- Email: [email protected]
Fibrillation potentials of denervated rat skeletal muscle are associated with expression of cardiac-type voltage-gated sodium channel isoform Nav1.5
Clinical Neurophysiology 123 (2012) 1650–1655
Contents lists available at SciVerse ScienceDirect
Clinical Neurophysiology journal homepage: www.elsevier.com/locate/clinph
Fibrillation potentials of denervated rat skeletal muscle are associated with expression of cardiac-type voltage-gated sodium channel isoform Nav1.5 Kenji Sekiguchi a,⇑, Fumio Kanda a, Shigeru Mitsui a, Nobuo Kohara b, Kazuo Chihara a a b
Department of Neurology, Kobe University Graduate School of Medicine, Kobe City, Japan Department of Neurology, Kobe City General Hospital, Kobe City, Japan
a r t i c l e
i n f o
Article history: Accepted 3 January 2012 Available online 14 February 2012 Keywords: Fibrillation potential Denervation Electromyography Sodium channel Nav1.5
h i g h l i g h t s Novel expression of cardiac type sodium channel Nav1.5 participates in the generation of fibrillation potentials in denervated rat skeletal muscle. Nav1.5 block by lidocaine suppressed fibrillation potentials without changing the amplitude of compound muscle action potential (CMAP) in innervated muscle. Changes after denervation that occur in ion channels including Nav1.5 contribute to fibrillation potentials.
a b s t r a c t Objective: The molecular mechanisms underlying fibrillation potentials are still unclear. We hypothesised that expression of the cardiac-type voltage-gated sodium channel isoform Nav1.5 in denervated rat skeletal muscle is associated with the generation of such potentials. Methods: Muscle samples were extracted and analysed biologically from surgically denervated rat extensor digitorum longus muscle after concentric needle electromyographic recording at various time points after denervation (4 h to 6 days). Results: Both nav1.5 messenger RNA (mRNA) signal on northern blotting and Nav1.5 protein expression on immunohistochemistry appeared on the second day after denervation, exactly when fibrillation potentials appeared. Administration of lidocaine, which has much stronger affinity for sodium channels in cardiac muscle than for those in skeletal muscle, dramatically decreased fibrillation potentials, but had no effect on contralateral compound muscle action potentials. Conclusions: Expression of Nav1.5 participates in the generation of fibrillation potentials in denervated rat skeletal muscle. Significance: We proposed an altered expression of voltage-gated sodium channel isoforms as a novel mechanism to explain the occurrence of fibrillation potentials following skeletal muscle denervation. Ó 2012 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.
1. Introduction Fibrillation potentials are hallmarks of pathological change in electromyographic (EMG) studies in the diagnosis of neuromuscular disorders. Fibrillation potentials have been hypothesised to
Abbreviations: cDNA, complementary deoxyribonucleic acid; CMAP, compound muscle action potential; EDL, extensor digitorum longus; mRNA, messenger ribonucleic acid; EMG, electromyography; FITC, fluorescein isothiocyanate; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; RT-PCR, reverse transcriptase-polymerase chain reaction; SDS, sodium dodecyl sulphate; TTX, tetrodotoxin. ⇑ Corresponding author. Address: Department of Neurology, Kobe University Graduate School of Medicine, 7-5-2 Kusunoki-cho, Chuo-ku, Kobe City, Hyogo 650-0017, Japan. Tel.: +81 078 382 5885; fax: +81 078 382 5899. E-mail address: [email protected] (K. Sekiguchi).
arise from denervation acetylcholine hypersensitivity in response to small quantities of circulating acetylcholine (Denny-Brown and Pennybacker, 1938; Thesleff, 1982). However, denervation hypersensitivity appears along the entire length of denervated fibres, whereas fibrillation potentials originate only from the former endplate zone. In addition, infusion of large quantities of d-tubocurarine failed to abolish such discharges (Muchnik et al., 1973; Brumback et al., 1978; Kimura, 2001). Thus, these findings indicate that the underlying mechanisms of fibrillation cannot be accounted for by this hypothesis alone. It has been found that sodium channels play an important role in generation of fibrillation potentials, as fibrillation potentials were abolished by sodium-free solution (Purves and Sakmann, 1974). Localised sodium conductance change in denervated muscle cell membrane participates in the generation of fibrillation potentials
1388-2457/$36.00 Ó 2012 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.clinph.2012.01.002
K. Sekiguchi et al. / Clinical Neurophysiology 123 (2012) 1650–1655
(Thesleff, 1982; Kimura, 2001). Following denervation, mammalian skeletal muscle undergoes dramatic changes in conductance, including the new appearance of tetrodotoxin (TTX)-resistant sodium current (Pappone, 1980). Expression of the ‘cardiac type’ of sodium channel in denervated skeletal muscle has been reported to contribute to TTX-resistant sodium current (Rogart et al., 1989; Lupa et al., 1995). Mammalian sodium channels are heterotrimers, composed of a central, pore-forming alpha subunit and two auxiliary beta subunits. The alpha subunits form a gene family with 10 members including cardiac specific isoform Nav1.5 (Catterall et al., 2005). There have, however, been no reports of the relationship between the generation of fibrillation potentials and expression of Nav1.5 in denervated skeletal muscle. The goal of this study was to clarify the association between fibrillation potentials and the cardiac sodium channel isoform by evaluating temporal changes in both the electromyogram and sodium channel expression in an animal model of denervation. 2. Materials and methods The experimental protocol was approved by the Institutional Animal Care and Use Committee of Kobe University (Permission number: P-030702) and carried out according to the Kobe University Animal Experimentation Regulations. Totally over 24 animals (three animals per time point) were studied to ensure reproducibility of the experiment. 2.1. Denervation Adult (250–300 g body weight) female Wistar rats were anaesthetised with intra-peritoneal injection of sodium pentobarbital (50 mg kg–1). The right hindlimb was denervated by removal of a section of the sciatic nerve (5 mm) at the mid-thigh level. The incision was sutured with 3/0 silk braid. 2.2. Electromyography Under sodium pentobarbital anesthesia, a concentric needle electrode (Neuroline 740 concentric, 30 gauge, Ballerup, Denmark) was placed in the mid-point along the length of the right extensor digitorum longus (EDL) muscle at various time points after denervation surgery. The evaluation time points were determined more short-term (4 h, 8 h, 16 h, 1 day, 2 days, 3 days and 6 days) than previous chronic denervated state research (6–14 days), because fibrillation potentials appear about 3 days after surgery in the rat model (Arancio et al., 1989). Electromyographic (EMG) signals were amplified using a Neuropack 8 (Nihon Kohden, Tokyo, Japan) with a band pass of 10 Hz–10 kHz and captured for 0.01 ms. To avoid effects of hyperactivity associated with needle insertion, the recordings were started after the amount of spontaneous discharge had reached steady state. All data were digitised with a sampling frequency of 44.1 kHz and stored as wav format files in a Windows PC. The total number of fibrillation potential discharges in a 10-min recording was counted with signal analysis software (Spike 2, Cambridge Electronic Design, UK). Three animals were studied for every time point. The identical animal was never used sequentially to exclude effects of needle injury. 2.3. Tissue preparation Animals were humanely sacrificed by deep pentobarbital anesthesia and decapitation after electromyographic recording. Immediately after section of the denervated EDL muscle, tissue samples were frozen in liquid nitrogen.
