- Email: [email protected]
Fibroblast growth factor 21 ameliorates high glucose-induced fibrogenesis in mesangial cells through inhibiting STAT5 signaling pathway
Biomedicine & Pharmacotherapy 93 (2017) 695–704
Available online at
ScienceDirect www.sciencedirect.com
Original article
Fibroblast growth factor 21 ameliorates high glucose-induced fibrogenesis in mesangial cells through inhibiting STAT5 signaling pathway Shuai Lia , Xiaochen Guoa , Teng Zhanga , Nan Wanga , Junyan Lia , Pengfei Xua , Shengqi Zhanga , Guiping Rena,b , Deshan Lia,b,* a b
Bio-pharmaceutical Lab, Life Science College, Northeast Agricultural University, Harbin, 150030, PR China Key Laboratory of Agricultural Biological Functional Gene, Harbin, 150030, PR China
A R T I C L E I N F O
Article history: Received 21 April 2017 Received in revised form 12 June 2017 Accepted 29 June 2017 Keywords: Fibroblast growth factor 21 Human mesangial cells Extracelluar matrix Growth factors STAT5
A B S T R A C T
Fibroblast growth factor 21 (FGF21) is a member of the FGF family and acts as a potent regulator of glucose and lipid homeostasis, but its effect on renal fibrosis and the underlying mechanisms are totally unknown. The purpose of this study was designed to investigate whether FGF21 has effect on high glucose-induced fibrogenesis in human mesangial cells (HMCs) and the underlying mechanism. High glucose is well known to stimulate the expression of extracelluar matrix (ECM) in human mesangial cells. In humans, overexpression and deposition of ECM lead to renal fibrosis. Thus, in this study, HMCs were incubated in high glucose with or without various concentrations of FGF21. Results demonstrated that the expression of FN, Col, TGF b1 and a-SMA were significantly up-regulated in HMCs. Whereas, treatment with FGF21 down-regulated the expression of FN, Col, TGF b1 and a-SMA. In addition, growth factors are considered to be an important driving force for the pathogenesis of renal fibrosis. Significantly increased PDGF, VEGF and CTGF expression were found in HMCs induced by high glucose. FGF21 treatments significantly decreased these growth factors expression by down-regulating the phosphorylation level of STAT5. Here, we reported for the first time that FGF21 decreases ECM expression by inhibiting STAT5 signal pathway and consequently decreasing the expression of PDGF, VEGF and CTGF. © 2017 Elsevier Masson SAS. All rights reserved.
1. Introduction Renal fibrosis is the common final outcome of almost all progressive chronic kidney diseases (CKD) [1,2]. The progression of renal fibrosis is hallmarked by increased secretion of growth factors, infiltration of inflammatory cells, overexpression and deposition of a large amount of extracelluar matrix (ECM), which results in a sustained activation and proliferation of mesangial cells. Together, these changes constitute a core set of fibrogenic events and lead the destruction of kidney function [3,4]. Renal fibrosis is associated with mesangial cell proliferation and myofibroblastic activation. Both fibroblasts and myofibroblasts have the capacity to proliferate in response to cytokine cues, resulting in areas of fibroblastic foci which are thought to be the sites of active extracellular matrix synthesis, and are regarded to be
* Corresponding author at: College of Life Science, Northeast Agricultural University, 59 Mucai Street, Harbin, 150030, PR China. E-mail address: [email protected] (D. Li). http://dx.doi.org/10.1016/j.biopha.2017.06.100 0753-3322/© 2017 Elsevier Masson SAS. All rights reserved.
the leading edge of fibrosis [5]. Compelling evidences suggest that growth factors believed to be pivotal for the process include platelet derived growth factor (PDGF), vascular endothelial growth factor (VEGF) and connective tissue growth factor (CTGF). They are believed to be a critical mediator of fibrogenesis by exerting immunological actions, having direct effects on structural cells involved in the synthesis of ECM and affecting fibroblast proliferation and the differentiation of fibroblasts into myofibroblasts [6–8]. Studies in vivo and in vitro provided evidences that high glucose is shown to enhance glomerular mesangial cell proliferation and stimulated ECM synthesis and production of growth factors [5,9,10]. Recently, several factors including Ap-1, NFkB, SMAD, Nrf2 and STAT have been shown to regulate the transcription of cytokines, inflammatory enzymes, chemokines, matrix metalloproteinases, which further affect the cell proliferation, differentiation and migration [11–13]. Signal transducers and activators of transcription (STAT) is a seven member family that mediates celluar response to diverse cytokines. Once phosphorylated, STAT proteins have been translocated to the nucleus, they bind to the regulatory regions of target genes [14]. Of these family
696
S. Li et al. / Biomedicine & Pharmacotherapy 93 (2017) 695–704
members, STAT5 is expressed in several metabolically relevant tissues, including kidney, spleen and liver. The sustained activation of the STAT5 pathway in mesangial cells induced the expression of growth factors and ECM in response to stimulate by high glucose, suggesting that blocking STAT5 signaling pathway is related to ameliorate fibrogenesis [15]. Fibroblast growth factor 21 (FGF21), a member of the FGF superfamily, has recently emerged as a potent regulator of metabolism [16]. The effects of FGF21 have been mediated by stimulating fibroblast growth factor receptor (FGFR) together with the obligate co-receptor bklotho in its target organs, including adipose tissue, liver and kidney [17,18]. Moreover, increasing evidences demonstrated that FGF21 exerts the function of antioxidative, anti-inflammation and anti-fibrosis [19–22]. In vivo studies demonstrated that FGF21 treatment improves the histological changes and reduces ECM accumulation hepatic fibrogenic model. The mechanisms involved NFkB and TGF b/Smad 2/3 signaling pathway. However, the role of FGF21 in renal mesangial cells fibrogenesis has not been explored [22]. Therefore, in the present study, we investigated the role of FGF21 to contribute to high glucose induced mesangial cells fibrogenesis and the mechanism of its action. 2. Materials and methods 2.1. FGF21 preparation The recombinant pSUMO vector containing the murine FGF21 was transformed into Escherichia coli Rosetta for expression. Transformants containing the FGF21 gene were inoculated in LB medium with ampicillin (100 mg/mL) and grew at 37 C with shaking (150 rpm). When the OD600 reached 0.4–0.6, isopropylb-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.25 mmol/L. The culture was continued to grow for additional 5 h at 30 C in a shaking incubator at 80 rpm to induce the expression of FGF21 protein. FGF21 purified by affinity chromatograph using AKTA purifier (GE Healthcare). SDS-polyaerylamide electrophoresis (SDS-PAGE) analysis purified FGF21 protein revealed the presence of a single band. 2.2. Cell culture HMC cell lines were a gift from Prof. J. D. Jiao (Harbin Medical University). Our studies used HMCs cultured in RPMI 1640 medium (Gibco) containing 1m antibiotics (Penicillin-Streptomycin), 8 mM glucose and 10% fetal bovine serum (FBS) at 37 C in 5% CO2. HMCs grown in 6-well culture plates with serum-free media for 24 h to synchronize the cell growth, FGF21 was added into the medium in association with high glucose. The experiment contains five groups: control (treated with PBS), HG (30 mM glucose), HG + FL (10 nmol/L), HG + FM (100 nmol/L), HG + FH (1000 nmol/L). After 24 h of incubation, the cultures were washed twice with PBS and the cells were gathered for immunofluorescent, qPCR, ELISA and western blot analysis. 2.3. Immunofluorescent assay HMCs were cultured and grown as monolayers and fixed in 4% paraformaldehyde for 30 min at room temperature. Cells were incubated at 4 C with serum (10% in PBS) for 1 h. They were then incubated with monoclonal anti-collagen I (1:100, Abcam), antia-smooth muscle actin (a-SMA, 1:100, Abcam) and anti-TGF-b1 (1:100, Abcam) for 1 h at 37 C, and then washed and incubated in the dark for 30 min with FITC-conjugated rabbit anti-mouse antibody (BioLegend Inc., San Diego, CA, USA) followed by 4.6diamidino-2-phenylindole (DAPI) was performed to identity the
nucleus. After staining, the cells were assayed using a fluorescence microscope. 2.4. Real-time PCR Total RNA was isolated from treated cells with Trizol (Invitrogen, USA). Using the Reverse Transcription Kit (Promega USA), we reverse transcribed 1–2 ug of total RNA. The expression levels of genes were determined by quantitative PCR using SYBR Green Supermix (ABI 7500, Applied Biosystems, Carlsbad, CA, USA) The analysis was done using a CFX connect Real-time System (BioRad, USA). The b-actin RNA was amplified at the same time and used as an internal control. For both b-actin and samples, the paraments included a single cycle of 95 C for 10 min followed by 40 cycles of 95 C for 15 s and 61 C for 1 min. We calculated mRNA using a 244t relative to the average of target genes. 44t was obtained by subtracting the mean 4Ct of the control cells from the 4Ct of each sample. Table 1 shows the sequences of the primer pairs. 2.5. Enzyme-linked immunosorbent assays (ELISA) The protein levels of FN, Col I, TGF b1, a-SMA, PDGF, VEGF and CTGF in HMCs supernatants were measured using ELISA kit (R&D, systems, USA), according to the manufacturer’s instructions. Briefly, cells in 6-wells plates, were incubation with or without FGF21 and high glucose for 24 h, and then collected the supernatants from cell cultures. 2.6. Western blot analysis Nuclear and cytoplasmic proteins were prepared using the Nuclear and Cytoplasmic Protein Extraction Kit (Beyothme Institute of Biotechnology, Suzhou, China) according to the manufacturer’s instructions. The protein concentration was measured using the Pierce BCA Protein Assay Kit (Thermo, USA). We used 30ug total protein or 40 ug of nuclear protein on a SDSPAGE, and then transferred it to nitrocellulose membrane (GE Healthcare, USA). We then blocked with 5% skim milk in phosphate buffer saline (PBS) and probed with the following antibodies overnight at 4 C: anti-STAT (1:1000, Abcam), anti-pSTAT (1:1000, Abcam), anti-Lamin b1 (1:10,000, R&D, USA), and then followed by a horseradish peroxidase-conjugated secondary antibodies to rabbit IgG (1:7500, R&D, USA) 1 h at 37 C. Blots were visualized using an enhanced chemi-lumi nesencedetection kit (ECL; Thermo Scientific, USA).
