteins and its receptor in ovarian cancer, Cancer Res. 51 (1991) 5107–5112. E. Maiorano, G. Loverro, G. Viale, et al., Insulin-like growth factor-I expression in normal and diseased endometrium, Int. J. Cancer 80 (1999) 188–193. J. Fujimoto, M. Hori, S. Ichigo, et al., Expression of basic fibroblast growth factor and its mRNA in uterine endometrial cancers, Invasion Metastasis 15 (1995) 203–210. J. Fujimoto, M. Hori, S. Ichigo, et al., Expression of the fibroblast growth factor family (FGF-1, -2 and -4) mRNA in endometrial cancers, Tumour Biol. 17 (1996) 226–233.