1651
2.4. Northern blotting analysis For production of a nav1.5-specific probe, oligonucleotide primers were designed based on the published rat nav1.5 complementary DNA (cDNA) sequence (GenBank No. M27902: sense 50 agctctctggagatgtctcc 30 ; anti-sense 50 acggtgctgttccttttgcc 30 ). The nav1.5 cDNA fragment was generated by reverse transcriptase polymerase chain reaction (RT-PCR) using RNA isolated from rat heart muscle and the primers. The PCR products were cloned with Escherichia coli (JM109: ToYoBo Co. Ltd., Tokyo, Japan)-transfected plasmid (pGEMÒ-T Easy Vector System I, Promega, USA). The sequence of purified amplified nav1.5 cDNA fragments was confirmed with a sequencing analyser (ABI-7700: Applied Biosystems, USA). Total RNA was isolated from 100 mg of frozen muscle sample using TRIzol reagent (Invitrogen, USA). Then 20-lg RNA samples were denatured and fractionated by electrophoresis in 1.2% agarose/6% formaldehyde gels. Separated RNA was transferred onto nylon membranes (Biodyne A: Pall, Drieich, FRG), and hybridisation was carried out with [32P] random prime-labelled nav1.5-specific probes at 42 °C for 24 h. Blots were washed 4 times with 0.1 SSC/0.1% sodium dodecyl sulphate (SDS) at 65 °C. The membranes were exposed to imaging plates (BAS-SR: Fujifilm, Japan) for 24 h and signals were detected using a BAS-2000 imaging plate reader. Data were analysed and counted with image analysis software (Image Gauge Ver. 4.0, Fujifilm, Japan). 2.5. Immunohistochemistry Staining procedures were performed as described by Haimovich et al. (1987). In brief, tissue sections (6 lm thick) were cut in a cryostat and air-dried for 1 h. Unfixed sections were permeabilised with phosphate-buffered saline (PBS) containing 0.2% Triton X-100 for 20 min and blocking with PBS containing 10% goat serum at room temperature. Sections were then incubated with anti-Nav1.5 antibody (1:20, Alomone Labs, Israel) diluted with the same blocking solution overnight at 4 °C. The specimens from the contralateral EDL innervated muscle and cardiac muscle were also stained as negative control and positive control, respectively. To verify signal specificity, one specimen was incubated with primary antibody preincubated with antipeptide (1:1). The sections were washed with PBS 3 times for 5 min each and incubated with goat fluorescein isothiocyanate (FITC)-labelled anti-rabbit immunoglobulin G (IgG) antibody (1:200, Jackson Immunoresearch, UK) for 1 h at room temperature. After washing thrice, the immunoreactivity of the sections was observed with a laser confocal microscope (LSM5Pascal, Zeiss, Germany). 2.6. Lidocaine injection The cardiac anti-arrhythmic agent lidocaine was used as a relatively specific Nav1.5 blocker. Three animals that were subjected to denervation surgery 6 days before injection were studied. The fibrillation potentials elicited from denervated rat EDL muscles were continuously recorded. About 5 min after needle insertion, the amount of spontaneous firing reached steady state, and 0.1 ml PBS was injected as a control via the tail vein with EMG observation. Five minutes later, lidocaine hydrochloride solution (XylocaineÒ injection 1%, AstraZeneca, Tokyo, Japan; 0.05–0.06 ml: 2 mg kg–1) was injected via the tail vein, and EMG monitoring was continued. Simultaneously, compound muscle action potentials (CMAPs) were recorded from the contralateral EDL muscle using surface electrodes placed on the anterior aspect of the hind limb with supramaximal electric stimulation of the sciatic nerve in the thigh. Stimulus duration was fixed at 0.2 ms. The obtained records of EMG were processed to temporal changes in the value of the root mean square with a time constant
1652
K. Sekiguchi et al. / Clinical Neurophysiology 123 (2012) 1650–1655
of 10 ms with the signal analysis software Spike2 to evaluate the power of fibrillatory activity. 3. Results 3.1. Spontaneous discharges increased gradually after denervation There were no electrical discharges detected during the 24-h period after denervation surgery. Stable firing of spontaneous discharges was first recognised on the second day after denervation. The number of discharges rapidly increased day by day and eventually became stable. On the sixth day after denervation, the EMG monitor was filled with very large numbers of discharges (Fig. 1). The contralateral EDL muscle maintained electrical silence. 3.2. New expression of nav1.5 mRNA noted on the second day after denervation No nav1.5-specific signal was detected in the control EDL muscle. In the denervated muscle, a nav1.5-specific signal was detected at around 7.5 kb on the second day, which increased on the third day, and then decreased on the sixth day after denervation (Fig. 2). 3.3. Nav 1.5 protein detected on denervated muscle membrane and in cytoplasmic regions after denervation Immunohistochemical examination revealed localised signals in the perinuclear sarcoremmal areas of some muscle fibres on the second day. Expression of signal gradually increased with dispersion and on the sixth day signal was detected throughout the fibre membrane and was sparse in the cytoplasmic regions in some fibres. There was no signal from the contralateral EDL innervated muscle. There were abundant signals localised in repeated transversely oriented bands on cardiac muscle on which Nav1.5 is predominantly distributed in T-tubular systems as previously reported (Haimovich et al., 1987). Preincubation with antipeptide for primary antibody completely eliminated the signal (Fig. 3). 3.4. Lidocaine injection decreased the number of fibrillation potentials without changing the amplitudes of CMAP Intravenous injection of lidocaine (2 mg kg–1) immediately decreased spontaneous discharges in denervated muscle. The amplitude of fibrillation potentials decreased initially, followed by reduction of the rate of firing (Fig. 4A). The same suppression of fibrillation potentials was observed in three animals. In contrast, lidocaine injection had no effect on the amplitudes of CMAP evoked by sciatic nerve stimulation in the contralateral innervated EDL muscle (Fig. 4B). These findings indicate that lidocaine injection had no effects on ordinary mechanisms of muscle contraction. 4. Discussion We demonstrated here that Nav1.5 expressions in denervated skeletal muscle contribute to generation of fibrillation potential by the following three findings: (i) fibrillation potentials developed with simultaneous expression of Nav1.5 early after denervation, (ii) novel appearance and persistence of Nav1.5 expression in denervated rat skeletal muscle were confirmed at the protein level and (iii) lidocaine, which had a high affinity for Nav1.5, attenuated fibrillation potentials. The cardiac sodium channel Nav1.5, recently known as one of the causative molecules of genetic arrhythmias such as Brugada syndrome, is not present in matured skeletal muscle (Kapplinger et al., 2010). However, Nav1.5 expresses on early development
Fig. 1. An illustrative raw waveform of EMG of denervated rat EDL muscle recorded by concentric needle insertion under pentobarbital anesthesia. (A) First day, (B) Second day, (C) Third day, (D) Sixth day after denervation. Spontaneous discharges increased day by day. Scale bar indicates 30 ms. Mean changes in number of fibrillation potentials from all examined rats at each time after denervation. (E) Spike counts per 1-s of fibrillation potentials during 10-min recordings are plotted at each time point after denervation. Three animals were studied for each time point.