Table 1 Sequences of Real-time PCR primers used in this study. Gene
Primer sequence
Col I F Col I R FN F FN R TGF-b1 F TGF-b1 R a-SMA F a-SMA R CTGF F CTGF R VEGF F VEGF R PDGF F PDGF R Lamin b1F Lamin b1 R
ATCAACCGGAGGAATTTCCGT CACCAGGACGACCAGGTTTTC GAGAATAAGCTGTACCATCGCAA CGACCACATAGGAAGTCCCAG CTAATGGTGGAAACCCACAACG TATCGCCAGGAATTGTTGCTG CTATGAGGGCTATGCCT GCTCAGCAGTAGTAACGAAGGA ACCGACTGGAAGACACGTTTG CCAGGTCAGCTTCGCAAGG AGGGCAGAATCATCACGAAGT AGGGTCTCGATTGGATGGCA GCAAGACCAGGACGGTCATTT GGCACTTGACACTGCTCGT CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT5
S. Li et al. / Biomedicine & Pharmacotherapy 93 (2017) 695–704
2.7. Wound healing assay HMCs were cultured in 6-well culture plates with RPMI 1640 media to confluence. A wound was made using a pipette tip and the culture medium was changed to fresh serum-free medium. Subsequently, the confluent cell layers were incubated with and without high glucose (30 mM) or different concentrations of FGF21 (10, 100, 1000 nmol/L) in a 5% CO2 high-humidity atmosphere at 37 C. Migration was measured for 24 h with a microscope. Images were analyzed with Image J. 2.8. Statistical analysis All data were statistically analyzed by SPSS 17.0 software. Data were expressed as mean SD, and analyzed by one-way analysis of
697
variance (ANOVA) followed by Student’s t-test for the determination of any significant differences. P values below 0.05 were considered statistically significant. 3. Results 3.1. FGF21 suppresses FN and COL I expression in HMCs under high glucose conditions In HMCs, the excessive deposition of ECM proteins, specifically fibronectin (FN) and Collagen Type I (Col I) overexpression, lead to acceleration of the pathological progress of renal fibrosis [4]. We question whether FGF21 mediates ECM expression in renal fibrosis. HMCs were incubated with high glucose together with different concentrations of FGF21 for 24 h. We analyzed the effects of FGF21
Fig. 1. FGF21 down-regulates the expression of fibronectin (FN) and Collagen Type I (Col l) in HMCs under high glucose condition (HG). HMCs were incubated in high glucose condition with or without different concentrations of FGF21 (low: FL; medium: FM and high: FH) for 24 h. The expression of FN mRNA (A) and protein (B), Col I mRNA (C) and protein (D) in HMCs were determined by Real-time PCR or ELISA. Col I expression in the HMCs was also examined by Immunofluorescent assay and co-stained with DAPI (E). The data were performed using one-way analysis of variance (ANOVA), followed by Student two-tail t-test. Data represent the mean SD (n = 6–10).*p < 0.05, **p < 0.01 and ***p < 0.001.
698
S. Li et al. / Biomedicine & Pharmacotherapy 93 (2017) 695–704
on expression and distribution of Col I and FN in HMCs under high glucose conditions. The results revealed that the mRNA expression levels of Col I and FN in HG group were up-regulated significantly compared with control group (p < 0.05). The mRNA expression levels of Col I and FN in HG+FGF21 groups were down-regulated significantly in a dose-dependent manner compared with HG groups (p < 0.001). Furthermore, the protein expression levels of FN and Col I were significantly up-regulated in HG group (P < 0.05) compared with control group. However, treatment with FGF21 blocked the protein expression levels of FN and Col I in a dosedependent manner compared with HG group (Fig. 1A–D). Immunofluorescence assays showed that Col I was expressed at high level in HG group compared with control group. But in FGF21 treatment groups, there were no significant changes compare with control group (Fig. 1E). These findings indicate that FGF21 mediates ECM homeostatic.
expression of TGF-b1 in HMCs. These cells were cultured in high glucose medium together with or without FGF21. As shown in Fig. 2A, the mRNA expression level of TGF-b1 significantly increased in HG group compared with control group (p < 0.05). However, treatment with FGF21 for 24 h blocked this increase significantly in a dose-dependent manner compared with HG group. In addition, we confirmed our Real-time data by ELISA and Immunofluorescence to evaluate the protein expression level of TGF-b1. Results showed that the protein expression level of TGFb1 in HG + FGF21 groups was significantly decreased compared with HG group (Fig. 2B–C). Notably, the expression of TGF-b1 is significantly decreases by FGF21 treatment in HMCs under high glucose conditions.
3.2. FGF21 suppresses TGF-b1 expression in HMCs under high glucose conditions
Previous studies showed that proliferation of HMCs was accompanied with phenotype change such as expression of a–SMA, which was a hallmark of phenotypic alteration. When mesangial cells are stimulated with high glucose, inactive mesangial cells can be transformed into proliferative mesangial cells and transdifferentiate. However, strong phenotype transdifferentiation leads to the production of large ECM in mesangial cells [5]. According to above findings, we investigate whether administration of FGF21 attenuates phenotype transdifferentiation. Fig. 3A showed that the mRNA expression level of a–SMA increased in HG group compared with control group (p < 0.001).
It suggests that TGF-b1 stimulates the synthesis and inhibits the degradation of ECM molecules, and promotes mesangial cell proliferation [8]. Moreover, TGF-b1 stimulates the expression of different types of collagen and fibronectin. These lead to the complex accumulation of ECM, resulting in glomerular fibrosis [22]. We have previously shown that FGF21 down-regulated the expression of FN and Col I in HMCs under high glucose conditions. Therefore, we further investigate whether FGF21 modulates the
3.3. FGF21 suppresses a-SMA expression in HMCs under high glucose conditions
Fig. 2. FGF21 down-regulates the expression of TGF-b in HMCs under high glucose condition (HG). HMCs were incubated in high glucose condition with or without different concentrations of FGF21 (low: FL; medium: FM and high: FH) for 24 h. The expression of TGF-b mRNA (A) and protein (B) in HMCs were determined by Real-time PCR or ELISA. TGF-b expression in the HMCs was also examined by Immunofluorescent assay and co-stained with DAPI (C) The data were performed using one-way analysis of variance (ANOVA), followed by Student two-tail t-test. Data represent the mean SD (n = 6–10).*p < 0.05, **p < 0.01 and ***p < 0.001.
S. Li et al. / Biomedicine & Pharmacotherapy 93 (2017) 695–704
699
Fig. 3. FGF21 down-regulates the expression of a-SMA in HMCs under high glucose condition (HG). HMCs were incubated in high glucose condition with or without different concentrations of FGF21 (low: FL; medium: FM and high: FH) for 24 h. The expression of a-SMA mRNA (A) and protein (B) in HMCs were determined by Real-time PCR or ELISA. a-SMA expression in the HMCs was also examined by Immunofluorescent assay and co-stained with DAPI (C) The data were performed using one-way analysis of variance (ANOVA), followed by Student two-tail t-test. Data represent the mean SD (n = 6–10).*p < 0.05, **p < 0.01 and ***p < 0.001.
Treatment with FG21 blocked this increase significantly in a dosedependent manner compared with HG group (p < 0.001). ELISA and Immunofluorescence results showed that the protein expression level of a–SMA was significantly up-regulated in HG group (P < 0.001) compared with control group. FGF21 treatment remarkably reduced the protein expression level of a–SMA in a dose-dependent manner compared with HG group (Fig. 3B–C). Taken together, these data demonstrate that FGF21 contributes to phenotypic alteration of HMCs under high glucose conditions. 3.4. PDGF, VEGF and CTGF are suppressed by FGF21 Recent studies showed that growth factors played key roles in fibrogenic changes in the kindey [6]. Growth factors are considered as important driving force for the pathogenesis of renal fibrosis. Some studies show that its likely involvement as one of the pathways stimulating the deposition of extracellular matrix around mesangial cells exposed to high glucose conditions [7– 9]. In this study, we found that FGF21 played a significant role in regulating of high glucose-induced fibrogenesis in HMCs. Therefore, we investigate the role of FGF21 reduced the expression of PDGF, VEGF and CTGF in high glucose culture. For this purpose, the expression of PDGF, VEGF and CTGF were evaluated by Real-time PCR and western blotting. Results showed that the mRNA and protein expression levels of PDGF, VEGF and CTGF were significantly increased in HG group compared with control group. In contrast, treatment with FGF21 for 24 h, the mRNA and protein expression levels of PDGF, VEGF and CTGF were decreased in a
dose-dependent manner compared with HG group (Fig. 4). Altogether, these data confirm the conclusion that reduced the expression of PDGF, VEGF and CTGF by treatment with FGF21. 3.5. FGF21 inhibits the expression of PDGF, VEGF and CTGF via STAT5 It is well known that STAT5 plays an important role in regulating of many critical functions in both normal and malignant human tissues, including differentiation and proliferation [14]. In addition, pSTAT5 induced cells response to the expression of growth factors [15]. Many evidences point that FGF21 inhibits STAT5 signaling pathway [23]. To elucidate the possible mechanisms that FGF-21 ameliorates high glucose-induced mesangial cells fibrogenesis, we examine the effects of FGF21 on STAT5 signaling pathway. As shown in Fig. 5, we detected the phosphorylation level of STAT5 significantly up-regulated in HG group compared with control group. FGF21 treatment downregulated the phosphorylation level of STAT5 in HG +FGF21 groups significantly compared with HG group. Notably, these data provide strong evidences that FGF21 plays an important role in downregulating the STAT5 signaling pathway. 3.6. Wound healing assay Wound healing assay is a classic and commonly used method for studying cell migration. They have been used with multiple cell types and, as the monolayers heal the wound in a characteristic manner, they have been used to study cell polarization, cell
700
S. Li et al. / Biomedicine & Pharmacotherapy 93 (2017) 695–704
Fig. 4. FGF21 down-regulates the expression of PDGF, VEGF and CTGF in HMCs under high glucose condition (HG). HMCs were incubated in high glucose condition with or without different concentrations of FGF21 (low: FL; medium: FM and high: FH) for 24 h. The expression of PDGF mRNA (A) and protein (B), VEGF mRNA (C) and protein (D), CTGF mRNA (E) and protein (F) in HMCs were determined by Real-time PCR or ELISA. The data were performed using one-way analysis of variance (ANOVA), followed by Student two-tail t-test. Data represent the mean SD (n = 6–10).*p < 0.05, **p < 0.01 and ***p < 0.001.
migration and numerous other processes [24]. To evaluate whether FGF21 is associated with cell migration, we used wound healing method. The results (Fig. 6) showed that the mean displacement area of HG group increased compared with control group. Treatment with FG21 (HG + FM and FH groups) blocked this increase significantly compared with HG group. But there were no significantly differences in HG + FL group compare with HG group. 4. Discussion FGF21 was previously shown to improve the histological changes and reduce ECM accumulation during hepatic fibrogenesis in vivo and in vitro [22]. Although the above studies affirm the preventive effect of FGF21 against hepatic fibrosis, it remains unknown whether FGF21 has the ability to ameliorate renal fibrosis. Using a high glucose-induced fibrogenic cell as the model, we found that the expression and deposition of extracellular
matrix were increased by high glucose, especially the collagen and fibronectin. During the process of fibrogenesis, HMCs were transited into myofibroblast-like cells characterized by expressing a-SMA. Further, under high glucose conditions, the expression of TGF-b increased in mesangial cells, which leads to the complex accumulation of ECM. Administration of FGF21 significantly decreased the expression of Col I, FN, a-SMA and TGF-b in high glucose-induced mesangial cells. These data demonstrate that FGF21 attenuates high glucose-induced mesangial cells fibrogenesis. Evidence indicates that the increased expression and deposition of ECM is closed associated with growth factors, which are believed to be pivotal for fibrotic process include PDGF, VEGF and CTGF [6,25]. Many studies show that PDGF plays an important role in inducing production of ECM components in mesangial cells [26]. The mesangial cells are major site of PDGF expression in the glomeruli. Knockdown of the PDGF gene reduce high glucose-
S. Li et al. / Biomedicine & Pharmacotherapy 93 (2017) 695–704
Fig. 5. FGF21 down-regulates the expression of total STAT5 and STAT5 phosphorylation levels in HMCs. HMCs were incubated with high glucose together with or without different concentrations of FGF21 for 24 h. (A) Western blot analysis of total STAT5 and STAT5 phosphorylation levels in the HMCs of each group. (B) The relative total STAT5 and STAT5 phosphorylation level content were expressed as the ratio pSTAT5/STAT5. The bands were analyzed with Image J. The data were performed using one-way analysis of variance (ANOVA), followed by Student two-tail t-test. Data represent the mean SD (n = 6–10).*p < 0.05, **p < 0.01 and ***p < 0.001 **p < 0.01 and ***p < 0.001.