K. Sekiguchi et al. / Clinical Neurophysiology 123 (2012) 1650–1655
Fig. 2. Northern blot analysis showing expression of nav1.5 mRNA at indicated times after denervation. (A) Expression of nav1.5 mRNA was first noted on the second day, increased on the third day, and decreased on the sixth day after denervation (upper panel). Expression of g3pdh mRNA indicated that approximately equal amounts of RNA had been loaded (lower panel). (B) Quantification of nav1.5 mRNA after denervation. Each bar is the mean of signal intensity of three separate blots.
and denervation in skeletal muscle, responsible for tetrodotoxinresistant sodium current (Rogart et al., 1989; Kallen et al., 1990; Yang et al., 1991; Lupa et al., 1995). In our study, an nav1.5-specific signal was detected on northern blot analysis at the same time as fibrillation potentials appeared. While the nav1.5 mRNA signal decreased on the sixth day after
1653
denervation, expression of the Nav1.5 protein continued to increase, as determined immunohistochemically. Although the half-life of the Nav1.5 protein has not been known, this finding suggests that the Nav1.5 protein is relatively stable. The time-series pattern of expression of nav1.5 mRNA described in previous reports appeared to be biphasic, similar to our results (Yang et al., 1991; Lupa et al., 1995). We first demonstrated here the expression of Nav1.5 proteins in denervated rat muscle immunohistochemically. The neuromuscular junctional pattern of immunoreactivity early after denervation was similar to Nav1.4 in innervated skeletal muscle and nav1.5 mRNA expression in denervated skeletal muscle (Caldwell and Milton, 1988; Awad et al., 2001). The cytoplasmic pattern on 6 days after denervation was similar to Nav1.4 expression in innervated muscle, suggesting expression in membranes of the T-tubular system (Haimovich et al., 1987). The expression pattern detected throughout the fibre membrane was also similar to Nav1.5 expression in cultured adult rat skeletal muscle fibres recently reported (Morel et al., 2010). Several in vitro studies have shown that lidocaine has much greater affinity for the sodium channels in cardiac muscle than for those in skeletal muscle (Makielski et al., 1999; Nuss et al., 2000; Li et al., 2002). We used 2 mg kg–1 of lidocaine (standard dose for arrhythmia in rats) in order to block Nav1.5, because no Nav1.5 specific blocker exists (Rousseau-Migneron et al., 1990). Dramatic fibrillation decrease without any effect on CMAP implied that lidocaine worked in this experiment as a relatively selective Nav1.5 blockade. We noticed that amplitude tended to decrease prior to the reduction of firing rate in raw EMG waves during administration of lidocaine. This finding suggests that decrement of inward sodium current via Nav1.5 sodium channel blockade first decreases the amplitude of potentials and thereby decreases the probability of reaching the threshold of depolarisation. Nav1.5 may contribute to generation of fibrillation through several mechanisms. Nav1.5 is a candidate for novel, fast recovery of sodium channels from inactivation state in denervated muscles as expected before (Kirsch and Anderson, 1986). Reduction of the refractory period due to fast recovery from inactivation state induces hyperexcitability. In addition, denervation-induced depolarisation closes the membrane potential to its threshold increasing the probability of random firing (Thesleff, 1982; Kirsch and
Fig. 3. Confocal microscopic immunohistochemistry of Nav1.5 protein in cross-sections of denervated EDL muscle at indicated times after denervation. (A) First day, (B) Second day, (C) Third day, (D) Sixth day. The specimens were immunolabelled with FITC-conjugated anti-rabbit IgG antibody after treatment with anti-Nav1.5 antibody. Localized membrane signals appeared after denervation surgery on the second day (B) and increased on the third day (C) and sixth day (D). Immunoreactivity was not detected when antibody was preincubated with antigenic peptide (E). Antibody did not react to innervated contralateral control EDL muscle specimen (F), but did react to rat cardiac muscle which contained abundant Nav1.5 protein (G). All images are 400 magnification.
1654
K. Sekiguchi et al. / Clinical Neurophysiology 123 (2012) 1650–1655
Fig. 4. Effects of lidocaine injection on electrophysiological findings. (A): Changes in root mean square (RMS) values of fibrillation potentials with a time constant of 10 ms in denervated EDL muscle. The RMS value, which reflects total electrical activity of muscle, decreased immediately after injection of 2 mg/kg lidocaine. The raw waves in the illustrated case indicated that the amplitude decreased prior to the decrease in firing rate (injection at arrowhead). (B): CMAP of contralateral innervated EDL muscle elicited by stimulation of sciatic nerve. CMAP amplitude did not change before to after lidocaine injection.
Anderson, 1986). After hyperpolarisation, which is required for regular recurrent firing, newly emerged in action potential in denervated muscle, probably by persistent sodium current (Thesleff and Ward, 1975; Gege et al., 1989; Kotsias and Venosa, 2001). Nav1.5 expression may contribute to generation of after hyperpolarisation by decreasing the total amount of inward-going sodium current (Wang et al., 1996; Kotsias and Venosa, 2001). A recent study showed that another TTX-resistant sodium channel Nav1.8 ectopically expressed on the motor axon in myelin protein zero mutant mice contributed to deterioration of nerve excitability (Moldovan et al., 2011). The altered expression of voltage-gated sodium channel may emerge as a general feature of response to injury in muscle and nerve as a reverting-back phenomenon (Yoshida, 1994). Alteration of other ion channels after denervation has also been reported (Klocke et al., 1994; Shin et al., 1997; Pribnow et al., 1999; Jacobson et al., 2002). The changes that occurred in various ion channels contribute to generation of fibrillation potentials, and sodium channels must be included among them. To reconsider the association between molecular and electrophysiological basis underlying muscle denervation may give an important insight to neuromuscular research, especially regenerative therapeutic strategy. Acknowledgement We would like to thank Dr. Hisatomo Kowa for advice in the preparation of the manuscript.
References Arancio O, Cangiano A, De Grandis D. Fibrillatory activity and other membrane changes in partially denervated muscles. Muscle Nerve 1989;12:149–53. Awad SS, Lightowlers RN, Young C, Chrzanowska-Lightowlers ZM, Lømo T, Slater CR. Sodium channel mRNAs at the neuromuscular junction: distinct patterns of accumulation and effects of muscle activity. J Neurosci 2001;21:8456–63. Brumback RA, Bertorini TE, Engel WK, Trotter JL, Oliver KL, Zirzow GC. The effect of pharmacologic acetylcholine receptor on fibrillation and myotonia in rat skeletal muscle. Arch Neurol 1978;35:8–10. Caldwell JH, Milton RL. Sodium channel distribution in normal and denervated rodent and snake skeletal muscle. J Physiol 1988;401:145–61. Catterall WA, Goldin AL, Waxman SG. International Union of Pharmacology. XLVII. Nomenclature and structure-function relationships of voltage-gated sodium channels. Pharmacol Rev 2005;57:397–409. Denny-Brown D, Pennybacker JB. Fibrillation and fasciculation in voluntary muscle. Brain 1938;61:311–32. Gege PW, Lamb GD, Wakefield BT. Transient and persistent sodium currents in normal and denervated mammalian skeletal muscle. J Physiol 1989;418:427–39. Haimovich B, Schotland DL, Fieles WE, Barchi RL. Localization of sodium channel subtypes in adult rat skeletal muscle using channel-specific monoclonal antibodies. J Neurosci 1987;7:2957–66. Jacobson D, Herson PS, Neelands TR, Maylie J, Adelman JP. SK channels are necessary but not sufficient for denervation-induced hyperexcitability. Muscle Nerve 2002;26:817–22. Kallen RG, Sheng ZH, Yang J, Chen L, Rogart RB, Barchi RL. Primary structure and expression of a sodium channel characteristic of denervated and immature rat skeletal muscle. Neuron 1990;4:233–42. Kapplinger JD, Tester DJ, Alders M, Benito B, Berthet M, Brugada J, et al. An international compendium of mutations in the SCN5A-encoded cardiac sodium channel in patients referred for Brugada syndrome genetic testing. Heart Rhythm 2010;7:33–46. Kimura J. Electrodiagnosis in diseases of nerve and muscle. 3rd ed. Oxford: Oxford University Press; 2001. p. 346–350.
K. Sekiguchi et al. / Clinical Neurophysiology 123 (2012) 1650–1655 Kirsch GE, Anderson MF. Sodium channel kinetics in normal and denervated rabbit muscle membrane. Muscle Nerve 1986;9:738–47. Klocke R, Steinmeyer K, Jentsch TJ, Jockusch H. Role of innervation, excitability, and myogenic factors in the expression of the muscular chloride channel ClC-1. A study on normal and myotonic muscle. J Biol Chem 1994;269:27635–9. Kotsias BA, Venosa RA. Sodium influx during action potential in innervated and denervated rat skeletal muscles. Muscle Nerve 2001;24:1026–33. Li RA, Ennis IL, Tomaselli GF, Marban E. Structural basis of differences in isoformspecific gating and lidocaine block between cardiac and skeletal muscle sodium channels. Mol Pharmacol 2002;61:136–41. Lupa MT, Krzemien DM, Schaller KL, Caldwell JH. Expression and distribution of sodium channels in short- and long-term denervated rodent skeletal muscles. J Physiol 1995;483:109–18. Makielski JC, Limberis J, Fan Z, Kyle JW. Intrinsic lidocaine affinity for Na channels expressed in Xenopus oocytes depends on alpha (hH1 vs. rSKM1) and beta 1 subunits. Cardiovasc Res 1999;42:503–9. Morel J, Rannou F, Talarmin H, Giroux-Metges MA, Pennec JP, Dorange G, et al. Sodium channel NaV1.5 expression is enhanced in cultured adult rat skeletal muscle fibers. J Membr Biol 2010;235:109–19. Moldovan M, Alvarez S, Pinchenko V, Klein D, Nielsen FC, Wood JN, et al. Nav1.8 channelopathy in mutant mice deficient for myelin protein zero is detrimental to motor axons. Brain 2011;134:585–601. Muchnik S, Ruarte AC, Kotsias BA. On the mechanism of denervatory electrical activity of single muscle fibers as tested in vivo with tetrodotoxin. Acta Physiol Lat Am 1973;23:24–8. Nuss HB, Kambouris NG, Marban E, Tomaselli GF, Balser JR. Isoform-specific lidocaine block of sodium channel explained by differences in gating. Biophys J 2000;78:200–10.
1655
Pappone PA. Voltage clamp experiments in normal and denervated mammalian skeletal muscle fibres. J Physiol 1980;306:377–410. Pribnow D, Johnson-Pais T, Bond CT, Keen J, Jhonson RA, Janowsky A, et al. Skeletal muscle and small-conductance calcium-activated potassium channels. Muscle Nerve 1999;22:742–50. Purves D, Sakmann B. Membrane properties underlying spontaneous activity of denervated muscle fibres. J Physiol 1974;239:125–53. Rogart RB, Cribbs LL, Muglia LK, Kephart DD, Kaiser MW. Molecular cloning of a putative tetrodotoxin-resistant rat heart Na+ channel isoform. Proc Natl Acad Sci 1989;86:8170–4. Rousseau-Migneron S, Tancrede G, Nadeau A. Lidocaine improves survival rate in diabetic rats submitted to acute left coronary artery ligation. Basic Res Cardiol 1990;85:404–10. Shin KS, Park JY, Kwon H, Chung CH, Kang MS. Opposite effect of intracellular Ca2+ and protein kinase C on the expression of inwardly rectifying K+ channel 1 in mouse skeletal muscle. J Biol Chem 1997;272:21227–32. Thesleff S, Ward MR. Studies on the mechanism of fibrillation potentials in denervated muscle. J Physiol 1975;244:313–23. Thesleff S. Fibrillation in denervated mammalian skeletal muscle. In: Culp WJ, Ochea S, editors. Abnormal nerves and muscles as impulse generators. New York: Oxford University Press; 1982. p. 678–94. Wang DW, George AL, Bennett PB. Comparison of heterologously expressed human cardiac and skeletal muscle sodium channels. Biophys J 1996;70:238–45. Yang JS, Sladky JT, Kallen RG, Barchi RL. TTX-sensitive and TTX-insensitive sodium channel mRNA transcripts are independently regulated in adult skeletal muscle after denervation. Neuron 1991;7:421–7. Yoshida S. Tetrodotoxin-resistant sodium channels. Cell Mol Neurobiol 1994;14:227–44.