induced deposition of collagen, suggesting that the PDGF is involved in fibrotic extracelluar matrix production in mesangial cells [27]. Mesangial cells express PDGF receptor. Using a PDGF receptor inhibitor, BIBF 1000, which diminishes high glucosemediated induction of PDGF downstream genes include extracellular matrix proteins [6]. This result indicates that a possible mechanism of extracellular matrix accumulation can be controlled via PDGF in mesangial cells [28]. Base on the above data, PDGF is an interesting target for future anti-fibrotic therapeutic approach. According to present knowledge, a down-modulation of PDGF activity may shift the ECM balance in anti-fibrosis process. Our results also confirmed previous observations that the expression of PDGF significantly increased by high glucose in HMCs [29]. Whereas treatment with FGF21 for 24 h, the mRNA and protein expression levels of PDGF decreased in a dose-dependent manner (Fig. 4). Another important fibrogenic mediator, VEGF, is an angiogenic factor. In a rat model of bleomycin-induced pulmonary fibrosis, the expression of VEGF increased in fibrotic lesions [30]. Chaudhary proved that VEGF receptor could be inhibited by a prototypical small molecule inhibitor to decrease fibrosis. These data suggest that an anti-VEGF approach may offer a suitable anti-fibrosis therapy [31]. Recent studies showed that VEGF induces expression of CTGF through TGF-b-dependent pathway, which is mediated via VEGF receptors. CTGF is a chemoattractant and mitogen for fibroblasts [32]. CTGF effects important cellular function, such as proliferative activity and ECM synthesis [33]. These effects are not only executed by CTGF alone, but also in combination with other growth factors or through direct interaction with ECM [34,35]. Some studies demonstrate that VEGF is able to anchor with ECM depends on the presence of CTGF. This supports the proposal that CTGF acts primarily as matrix-associated proteins that provide a bridge between structural proteins in the ECM and effector
701
molecules such as growth factors recruit to the matrix [36–38]. In the same study, an enhancing effect of CTGF on the binding of FN to fibrin was demonstrated [39]. In conclusion, CTGF contributes to the ECM accumulation in tissue fibrosis by promoting fibre-fibre, fibre-matrix and matrix- matrix interactions through direct molecular interactions with matrix components [33]. Thus, preventive and treatment strategies targeting the VEGF and CTGF pathway are reasonable antifibrotic options in renal fibrosis. Base on the above data, we revealed a role for FGF21 in regulating the expression of VEGF and CTGF in high glucose-induced mesangial cell fibrogenesis. Results showed that the expression of VEGF and CTGF were significantly increased by high glucose in HMCs. Under high glucose conditions, treatment with FGF21 in HMCs decreased VEGF and CTGF both at mRNA and protein levels in a dosedependent manner. All of the above indicate that FGF21 decreases growth factors expression in high glucose conditions, and further decrease the expression and deposition of ECM. However, the underlying mechanism how FGF21 affects the expression of growth factors is not clear. Therefore, we searched for the potential genes to regulate growth factors. Among the potential genes, we focused on STAT because of its known role as a regulator of many critical functions in the pathophysiology of renal fibrosis [40]. The STAT pathway is a key pathway that participates in cytokine signal transduction. Numerous cytokines, including growth factors, regulate the proliferation and differentiation of cells through the STAT pathway [41]. Several preclinical studies show that the inhibition of STAT signaling results in the attenuation of fibrosis in rodents, suggesting that drug-targeting of the STAT pathway may provide a useful therapeutic intervention in human fibrotic diseases including renal fibrosis [42]. In experimental models, inhibition of the STAT signaling pathway, particularly STAT5, reduces renal fibrosis and prevent deterioration of renal function [43]. STAT5 is a member of the STAT protein family which is latent cytoplasmic transcription factors that mediate normal cellular responses to cytokines, growth factors and other polypeptide ligands [44–46]. The STAT5 phosphorylation leads to the activity of STAT5 pathway, which causes its translocation to the nucleus to bind DNA regulatory sequences and induce expression of multiple genes, including growth factors [47]. VEGF is shown to induce kidney fibroblast proliferation and extracellular matrix synthesis [48] Effect of VEGF on fibroblast is found to be partially mediated by STAT5. Some studies demonstrate that STAT activation promotes VEGF expression and stimulates cells proliferation [49,50]. Previous study showed that knockdown of STAT3 or STAT5 significantly decreased VEGF expression at mRNA and protein levels [51]. STAT5 has been described for regulation growth factors such as VEGF. Thus, similar mechanisms of protein-protein interaction in renal fibrosis may also propose for PDGF and CTGF. For example, it is shown that CTGF in renal fibrosis may regulate the expression of matrix-integrin complex by STAT5 signal pathway [31,52]. A widely accepted paradigm in concepts of development of renal fibrosis is that TGFb up-regulation is a main factor responsible for fibrotic changes. TGF-b is found to induce expression of PDGF in various cell types including mesangial cells, PDGF may act as a role of downstream of TGF-b leading to fibrosis. The two potential STAT-binding sites in the promoter region of TGF-b and demonstrated that STAT activates the promoter activity in vitro [52]. Therefore, TGF-b transcription seems to be directly regulated by STAT. Another study uses a combination of immunoprecipitation (IP) and immunoblotting to explore the possibility of a physical interaction between STAT5 and TGF-b. Result show that the 94 N-terminal amino acids of STAT5 are critical for the interaction with TGF-b [53]. Alternatively and provoking, it may also hint to regulate PDGF expression by STAT5. These data provide strong evidences that activation of STAT signaling has been shown to play an important
702
S. Li et al. / Biomedicine & Pharmacotherapy 93 (2017) 695–704
Fig. 6. FGF21 effects the migratory ability of HMC. HMCs were grown to 100% confluency in 6-well culture plates. Wounds were made in confluent layers of growth-arrested cells using a fine pipette tip (A). Migration was monitored for 24 h for calculation of cellular displacement (mm) with or without FGF21 (B). The displacement is the distance between the positions of cells at the beginning and at the end of the experiment. Images were analyzed with Image J. The data were performed using one-way analysis of variance (ANOVA), followed by Student two-tail t-test. Data represent the mean SD (n = 6–10).*p < 0.05, **p < 0.01 and ***p < 0.001 **p < 0.01 and ***p < 0.001.
role in driving growth factors expression and the development of tissue fibrosis. In this study, our findings suggest that high glucose activate STAT5 pathway and promote the progression of renal fibrosis through increasing growth factors. Consequently, STAT5-
mediated expression of growth factors is inhibited, which would alleviate the development of renal fibrosis. Indeed, Treatment with FGF21 reduced STAT5 tyrosine phosphorylation and prevented the high glucose-induced production of growth factors in mesangial
S. Li et al. / Biomedicine & Pharmacotherapy 93 (2017) 695–704
cells. Therefore, STAT5 activity is necessary for the progression of renal fibrosis. Inhibition of STAT5 signaling with FGF21 may hold therapeutic potential for fibrotic kidney diseases. However, the regulation of growth factors in mesangial cell is quite complicated, and we cannot rule out the possibility that other signaling pathways to modulate PDGF, VEGF and CTGF expression. In summary, we show that the overactivity of STAT5 signal pathway in HMCs under high glucose conditions, which may explain the high expression of PDGF, VEGF and CTGF, the cell fibrogenesis and the expression of ECM components. Treatment with FGF21 inhibits the overactivity of the STAT5 signal pathway and thus decreased PDGF, VEGF and CTGF expression. Furthermore, the decreased expression of PDGF, VEGF and CTGF inhibit excessive deposition of ECM in high glucose-induced mesangial cells. Taken together, these results suggest that FGF21 ameliorates high glucose-induced fibrogenesis in mesangial cells. We propose that FGF21 may be a promising therapeutic approach to prevent the renal fibrosis. Acknowledgments This work was supported by Bio-pharmaceutical Lab, Life Science College, Northeast Agricultural University. We are grateful to Prof. J. D. Jiao (Harbin Medical University) for HMC cell lines gift to us. References [1] P.Y. Chuang, M.C. Menon, J.C. He, Molecular targets for treatment of kidney fibrosis, J. Mol. Med. (Berl). 91 (5) (2013) 549–559. [2] R.C. Harris, E.G. Neilson, Toward a unified theory of renal progression, Annu. Rev. Med. 57 (2016) 365–380. [3] J.M. Zheng, J.M. Zhu, L.S. Li, et al., Rhein reverses the diabetic phenotype of mesangial cells over-expressing the glucose transporter (Glut 1) by inhibiting the hexosamine pathway, Br. J. Pharmacol. 153 (2008) 1456–1464. [4] S.H. Ayo, R.A. Radnik, J.A. Garoni, et al., Increased extracellular matrix synthesis and mRNA in mesangial cells grown in high-glucose medium, Am. J. Physiol. 260 (2) (1991) 185–191. [5] H. Kitsunai, Y. Makino, H. Sakagami, et al., High glucose induces plateletderived growth factor-C via carbohydrate response element-binding protein in glomerular mesangial cells, Physiol. Rep. 4 (6) (2016) e12730. [6] N.I. Chaudhary, G.J. Roth, F. Hilberg, et al., Inhibition of PDGF: VEGF and FGF signaling attenuates fibrosis, Eur. Respir. J. 29 (2007) 976–985. [7] R.K. Coker, G.J. Laurent, S. Shahzeidi, et al., Transforming growth factors-beta 1, beta 2, and beta 3 stimulate fibroblast procollagen production in vitro but are differentially expressed during bleomycin-induced lung fibrosis, Am. J. Pathol. 150 (1997) 981–991. [8] R.J. McAnulty, J.S. Campa, A.D. Cambrey, et al., The effect of transforming growth factor beta on rates of procollagen synthesis and degradation in vitro, Biochim. Biophys. Acta 1091 (1991) 231––235. [9] X. Li, A. Ponten, K. Aase, et al., PDGF-C is a new protease-activated ligand for the PDGF alpha-receptor, Nat. Cell Biol. 2 (5) (2000) 302–309. [10] A. Ponten, X. Li, P. Thoren, et al., Transgenic overexpression of platelet-derived growth factor-C in the mouse heart induces cardiac fibrosis, hypertrophy, and dilated cardiomyopathy, Am. J. Pathol. 163 (2003) 673–682. [11] S.H. Han, Y.H. Kim, I. Mook-Jung, RAGE: the beneficial and deleterious effects by diverse mechanisms of actions, Mol. Cells 31 (2011) 91–97. [12] H.J. Cho, S.M. Son, S.M. Jin, et al., RAGE regulates BACE1 and Ab generation via NFAT1 activation in Alzheimer's disease animal model, FASEB J. 23 (2009) 2639–2649. [13] F. Riuzzi, G. Sorci, R. Sagheddu, et al., HMGB1-RAGE regulates muscle satellite cell homeostasis via p38-MAPK- and myogenin-dependent repression of Pax7 transcription, J. Cell Sci. 125 (2012) 1440–1454. [14] V.S. Tapia, H.R. Mauricio, J. Larrain, JAK-STAT pathway activation in response to spinal cord injury in regenerative and non-regenerative stages of Xenopus laevis, Regeneration 4 (2017) 21–35. [15] T. Kisseleva, S. Bhattacharya, J. Braunstein, et al., Signaling through the JAK/ STAT pathway, recent advances and future challenges, Gene 285 (1–2) (2002) 1––24. [16] S. Wang, Q.C. Yang, S.Q. Yu, et al., Fibroblast growth factor 1 levels are elevated in newly diagnosed type 2 diabetes compared to normal glucose tolerance controls, Jpn. Endocr. Soc. 63 (4) (2016) 359–365. [17] S. Vernia, C.K. Julie, T. Barrett, et al., Fibroblast growth factor 21 mediates glycemic regulation by hepatic JNK, Cell Rep. 14 (2016) 2273–2280. [18] B.M. Owen, D.J. Mangelsdorf, S.A. Kliewer, Tiusse-specific actions of the metabolic hormones FGF15/19 and FGF21, Trends Endocrinol. Metab. 26 (2015) 22–29.
703
[19] Y.H. Yu, J.J. He, S.M. Li, et al., Fibroblast growth factor 21 (FGF21) inhibits macrophage-mediated inflammation by activating Nrf2 and suppressing the NF-kB signaling pathway, Int. Immunopharmacol. 38 (2016) 144–152. [20] W.T. Cong, J. Ling, H.S. Tian, et al., Proteomic study on the protective mechanism of fibroblast growth factor 21 to ischemia–reperfusion injury, Can. J. Physiol. Pharmacol. 91 (2013) 973–984. [21] Y. Yu, F. Bai, W. Wang, et al., Fibroblast growth factor 21 protects mouse brain against D-galactose induced aging via suppression of oxidative stress response and advanced glycation end products formation, Pharmacol. Biochem. Be. 133 (2015) 122–131. [22] P.F. Xu, Y.J. Zhang, Y.Y. Liu, et al., Fibroblast growth factor 21 attenuates hepatic fibrogenesis through TGF-b/smad2/3 and NF-kB signaling pathways, Toxicol. Appl. Pharmacol. 290 (2016) 43–53. [23] T. Inagaki, V.Y. Lin, R. Goetz, et al., Inhibition of growth hormone signaling by the fasting-induced hormone FGF21, Cell Metab. 8 (2008) 77–83. [24] J.M. Zahm, H. Kaplan, A.L. Herad, et al., Cell migration and proliferation during the in vitro wound repair of the respiratory epithelium, Cell Motil. Cytoskeleton 37 (1997) 33–43. [25] H. Kitsunal, Y. Makino, H. Sakagami, et al., High glucose induces plateletderived growth factor-C via carbohydrate response element-binding protein in glomerular mesangial cells, Physiol. Rep. 2016 4 (2016) e12730. [26] F. Floege, C.E. Eitner, Alpers a new look at platelet-derived growth factor in renal disease, J. Am. Soc. Nephrol. 19 (2008) 12–23. [27] J. Floege, F. Eitner, C.E. Alpers, A new look at platelet-derived growth factor in renal disease, J. Am. Soc. Nephrol. 19 (2008) 12–23. [28] T. Ostendorf, F. Eitner, J. Floege, The PDGF family in renal fibrosis, Pediatr. Nephrol. 27 (2012) 1041–1050. [29] J. Floege, E. Eng, B.A. Young, et al., Infusion of platelet-derived growth factor or basic fibroblast growth factor induces selective glomerular mesangial cell proliferation and matrix accumulation in rats, J. Clin. Invest. 92 (1993) 2952– 2962. [30] J.T. Allen, M.A. Spiteri, Growth factors in idiopathic pulmonary fibrosis: relative roles, Respir. Res. 3 (2002) 13. [31] N. Hamada, K. Kuwano, M. Yamada, et al., Anti-vascular endothelial growth factor gene therapy attenuates lung injury and fibrosis in mice, J. Immunol. 175 (2005) 1224–1231. [32] Y. Iro, J. Aten, R.J. Bende, et al., Expression of connective tissue growth factor in human renal fibrosis, Kidney Int. 53 (4) (1998) 853–861. [33] O.A. Gressner, A.M. Gressner, Connective tissue growth factor: a fibrogenic master switch in fibrotic liver diseases, Liver Int. 28 (8) (2008) 1065–1079. [34] R.P. Gao, D.K. Ball, B. Perbal, et al., Connective tissue growth factor induces cfos gene activation and cell proliferation through p44/42 MAP kinase in primary rat hepatic stellate cells, J. Hepatol. 40 (2004) 431–438. [35] F.F. Safadi, S.N. Popoff, R. Aswald, et al., Connective tissue growth factor (CTGF) acts as a downstream mediator of TGF-beta 1 to induce mesenchymal cell condensation, Cell Physiol. 210 (2007) 398–410. [36] J.K. Burgess, Q. Ge, M.H. Poniris, et al., Connective tissue growth factor and vascular endothelial growth factor from airway smooth muscle interact with the extracellular matrix, Am. J. Physiol. Lung Cell Mol. Physiol. 290 (1) (2006) 153–161. [37] P. Bornstein, E.H. Sage, Matricellular proteins: extracellular modulators of cell function, Curr. Opin. Cell Biol. 14 (2002) 608–616. [38] L.F. Lau, S.C. Lam, The CCN family of angiogenic regulators: the integrin connection, Exp. Cell Res. 248 (1999) 44–57. [39] K. Yoshida, H. Munakata, Connective tissue growth factor binds to fibronectin through the type I repeat modules and enhances the affinity of fibronectin to fibrin, Biochim. Biophys. Acta. General Subjects. 1770 (2007) 672–680. [40] F. Matsui, K.K. Meldrum, The role of the Janus kinase family/signal transducer and activator of transcription signaling pathway in fibrotic renal disease, J. Surg. Res. 178 (1) (2012) 339–345. [41] P.Y. Chuang, J.C. He, JAK/STAT signaling in renal diseases, Kidney Int. 78 (2010) 231–234. [42] M. Kuratsune, T. Masaki, T. Hirai, et al., Signal transducer and activator of transcription 3 involvement in the development of renal interstitial fibrosis after unilateral ureteral obstruction, Nephrology (Carlton) 12 (2007) 565– 571. [43] L. Blaas, J.W. Kornfeld, D. Schramek, et al., Disruption of the growth hormone— signal transducer and activator of transcription 5-insulinlike growth factor 1 axis severely aggravates liver fibrosis in a mouse model of cholestasis, Hepatology 51 (2010) 1319–1326. [44] L. Ma, S.G. Zhuang, The role of STAT 3 in tissue fibrosis, Curr. Chem. Biol. 5 (2011) 44–51. [45] J.E. Darnell, STATs and gene regulation, Science 277 (1997) 1630–1635. [46] J. Turkson, STAT proteins as novel targets for cancer drug discovery, Expert Opin. Ther. Targets 8 (2004) 409–422. [47] C. Mertens, J.E. Darnell, Snap shot JAK-STAT signaling, Cell 131 (3) (2007) 612. [48] K. Frazier, S. Williams, D. Kothapalli, et al., Stimulation of fibroblast cell growth, matrix production, and granulation tissue formation by connective tissue growth factor, J. Invest Dermatol. 107 (1996) 404–411. [49] X.Y. Zhang, J. Tang1, X.F. Zhi, et al., miR-874 functions as a tumor suppressor by inhibiting angiogenesis through STAT3/VEGF-a pathway in gastric cancer, Oncotarget 6 (3) (2015) 1605–1617. [50] L.M. Judd, K. Bredin, A. Kalantzis, et al., STAT3 activation regulates growth, inflammation, and vascularization in a mouse model of gastric tumorigenesis, Gastroenterology 131 (2006) 1073–1085.