Contents lists available at SciVerse ScienceDirect
Clinical Neurophysiology journal homepage: www.elsevier.com/locate/clinph
Fibrillation potentials of denervated rat skeletal muscle are associated with expression of cardiac-type voltage-gated sodium channel isoform Nav1.5 Kenji Sekiguchi a,⇑, Fumio Kanda a, Shigeru Mitsui a, Nobuo Kohara b, Kazuo Chihara a a b
Department of Neurology, Kobe University Graduate School of Medicine, Kobe City, Japan Department of Neurology, Kobe City General Hospital, Kobe City, Japan
a r t i c l e
i n f o
Article history: Accepted 3 January 2012 Available online 14 February 2012 Keywords: Fibrillation potential Denervation Electromyography Sodium channel Nav1.5
h i g h l i g h t s Novel expression of cardiac type sodium channel Nav1.5 participates in the generation of fibrillation potentials in denervated rat skeletal muscle. Nav1.5 block by lidocaine suppressed fibrillation potentials without changing the amplitude of compound muscle action potential (CMAP) in innervated muscle. Changes after denervation that occur in ion channels including Nav1.5 contribute to fibrillation potentials.
a b s t r a c t Objective: The molecular mechanisms underlying fibrillation potentials are still unclear. We hypothesised that expression of the cardiac-type voltage-gated sodium channel isoform Nav1.5 in denervated rat skeletal muscle is associated with the generation of such potentials. Methods: Muscle samples were extracted and analysed biologically from surgically denervated rat extensor digitorum longus muscle after concentric needle electromyographic recording at various time points after denervation (4 h to 6 days). Results: Both nav1.5 messenger RNA (mRNA) signal on northern blotting and Nav1.5 protein expression on immunohistochemistry appeared on the second day after denervation, exactly when fibrillation potentials appeared. Administration of lidocaine, which has much stronger affinity for sodium channels in cardiac muscle than for those in skeletal muscle, dramatically decreased fibrillation potentials, but had no effect on contralateral compound muscle action potentials. Conclusions: Expression of Nav1.5 participates in the generation of fibrillation potentials in denervated rat skeletal muscle. Significance: We proposed an altered expression of voltage-gated sodium channel isoforms as a novel mechanism to explain the occurrence of fibrillation potentials following skeletal muscle denervation. Ó 2012 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.
1. Introduction Fibrillation potentials are hallmarks of pathological change in electromyographic (EMG) studies in the diagnosis of neuromuscular disorders. Fibrillation potentials have been hypothesised to
Abbreviations: cDNA, complementary deoxyribonucleic acid; CMAP, compound muscle action potential; EDL, extensor digitorum longus; mRNA, messenger ribonucleic acid; EMG, electromyography; FITC, fluorescein isothiocyanate; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; RT-PCR, reverse transcriptase-polymerase chain reaction; SDS, sodium dodecyl sulphate; TTX, tetrodotoxin. ⇑ Corresponding author. Address: Department of Neurology, Kobe University Graduate School of Medicine, 7-5-2 Kusunoki-cho, Chuo-ku, Kobe City, Hyogo 650-0017, Japan. Tel.: +81 078 382 5885; fax: +81 078 382 5899. E-mail address: [email protected] (K. Sekiguchi).
arise from denervation acetylcholine hypersensitivity in response to small quantities of circulating acetylcholine (Denny-Brown and Pennybacker, 1938; Thesleff, 1982). However, denervation hypersensitivity appears along the entire length of denervated fibres, whereas fibrillation potentials originate only from the former endplate zone. In addition, infusion of large quantities of d-tubocurarine failed to abolish such discharges (Muchnik et al., 1973; Brumback et al., 1978; Kimura, 2001). Thus, these findings indicate that the underlying mechanisms of fibrillation cannot be accounted for by this hypothesis alone. It has been found that sodium channels play an important role in generation of fibrillation potentials, as fibrillation potentials were abolished by sodium-free solution (Purves and Sakmann, 1974). Localised sodium conductance change in denervated muscle cell membrane participates in the generation of fibrillation potentials
1388-2457/$36.00 Ó 2012 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.clinph.2012.01.002
K. Sekiguchi et al. / Clinical Neurophysiology 123 (2012) 1650–1655
(Thesleff, 1982; Kimura, 2001). Following denervation, mammalian skeletal muscle undergoes dramatic changes in conductance, including the new appearance of tetrodotoxin (TTX)-resistant sodium current (Pappone, 1980). Expression of the ‘cardiac type’ of sodium channel in denervated skeletal muscle has been reported to contribute to TTX-resistant sodium current (Rogart et al., 1989; Lupa et al., 1995). Mammalian sodium channels are heterotrimers, composed of a central, pore-forming alpha subunit and two auxiliary beta subunits. The alpha subunits form a gene family with 10 members including cardiac specific isoform Nav1.5 (Catterall et al., 2005). There have, however, been no reports of the relationship between the generation of fibrillation potentials and expression of Nav1.5 in denervated skeletal muscle. The goal of this study was to clarify the association between fibrillation potentials and the cardiac sodium channel isoform by evaluating temporal changes in both the electromyogram and sodium channel expression in an animal model of denervation. 2. Materials and methods The experimental protocol was approved by the Institutional Animal Care and Use Committee of Kobe University (Permission number: P-030702) and carried out according to the Kobe University Animal Experimentation Regulations. Totally over 24 animals (three animals per time point) were studied to ensure reproducibility of the experiment. 2.1. Denervation Adult (250–300 g body weight) female Wistar rats were anaesthetised with intra-peritoneal injection of sodium pentobarbital (50 mg kg–1). The right hindlimb was denervated by removal of a section of the sciatic nerve (5 mm) at the mid-thigh level. The incision was sutured with 3/0 silk braid. 2.2. Electromyography Under sodium pentobarbital anesthesia, a concentric needle electrode (Neuroline 740 concentric, 30 gauge, Ballerup, Denmark) was placed in the mid-point along the length of the right extensor digitorum longus (EDL) muscle at various time points after denervation surgery. The evaluation time points were determined more short-term (4 h, 8 h, 16 h, 1 day, 2 days, 3 days and 6 days) than previous chronic denervated state research (6–14 days), because fibrillation potentials appear about 3 days after surgery in the rat model (Arancio et al., 1989). Electromyographic (EMG) signals were amplified using a Neuropack 8 (Nihon Kohden, Tokyo, Japan) with a band pass of 10 Hz–10 kHz and captured for 0.01 ms. To avoid effects of hyperactivity associated with needle insertion, the recordings were started after the amount of spontaneous discharge had reached steady state. All data were digitised with a sampling frequency of 44.1 kHz and stored as wav format files in a Windows PC. The total number of fibrillation potential discharges in a 10-min recording was counted with signal analysis software (Spike 2, Cambridge Electronic Design, UK). Three animals were studied for every time point. The identical animal was never used sequentially to exclude effects of needle injury. 2.3. Tissue preparation Animals were humanely sacrificed by deep pentobarbital anesthesia and decapitation after electromyographic recording. Immediately after section of the denervated EDL muscle, tissue samples were frozen in liquid nitrogen.