704
S. Li et al. / Biomedicine & Pharmacotherapy 93 (2017) 695–704
[51] T. You, Y.H. Bi, J. li, et al., IL-17 induces reactive astrocytes and up-regulation of vascular endothelial growth factor (VEGF) through JAK/STAT signaling, Sci. Rep. 7 (2017) 41779. [52] M.Y. Pang1, L. Ma, R.J. Gong, et al., A novel STAT3 inhibitor S3I-201, attenuates renal interstitial fibroblast activation and interstitial fibrosis in obstructive nephropathy, Kidney Int. 78 (2010) 257–268.
[53] A. Hosui, A. Kimura, D. Yamaji, et al., Loss of STAT5 causes liver fibrosis and cancer development through increased TGF-b and STAT3 activation, J. Exp. Med. 206 (4) (2009) 819–831.
Available online at
ScienceDirect www.sciencedirect.com
Original article
Fibroblast growth factor 21 ameliorates high glucose-induced fibrogenesis in mesangial cells through inhibiting STAT5 signaling pathway Shuai Lia , Xiaochen Guoa , Teng Zhanga , Nan Wanga , Junyan Lia , Pengfei Xua , Shengqi Zhanga , Guiping Rena,b , Deshan Lia,b,* a b
Bio-pharmaceutical Lab, Life Science College, Northeast Agricultural University, Harbin, 150030, PR China Key Laboratory of Agricultural Biological Functional Gene, Harbin, 150030, PR China
A R T I C L E I N F O
Article history: Received 21 April 2017 Received in revised form 12 June 2017 Accepted 29 June 2017 Keywords: Fibroblast growth factor 21 Human mesangial cells Extracelluar matrix Growth factors STAT5
A B S T R A C T
Fibroblast growth factor 21 (FGF21) is a member of the FGF family and acts as a potent regulator of glucose and lipid homeostasis, but its effect on renal fibrosis and the underlying mechanisms are totally unknown. The purpose of this study was designed to investigate whether FGF21 has effect on high glucose-induced fibrogenesis in human mesangial cells (HMCs) and the underlying mechanism. High glucose is well known to stimulate the expression of extracelluar matrix (ECM) in human mesangial cells. In humans, overexpression and deposition of ECM lead to renal fibrosis. Thus, in this study, HMCs were incubated in high glucose with or without various concentrations of FGF21. Results demonstrated that the expression of FN, Col, TGF b1 and a-SMA were significantly up-regulated in HMCs. Whereas, treatment with FGF21 down-regulated the expression of FN, Col, TGF b1 and a-SMA. In addition, growth factors are considered to be an important driving force for the pathogenesis of renal fibrosis. Significantly increased PDGF, VEGF and CTGF expression were found in HMCs induced by high glucose. FGF21 treatments significantly decreased these growth factors expression by down-regulating the phosphorylation level of STAT5. Here, we reported for the first time that FGF21 decreases ECM expression by inhibiting STAT5 signal pathway and consequently decreasing the expression of PDGF, VEGF and CTGF. © 2017 Elsevier Masson SAS. All rights reserved.
1. Introduction Renal fibrosis is the common final outcome of almost all progressive chronic kidney diseases (CKD) [1,2]. The progression of renal fibrosis is hallmarked by increased secretion of growth factors, infiltration of inflammatory cells, overexpression and deposition of a large amount of extracelluar matrix (ECM), which results in a sustained activation and proliferation of mesangial cells. Together, these changes constitute a core set of fibrogenic events and lead the destruction of kidney function [3,4]. Renal fibrosis is associated with mesangial cell proliferation and myofibroblastic activation. Both fibroblasts and myofibroblasts have the capacity to proliferate in response to cytokine cues, resulting in areas of fibroblastic foci which are thought to be the sites of active extracellular matrix synthesis, and are regarded to be
* Corresponding author at: College of Life Science, Northeast Agricultural University, 59 Mucai Street, Harbin, 150030, PR China. E-mail address: [email protected] (D. Li). http://dx.doi.org/10.1016/j.biopha.2017.06.100 0753-3322/© 2017 Elsevier Masson SAS. All rights reserved.
the leading edge of fibrosis [5]. Compelling evidences suggest that growth factors believed to be pivotal for the process include platelet derived growth factor (PDGF), vascular endothelial growth factor (VEGF) and connective tissue growth factor (CTGF). They are believed to be a critical mediator of fibrogenesis by exerting immunological actions, having direct effects on structural cells involved in the synthesis of ECM and affecting fibroblast proliferation and the differentiation of fibroblasts into myofibroblasts [6–8]. Studies in vivo and in vitro provided evidences that high glucose is shown to enhance glomerular mesangial cell proliferation and stimulated ECM synthesis and production of growth factors [5,9,10]. Recently, several factors including Ap-1, NFkB, SMAD, Nrf2 and STAT have been shown to regulate the transcription of cytokines, inflammatory enzymes, chemokines, matrix metalloproteinases, which further affect the cell proliferation, differentiation and migration [11–13]. Signal transducers and activators of transcription (STAT) is a seven member family that mediates celluar response to diverse cytokines. Once phosphorylated, STAT proteins have been translocated to the nucleus, they bind to the regulatory regions of target genes [14]. Of these family
696
S. Li et al. / Biomedicine & Pharmacotherapy 93 (2017) 695–704
members, STAT5 is expressed in several metabolically relevant tissues, including kidney, spleen and liver. The sustained activation of the STAT5 pathway in mesangial cells induced the expression of growth factors and ECM in response to stimulate by high glucose, suggesting that blocking STAT5 signaling pathway is related to ameliorate fibrogenesis [15]. Fibroblast growth factor 21 (FGF21), a member of the FGF superfamily, has recently emerged as a potent regulator of metabolism [16]. The effects of FGF21 have been mediated by stimulating fibroblast growth factor receptor (FGFR) together with the obligate co-receptor bklotho in its target organs, including adipose tissue, liver and kidney [17,18]. Moreover, increasing evidences demonstrated that FGF21 exerts the function of antioxidative, anti-inflammation and anti-fibrosis [19–22]. In vivo studies demonstrated that FGF21 treatment improves the histological changes and reduces ECM accumulation hepatic fibrogenic model. The mechanisms involved NFkB and TGF b/Smad 2/3 signaling pathway. However, the role of FGF21 in renal mesangial cells fibrogenesis has not been explored [22]. Therefore, in the present study, we investigated the role of FGF21 to contribute to high glucose induced mesangial cells fibrogenesis and the mechanism of its action. 2. Materials and methods 2.1. FGF21 preparation The recombinant pSUMO vector containing the murine FGF21 was transformed into Escherichia coli Rosetta for expression. Transformants containing the FGF21 gene were inoculated in LB medium with ampicillin (100 mg/mL) and grew at 37 C with shaking (150 rpm). When the OD600 reached 0.4–0.6, isopropylb-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.25 mmol/L. The culture was continued to grow for additional 5 h at 30 C in a shaking incubator at 80 rpm to induce the expression of FGF21 protein. FGF21 purified by affinity chromatograph using AKTA purifier (GE Healthcare). SDS-polyaerylamide electrophoresis (SDS-PAGE) analysis purified FGF21 protein revealed the presence of a single band. 2.2. Cell culture HMC cell lines were a gift from Prof. J. D. Jiao (Harbin Medical University). Our studies used HMCs cultured in RPMI 1640 medium (Gibco) containing 1m antibiotics (Penicillin-Streptomycin), 8 mM glucose and 10% fetal bovine serum (FBS) at 37 C in 5% CO2. HMCs grown in 6-well culture plates with serum-free media for 24 h to synchronize the cell growth, FGF21 was added into the medium in association with high glucose. The experiment contains five groups: control (treated with PBS), HG (30 mM glucose), HG + FL (10 nmol/L), HG + FM (100 nmol/L), HG + FH (1000 nmol/L). After 24 h of incubation, the cultures were washed twice with PBS and the cells were gathered for immunofluorescent, qPCR, ELISA and western blot analysis. 2.3. Immunofluorescent assay HMCs were cultured and grown as monolayers and fixed in 4% paraformaldehyde for 30 min at room temperature. Cells were incubated at 4 C with serum (10% in PBS) for 1 h. They were then incubated with monoclonal anti-collagen I (1:100, Abcam), antia-smooth muscle actin (a-SMA, 1:100, Abcam) and anti-TGF-b1 (1:100, Abcam) for 1 h at 37 C, and then washed and incubated in the dark for 30 min with FITC-conjugated rabbit anti-mouse antibody (BioLegend Inc., San Diego, CA, USA) followed by 4.6diamidino-2-phenylindole (DAPI) was performed to identity the
nucleus. After staining, the cells were assayed using a fluorescence microscope. 2.4. Real-time PCR Total RNA was isolated from treated cells with Trizol (Invitrogen, USA). Using the Reverse Transcription Kit (Promega USA), we reverse transcribed 1–2 ug of total RNA. The expression levels of genes were determined by quantitative PCR using SYBR Green Supermix (ABI 7500, Applied Biosystems, Carlsbad, CA, USA) The analysis was done using a CFX connect Real-time System (BioRad, USA). The b-actin RNA was amplified at the same time and used as an internal control. For both b-actin and samples, the paraments included a single cycle of 95 C for 10 min followed by 40 cycles of 95 C for 15 s and 61 C for 1 min. We calculated mRNA using a 244t relative to the average of target genes. 44t was obtained by subtracting the mean 4Ct of the control cells from the 4Ct of each sample. Table 1 shows the sequences of the primer pairs. 2.5. Enzyme-linked immunosorbent assays (ELISA) The protein levels of FN, Col I, TGF b1, a-SMA, PDGF, VEGF and CTGF in HMCs supernatants were measured using ELISA kit (R&D, systems, USA), according to the manufacturer’s instructions. Briefly, cells in 6-wells plates, were incubation with or without FGF21 and high glucose for 24 h, and then collected the supernatants from cell cultures. 2.6. Western blot analysis Nuclear and cytoplasmic proteins were prepared using the Nuclear and Cytoplasmic Protein Extraction Kit (Beyothme Institute of Biotechnology, Suzhou, China) according to the manufacturer’s instructions. The protein concentration was measured using the Pierce BCA Protein Assay Kit (Thermo, USA). We used 30ug total protein or 40 ug of nuclear protein on a SDSPAGE, and then transferred it to nitrocellulose membrane (GE Healthcare, USA). We then blocked with 5% skim milk in phosphate buffer saline (PBS) and probed with the following antibodies overnight at 4 C: anti-STAT (1:1000, Abcam), anti-pSTAT (1:1000, Abcam), anti-Lamin b1 (1:10,000, R&D, USA), and then followed by a horseradish peroxidase-conjugated secondary antibodies to rabbit IgG (1:7500, R&D, USA) 1 h at 37 C. Blots were visualized using an enhanced chemi-lumi nesencedetection kit (ECL; Thermo Scientific, USA).
Table 1 Sequences of Real-time PCR primers used in this study. Gene
Primer sequence
Col I F Col I R FN F FN R TGF-b1 F TGF-b1 R a-SMA F a-SMA R CTGF F CTGF R VEGF F VEGF R PDGF F PDGF R Lamin b1F Lamin b1 R
ATCAACCGGAGGAATTTCCGT CACCAGGACGACCAGGTTTTC GAGAATAAGCTGTACCATCGCAA CGACCACATAGGAAGTCCCAG CTAATGGTGGAAACCCACAACG TATCGCCAGGAATTGTTGCTG CTATGAGGGCTATGCCT GCTCAGCAGTAGTAACGAAGGA ACCGACTGGAAGACACGTTTG CCAGGTCAGCTTCGCAAGG AGGGCAGAATCATCACGAAGT AGGGTCTCGATTGGATGGCA GCAAGACCAGGACGGTCATTT GGCACTTGACACTGCTCGT CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT5
S. Li et al. / Biomedicine & Pharmacotherapy 93 (2017) 695–704
2.7. Wound healing assay HMCs were cultured in 6-well culture plates with RPMI 1640 media to confluence. A wound was made using a pipette tip and the culture medium was changed to fresh serum-free medium. Subsequently, the confluent cell layers were incubated with and without high glucose (30 mM) or different concentrations of FGF21 (10, 100, 1000 nmol/L) in a 5% CO2 high-humidity atmosphere at 37 C. Migration was measured for 24 h with a microscope. Images were analyzed with Image J. 2.8. Statistical analysis All data were statistically analyzed by SPSS 17.0 software. Data were expressed as mean SD, and analyzed by one-way analysis of
697
variance (ANOVA) followed by Student’s t-test for the determination of any significant differences. P values below 0.05 were considered statistically significant. 3. Results 3.1. FGF21 suppresses FN and COL I expression in HMCs under high glucose conditions In HMCs, the excessive deposition of ECM proteins, specifically fibronectin (FN) and Collagen Type I (Col I) overexpression, lead to acceleration of the pathological progress of renal fibrosis [4]. We question whether FGF21 mediates ECM expression in renal fibrosis. HMCs were incubated with high glucose together with different concentrations of FGF21 for 24 h. We analyzed the effects of FGF21
Fig. 1. FGF21 down-regulates the expression of fibronectin (FN) and Collagen Type I (Col l) in HMCs under high glucose condition (HG). HMCs were incubated in high glucose condition with or without different concentrations of FGF21 (low: FL; medium: FM and high: FH) for 24 h. The expression of FN mRNA (A) and protein (B), Col I mRNA (C) and protein (D) in HMCs were determined by Real-time PCR or ELISA. Col I expression in the HMCs was also examined by Immunofluorescent assay and co-stained with DAPI (E). The data were performed using one-way analysis of variance (ANOVA), followed by Student two-tail t-test. Data represent the mean SD (n = 6–10).*p < 0.05, **p < 0.01 and ***p < 0.001.
698
S. Li et al. / Biomedicine & Pharmacotherapy 93 (2017) 695–704
on expression and distribution of Col I and FN in HMCs under high glucose conditions. The results revealed that the mRNA expression levels of Col I and FN in HG group were up-regulated significantly compared with control group (p < 0.05). The mRNA expression levels of Col I and FN in HG+FGF21 groups were down-regulated significantly in a dose-dependent manner compared with HG groups (p < 0.001). Furthermore, the protein expression levels of FN and Col I were significantly up-regulated in HG group (P < 0.05) compared with control group. However, treatment with FGF21 blocked the protein expression levels of FN and Col I in a dosedependent manner compared with HG group (Fig. 1A–D). Immunofluorescence assays showed that Col I was expressed at high level in HG group compared with control group. But in FGF21 treatment groups, there were no significant changes compare with control group (Fig. 1E). These findings indicate that FGF21 mediates ECM homeostatic.
expression of TGF-b1 in HMCs. These cells were cultured in high glucose medium together with or without FGF21. As shown in Fig. 2A, the mRNA expression level of TGF-b1 significantly increased in HG group compared with control group (p < 0.05). However, treatment with FGF21 for 24 h blocked this increase significantly in a dose-dependent manner compared with HG group. In addition, we confirmed our Real-time data by ELISA and Immunofluorescence to evaluate the protein expression level of TGF-b1. Results showed that the protein expression level of TGFb1 in HG + FGF21 groups was significantly decreased compared with HG group (Fig. 2B–C). Notably, the expression of TGF-b1 is significantly decreases by FGF21 treatment in HMCs under high glucose conditions.
3.2. FGF21 suppresses TGF-b1 expression in HMCs under high glucose conditions
Previous studies showed that proliferation of HMCs was accompanied with phenotype change such as expression of a–SMA, which was a hallmark of phenotypic alteration. When mesangial cells are stimulated with high glucose, inactive mesangial cells can be transformed into proliferative mesangial cells and transdifferentiate. However, strong phenotype transdifferentiation leads to the production of large ECM in mesangial cells [5]. According to above findings, we investigate whether administration of FGF21 attenuates phenotype transdifferentiation. Fig. 3A showed that the mRNA expression level of a–SMA increased in HG group compared with control group (p < 0.001).