1651
2.4. Northern blotting analysis For production of a nav1.5-specific probe, oligonucleotide primers were designed based on the published rat nav1.5 complementary DNA (cDNA) sequence (GenBank No. M27902: sense 50 agctctctggagatgtctcc 30 ; anti-sense 50 acggtgctgttccttttgcc 30 ). The nav1.5 cDNA fragment was generated by reverse transcriptase polymerase chain reaction (RT-PCR) using RNA isolated from rat heart muscle and the primers. The PCR products were cloned with Escherichia coli (JM109: ToYoBo Co. Ltd., Tokyo, Japan)-transfected plasmid (pGEMÒ-T Easy Vector System I, Promega, USA). The sequence of purified amplified nav1.5 cDNA fragments was confirmed with a sequencing analyser (ABI-7700: Applied Biosystems, USA). Total RNA was isolated from 100 mg of frozen muscle sample using TRIzol reagent (Invitrogen, USA). Then 20-lg RNA samples were denatured and fractionated by electrophoresis in 1.2% agarose/6% formaldehyde gels. Separated RNA was transferred onto nylon membranes (Biodyne A: Pall, Drieich, FRG), and hybridisation was carried out with [32P] random prime-labelled nav1.5-specific probes at 42 °C for 24 h. Blots were washed 4 times with 0.1 SSC/0.1% sodium dodecyl sulphate (SDS) at 65 °C. The membranes were exposed to imaging plates (BAS-SR: Fujifilm, Japan) for 24 h and signals were detected using a BAS-2000 imaging plate reader. Data were analysed and counted with image analysis software (Image Gauge Ver. 4.0, Fujifilm, Japan). 2.5. Immunohistochemistry Staining procedures were performed as described by Haimovich et al. (1987). In brief, tissue sections (6 lm thick) were cut in a cryostat and air-dried for 1 h. Unfixed sections were permeabilised with phosphate-buffered saline (PBS) containing 0.2% Triton X-100 for 20 min and blocking with PBS containing 10% goat serum at room temperature. Sections were then incubated with anti-Nav1.5 antibody (1:20, Alomone Labs, Israel) diluted with the same blocking solution overnight at 4 °C. The specimens from the contralateral EDL innervated muscle and cardiac muscle were also stained as negative control and positive control, respectively. To verify signal specificity, one specimen was incubated with primary antibody preincubated with antipeptide (1:1). The sections were washed with PBS 3 times for 5 min each and incubated with goat fluorescein isothiocyanate (FITC)-labelled anti-rabbit immunoglobulin G (IgG) antibody (1:200, Jackson Immunoresearch, UK) for 1 h at room temperature. After washing thrice, the immunoreactivity of the sections was observed with a laser confocal microscope (LSM5Pascal, Zeiss, Germany). 2.6. Lidocaine injection The cardiac anti-arrhythmic agent lidocaine was used as a relatively specific Nav1.5 blocker. Three animals that were subjected to denervation surgery 6 days before injection were studied. The fibrillation potentials elicited from denervated rat EDL muscles were continuously recorded. About 5 min after needle insertion, the amount of spontaneous firing reached steady state, and 0.1 ml PBS was injected as a control via the tail vein with EMG observation. Five minutes later, lidocaine hydrochloride solution (XylocaineÒ injection 1%, AstraZeneca, Tokyo, Japan; 0.05–0.06 ml: 2 mg kg–1) was injected via the tail vein, and EMG monitoring was continued. Simultaneously, compound muscle action potentials (CMAPs) were recorded from the contralateral EDL muscle using surface electrodes placed on the anterior aspect of the hind limb with supramaximal electric stimulation of the sciatic nerve in the thigh. Stimulus duration was fixed at 0.2 ms. The obtained records of EMG were processed to temporal changes in the value of the root mean square with a time constant
1652
K. Sekiguchi et al. / Clinical Neurophysiology 123 (2012) 1650–1655
of 10 ms with the signal analysis software Spike2 to evaluate the power of fibrillatory activity. 3. Results 3.1. Spontaneous discharges increased gradually after denervation There were no electrical discharges detected during the 24-h period after denervation surgery. Stable firing of spontaneous discharges was first recognised on the second day after denervation. The number of discharges rapidly increased day by day and eventually became stable. On the sixth day after denervation, the EMG monitor was filled with very large numbers of discharges (Fig. 1). The contralateral EDL muscle maintained electrical silence. 3.2. New expression of nav1.5 mRNA noted on the second day after denervation No nav1.5-specific signal was detected in the control EDL muscle. In the denervated muscle, a nav1.5-specific signal was detected at around 7.5 kb on the second day, which increased on the third day, and then decreased on the sixth day after denervation (Fig. 2). 3.3. Nav 1.5 protein detected on denervated muscle membrane and in cytoplasmic regions after denervation Immunohistochemical examination revealed localised signals in the perinuclear sarcoremmal areas of some muscle fibres on the second day. Expression of signal gradually increased with dispersion and on the sixth day signal was detected throughout the fibre membrane and was sparse in the cytoplasmic regions in some fibres. There was no signal from the contralateral EDL innervated muscle. There were abundant signals localised in repeated transversely oriented bands on cardiac muscle on which Nav1.5 is predominantly distributed in T-tubular systems as previously reported (Haimovich et al., 1987). Preincubation with antipeptide for primary antibody completely eliminated the signal (Fig. 3). 3.4. Lidocaine injection decreased the number of fibrillation potentials without changing the amplitudes of CMAP Intravenous injection of lidocaine (2 mg kg–1) immediately decreased spontaneous discharges in denervated muscle. The amplitude of fibrillation potentials decreased initially, followed by reduction of the rate of firing (Fig. 4A). The same suppression of fibrillation potentials was observed in three animals. In contrast, lidocaine injection had no effect on the amplitudes of CMAP evoked by sciatic nerve stimulation in the contralateral innervated EDL muscle (Fig. 4B). These findings indicate that lidocaine injection had no effects on ordinary mechanisms of muscle contraction. 4. Discussion We demonstrated here that Nav1.5 expressions in denervated skeletal muscle contribute to generation of fibrillation potential by the following three findings: (i) fibrillation potentials developed with simultaneous expression of Nav1.5 early after denervation, (ii) novel appearance and persistence of Nav1.5 expression in denervated rat skeletal muscle were confirmed at the protein level and (iii) lidocaine, which had a high affinity for Nav1.5, attenuated fibrillation potentials. The cardiac sodium channel Nav1.5, recently known as one of the causative molecules of genetic arrhythmias such as Brugada syndrome, is not present in matured skeletal muscle (Kapplinger et al., 2010). However, Nav1.5 expresses on early development
Fig. 1. An illustrative raw waveform of EMG of denervated rat EDL muscle recorded by concentric needle insertion under pentobarbital anesthesia. (A) First day, (B) Second day, (C) Third day, (D) Sixth day after denervation. Spontaneous discharges increased day by day. Scale bar indicates 30 ms. Mean changes in number of fibrillation potentials from all examined rats at each time after denervation. (E) Spike counts per 1-s of fibrillation potentials during 10-min recordings are plotted at each time point after denervation. Three animals were studied for each time point.
K. Sekiguchi et al. / Clinical Neurophysiology 123 (2012) 1650–1655
Fig. 2. Northern blot analysis showing expression of nav1.5 mRNA at indicated times after denervation. (A) Expression of nav1.5 mRNA was first noted on the second day, increased on the third day, and decreased on the sixth day after denervation (upper panel). Expression of g3pdh mRNA indicated that approximately equal amounts of RNA had been loaded (lower panel). (B) Quantification of nav1.5 mRNA after denervation. Each bar is the mean of signal intensity of three separate blots.
and denervation in skeletal muscle, responsible for tetrodotoxinresistant sodium current (Rogart et al., 1989; Kallen et al., 1990; Yang et al., 1991; Lupa et al., 1995). In our study, an nav1.5-specific signal was detected on northern blot analysis at the same time as fibrillation potentials appeared. While the nav1.5 mRNA signal decreased on the sixth day after
1653
denervation, expression of the Nav1.5 protein continued to increase, as determined immunohistochemically. Although the half-life of the Nav1.5 protein has not been known, this finding suggests that the Nav1.5 protein is relatively stable. The time-series pattern of expression of nav1.5 mRNA described in previous reports appeared to be biphasic, similar to our results (Yang et al., 1991; Lupa et al., 1995). We first demonstrated here the expression of Nav1.5 proteins in denervated rat muscle immunohistochemically. The neuromuscular junctional pattern of immunoreactivity early after denervation was similar to Nav1.4 in innervated skeletal muscle and nav1.5 mRNA expression in denervated skeletal muscle (Caldwell and Milton, 1988; Awad et al., 2001). The cytoplasmic pattern on 6 days after denervation was similar to Nav1.4 expression in innervated muscle, suggesting expression in membranes of the T-tubular system (Haimovich et al., 1987). The expression pattern detected throughout the fibre membrane was also similar to Nav1.5 expression in cultured adult rat skeletal muscle fibres recently reported (Morel et al., 2010). Several in vitro studies have shown that lidocaine has much greater affinity for the sodium channels in cardiac muscle than for those in skeletal muscle (Makielski et al., 1999; Nuss et al., 2000; Li et al., 2002). We used 2 mg kg–1 of lidocaine (standard dose for arrhythmia in rats) in order to block Nav1.5, because no Nav1.5 specific blocker exists (Rousseau-Migneron et al., 1990). Dramatic fibrillation decrease without any effect on CMAP implied that lidocaine worked in this experiment as a relatively selective Nav1.5 blockade. We noticed that amplitude tended to decrease prior to the reduction of firing rate in raw EMG waves during administration of lidocaine. This finding suggests that decrement of inward sodium current via Nav1.5 sodium channel blockade first decreases the amplitude of potentials and thereby decreases the probability of reaching the threshold of depolarisation. Nav1.5 may contribute to generation of fibrillation through several mechanisms. Nav1.5 is a candidate for novel, fast recovery of sodium channels from inactivation state in denervated muscles as expected before (Kirsch and Anderson, 1986). Reduction of the refractory period due to fast recovery from inactivation state induces hyperexcitability. In addition, denervation-induced depolarisation closes the membrane potential to its threshold increasing the probability of random firing (Thesleff, 1982; Kirsch and
Fig. 3. Confocal microscopic immunohistochemistry of Nav1.5 protein in cross-sections of denervated EDL muscle at indicated times after denervation. (A) First day, (B) Second day, (C) Third day, (D) Sixth day. The specimens were immunolabelled with FITC-conjugated anti-rabbit IgG antibody after treatment with anti-Nav1.5 antibody. Localized membrane signals appeared after denervation surgery on the second day (B) and increased on the third day (C) and sixth day (D). Immunoreactivity was not detected when antibody was preincubated with antigenic peptide (E). Antibody did not react to innervated contralateral control EDL muscle specimen (F), but did react to rat cardiac muscle which contained abundant Nav1.5 protein (G). All images are 400 magnification.
1654
K. Sekiguchi et al. / Clinical Neurophysiology 123 (2012) 1650–1655
Fig. 4. Effects of lidocaine injection on electrophysiological findings. (A): Changes in root mean square (RMS) values of fibrillation potentials with a time constant of 10 ms in denervated EDL muscle. The RMS value, which reflects total electrical activity of muscle, decreased immediately after injection of 2 mg/kg lidocaine. The raw waves in the illustrated case indicated that the amplitude decreased prior to the decrease in firing rate (injection at arrowhead). (B): CMAP of contralateral innervated EDL muscle elicited by stimulation of sciatic nerve. CMAP amplitude did not change before to after lidocaine injection.
Anderson, 1986). After hyperpolarisation, which is required for regular recurrent firing, newly emerged in action potential in denervated muscle, probably by persistent sodium current (Thesleff and Ward, 1975; Gege et al., 1989; Kotsias and Venosa, 2001). Nav1.5 expression may contribute to generation of after hyperpolarisation by decreasing the total amount of inward-going sodium current (Wang et al., 1996; Kotsias and Venosa, 2001). A recent study showed that another TTX-resistant sodium channel Nav1.8 ectopically expressed on the motor axon in myelin protein zero mutant mice contributed to deterioration of nerve excitability (Moldovan et al., 2011). The altered expression of voltage-gated sodium channel may emerge as a general feature of response to injury in muscle and nerve as a reverting-back phenomenon (Yoshida, 1994). Alteration of other ion channels after denervation has also been reported (Klocke et al., 1994; Shin et al., 1997; Pribnow et al., 1999; Jacobson et al., 2002). The changes that occurred in various ion channels contribute to generation of fibrillation potentials, and sodium channels must be included among them. To reconsider the association between molecular and electrophysiological basis underlying muscle denervation may give an important insight to neuromuscular research, especially regenerative therapeutic strategy. Acknowledgement We would like to thank Dr. Hisatomo Kowa for advice in the preparation of the manuscript.
References Arancio O, Cangiano A, De Grandis D. Fibrillatory activity and other membrane changes in partially denervated muscles. Muscle Nerve 1989;12:149–53. Awad SS, Lightowlers RN, Young C, Chrzanowska-Lightowlers ZM, Lømo T, Slater CR. Sodium channel mRNAs at the neuromuscular junction: distinct patterns of accumulation and effects of muscle activity. J Neurosci 2001;21:8456–63. Brumback RA, Bertorini TE, Engel WK, Trotter JL, Oliver KL, Zirzow GC. The effect of pharmacologic acetylcholine receptor on fibrillation and myotonia in rat skeletal muscle. Arch Neurol 1978;35:8–10. Caldwell JH, Milton RL. Sodium channel distribution in normal and denervated rodent and snake skeletal muscle. J Physiol 1988;401:145–61. Catterall WA, Goldin AL, Waxman SG. International Union of Pharmacology. XLVII. Nomenclature and structure-function relationships of voltage-gated sodium channels. Pharmacol Rev 2005;57:397–409. Denny-Brown D, Pennybacker JB. Fibrillation and fasciculation in voluntary muscle. Brain 1938;61:311–32. Gege PW, Lamb GD, Wakefield BT. Transient and persistent sodium currents in normal and denervated mammalian skeletal muscle. J Physiol 1989;418:427–39. Haimovich B, Schotland DL, Fieles WE, Barchi RL. Localization of sodium channel subtypes in adult rat skeletal muscle using channel-specific monoclonal antibodies. J Neurosci 1987;7:2957–66. Jacobson D, Herson PS, Neelands TR, Maylie J, Adelman JP. SK channels are necessary but not sufficient for denervation-induced hyperexcitability. Muscle Nerve 2002;26:817–22. Kallen RG, Sheng ZH, Yang J, Chen L, Rogart RB, Barchi RL. Primary structure and expression of a sodium channel characteristic of denervated and immature rat skeletal muscle. Neuron 1990;4:233–42. Kapplinger JD, Tester DJ, Alders M, Benito B, Berthet M, Brugada J, et al. An international compendium of mutations in the SCN5A-encoded cardiac sodium channel in patients referred for Brugada syndrome genetic testing. Heart Rhythm 2010;7:33–46. Kimura J. Electrodiagnosis in diseases of nerve and muscle. 3rd ed. Oxford: Oxford University Press; 2001. p. 346–350.
K. Sekiguchi et al. / Clinical Neurophysiology 123 (2012) 1650–1655 Kirsch GE, Anderson MF. Sodium channel kinetics in normal and denervated rabbit muscle membrane. Muscle Nerve 1986;9:738–47. Klocke R, Steinmeyer K, Jentsch TJ, Jockusch H. Role of innervation, excitability, and myogenic factors in the expression of the muscular chloride channel ClC-1. A study on normal and myotonic muscle. J Biol Chem 1994;269:27635–9. Kotsias BA, Venosa RA. Sodium influx during action potential in innervated and denervated rat skeletal muscles. Muscle Nerve 2001;24:1026–33. Li RA, Ennis IL, Tomaselli GF, Marban E. Structural basis of differences in isoformspecific gating and lidocaine block between cardiac and skeletal muscle sodium channels. Mol Pharmacol 2002;61:136–41. Lupa MT, Krzemien DM, Schaller KL, Caldwell JH. Expression and distribution of sodium channels in short- and long-term denervated rodent skeletal muscles. J Physiol 1995;483:109–18. Makielski JC, Limberis J, Fan Z, Kyle JW. Intrinsic lidocaine affinity for Na channels expressed in Xenopus oocytes depends on alpha (hH1 vs. rSKM1) and beta 1 subunits. Cardiovasc Res 1999;42:503–9. Morel J, Rannou F, Talarmin H, Giroux-Metges MA, Pennec JP, Dorange G, et al. Sodium channel NaV1.5 expression is enhanced in cultured adult rat skeletal muscle fibers. J Membr Biol 2010;235:109–19. Moldovan M, Alvarez S, Pinchenko V, Klein D, Nielsen FC, Wood JN, et al. Nav1.8 channelopathy in mutant mice deficient for myelin protein zero is detrimental to motor axons. Brain 2011;134:585–601. Muchnik S, Ruarte AC, Kotsias BA. On the mechanism of denervatory electrical activity of single muscle fibers as tested in vivo with tetrodotoxin. Acta Physiol Lat Am 1973;23:24–8. Nuss HB, Kambouris NG, Marban E, Tomaselli GF, Balser JR. Isoform-specific lidocaine block of sodium channel explained by differences in gating. Biophys J 2000;78:200–10.
1655
Pappone PA. Voltage clamp experiments in normal and denervated mammalian skeletal muscle fibres. J Physiol 1980;306:377–410. Pribnow D, Johnson-Pais T, Bond CT, Keen J, Jhonson RA, Janowsky A, et al. Skeletal muscle and small-conductance calcium-activated potassium channels. Muscle Nerve 1999;22:742–50. Purves D, Sakmann B. Membrane properties underlying spontaneous activity of denervated muscle fibres. J Physiol 1974;239:125–53. Rogart RB, Cribbs LL, Muglia LK, Kephart DD, Kaiser MW. Molecular cloning of a putative tetrodotoxin-resistant rat heart Na+ channel isoform. Proc Natl Acad Sci 1989;86:8170–4. Rousseau-Migneron S, Tancrede G, Nadeau A. Lidocaine improves survival rate in diabetic rats submitted to acute left coronary artery ligation. Basic Res Cardiol 1990;85:404–10. Shin KS, Park JY, Kwon H, Chung CH, Kang MS. Opposite effect of intracellular Ca2+ and protein kinase C on the expression of inwardly rectifying K+ channel 1 in mouse skeletal muscle. J Biol Chem 1997;272:21227–32. Thesleff S, Ward MR. Studies on the mechanism of fibrillation potentials in denervated muscle. J Physiol 1975;244:313–23. Thesleff S. Fibrillation in denervated mammalian skeletal muscle. In: Culp WJ, Ochea S, editors. Abnormal nerves and muscles as impulse generators. New York: Oxford University Press; 1982. p. 678–94. Wang DW, George AL, Bennett PB. Comparison of heterologously expressed human cardiac and skeletal muscle sodium channels. Biophys J 1996;70:238–45. Yang JS, Sladky JT, Kallen RG, Barchi RL. TTX-sensitive and TTX-insensitive sodium channel mRNA transcripts are independently regulated in adult skeletal muscle after denervation. Neuron 1991;7:421–7. Yoshida S. Tetrodotoxin-resistant sodium channels. Cell Mol Neurobiol 1994;14:227–44.