It suggests that TGF-b1 stimulates the synthesis and inhibits the degradation of ECM molecules, and promotes mesangial cell proliferation [8]. Moreover, TGF-b1 stimulates the expression of different types of collagen and fibronectin. These lead to the complex accumulation of ECM, resulting in glomerular fibrosis [22]. We have previously shown that FGF21 down-regulated the expression of FN and Col I in HMCs under high glucose conditions. Therefore, we further investigate whether FGF21 modulates the
3.3. FGF21 suppresses a-SMA expression in HMCs under high glucose conditions
Fig. 2. FGF21 down-regulates the expression of TGF-b in HMCs under high glucose condition (HG). HMCs were incubated in high glucose condition with or without different concentrations of FGF21 (low: FL; medium: FM and high: FH) for 24 h. The expression of TGF-b mRNA (A) and protein (B) in HMCs were determined by Real-time PCR or ELISA. TGF-b expression in the HMCs was also examined by Immunofluorescent assay and co-stained with DAPI (C) The data were performed using one-way analysis of variance (ANOVA), followed by Student two-tail t-test. Data represent the mean SD (n = 6–10).*p < 0.05, **p < 0.01 and ***p < 0.001.
S. Li et al. / Biomedicine & Pharmacotherapy 93 (2017) 695–704
699
Fig. 3. FGF21 down-regulates the expression of a-SMA in HMCs under high glucose condition (HG). HMCs were incubated in high glucose condition with or without different concentrations of FGF21 (low: FL; medium: FM and high: FH) for 24 h. The expression of a-SMA mRNA (A) and protein (B) in HMCs were determined by Real-time PCR or ELISA. a-SMA expression in the HMCs was also examined by Immunofluorescent assay and co-stained with DAPI (C) The data were performed using one-way analysis of variance (ANOVA), followed by Student two-tail t-test. Data represent the mean SD (n = 6–10).*p < 0.05, **p < 0.01 and ***p < 0.001.
Treatment with FG21 blocked this increase significantly in a dosedependent manner compared with HG group (p < 0.001). ELISA and Immunofluorescence results showed that the protein expression level of a–SMA was significantly up-regulated in HG group (P < 0.001) compared with control group. FGF21 treatment remarkably reduced the protein expression level of a–SMA in a dose-dependent manner compared with HG group (Fig. 3B–C). Taken together, these data demonstrate that FGF21 contributes to phenotypic alteration of HMCs under high glucose conditions. 3.4. PDGF, VEGF and CTGF are suppressed by FGF21 Recent studies showed that growth factors played key roles in fibrogenic changes in the kindey [6]. Growth factors are considered as important driving force for the pathogenesis of renal fibrosis. Some studies show that its likely involvement as one of the pathways stimulating the deposition of extracellular matrix around mesangial cells exposed to high glucose conditions [7– 9]. In this study, we found that FGF21 played a significant role in regulating of high glucose-induced fibrogenesis in HMCs. Therefore, we investigate the role of FGF21 reduced the expression of PDGF, VEGF and CTGF in high glucose culture. For this purpose, the expression of PDGF, VEGF and CTGF were evaluated by Real-time PCR and western blotting. Results showed that the mRNA and protein expression levels of PDGF, VEGF and CTGF were significantly increased in HG group compared with control group. In contrast, treatment with FGF21 for 24 h, the mRNA and protein expression levels of PDGF, VEGF and CTGF were decreased in a
dose-dependent manner compared with HG group (Fig. 4). Altogether, these data confirm the conclusion that reduced the expression of PDGF, VEGF and CTGF by treatment with FGF21. 3.5. FGF21 inhibits the expression of PDGF, VEGF and CTGF via STAT5 It is well known that STAT5 plays an important role in regulating of many critical functions in both normal and malignant human tissues, including differentiation and proliferation [14]. In addition, pSTAT5 induced cells response to the expression of growth factors [15]. Many evidences point that FGF21 inhibits STAT5 signaling pathway [23]. To elucidate the possible mechanisms that FGF-21 ameliorates high glucose-induced mesangial cells fibrogenesis, we examine the effects of FGF21 on STAT5 signaling pathway. As shown in Fig. 5, we detected the phosphorylation level of STAT5 significantly up-regulated in HG group compared with control group. FGF21 treatment downregulated the phosphorylation level of STAT5 in HG +FGF21 groups significantly compared with HG group. Notably, these data provide strong evidences that FGF21 plays an important role in downregulating the STAT5 signaling pathway. 3.6. Wound healing assay Wound healing assay is a classic and commonly used method for studying cell migration. They have been used with multiple cell types and, as the monolayers heal the wound in a characteristic manner, they have been used to study cell polarization, cell
700
S. Li et al. / Biomedicine & Pharmacotherapy 93 (2017) 695–704
Fig. 4. FGF21 down-regulates the expression of PDGF, VEGF and CTGF in HMCs under high glucose condition (HG). HMCs were incubated in high glucose condition with or without different concentrations of FGF21 (low: FL; medium: FM and high: FH) for 24 h. The expression of PDGF mRNA (A) and protein (B), VEGF mRNA (C) and protein (D), CTGF mRNA (E) and protein (F) in HMCs were determined by Real-time PCR or ELISA. The data were performed using one-way analysis of variance (ANOVA), followed by Student two-tail t-test. Data represent the mean SD (n = 6–10).*p < 0.05, **p < 0.01 and ***p < 0.001.
migration and numerous other processes [24]. To evaluate whether FGF21 is associated with cell migration, we used wound healing method. The results (Fig. 6) showed that the mean displacement area of HG group increased compared with control group. Treatment with FG21 (HG + FM and FH groups) blocked this increase significantly compared with HG group. But there were no significantly differences in HG + FL group compare with HG group. 4. Discussion FGF21 was previously shown to improve the histological changes and reduce ECM accumulation during hepatic fibrogenesis in vivo and in vitro [22]. Although the above studies affirm the preventive effect of FGF21 against hepatic fibrosis, it remains unknown whether FGF21 has the ability to ameliorate renal fibrosis. Using a high glucose-induced fibrogenic cell as the model, we found that the expression and deposition of extracellular
matrix were increased by high glucose, especially the collagen and fibronectin. During the process of fibrogenesis, HMCs were transited into myofibroblast-like cells characterized by expressing a-SMA. Further, under high glucose conditions, the expression of TGF-b increased in mesangial cells, which leads to the complex accumulation of ECM. Administration of FGF21 significantly decreased the expression of Col I, FN, a-SMA and TGF-b in high glucose-induced mesangial cells. These data demonstrate that FGF21 attenuates high glucose-induced mesangial cells fibrogenesis. Evidence indicates that the increased expression and deposition of ECM is closed associated with growth factors, which are believed to be pivotal for fibrotic process include PDGF, VEGF and CTGF [6,25]. Many studies show that PDGF plays an important role in inducing production of ECM components in mesangial cells [26]. The mesangial cells are major site of PDGF expression in the glomeruli. Knockdown of the PDGF gene reduce high glucose-
S. Li et al. / Biomedicine & Pharmacotherapy 93 (2017) 695–704
Fig. 5. FGF21 down-regulates the expression of total STAT5 and STAT5 phosphorylation levels in HMCs. HMCs were incubated with high glucose together with or without different concentrations of FGF21 for 24 h. (A) Western blot analysis of total STAT5 and STAT5 phosphorylation levels in the HMCs of each group. (B) The relative total STAT5 and STAT5 phosphorylation level content were expressed as the ratio pSTAT5/STAT5. The bands were analyzed with Image J. The data were performed using one-way analysis of variance (ANOVA), followed by Student two-tail t-test. Data represent the mean SD (n = 6–10).*p < 0.05, **p < 0.01 and ***p < 0.001 **p < 0.01 and ***p < 0.001.
induced deposition of collagen, suggesting that the PDGF is involved in fibrotic extracelluar matrix production in mesangial cells [27]. Mesangial cells express PDGF receptor. Using a PDGF receptor inhibitor, BIBF 1000, which diminishes high glucosemediated induction of PDGF downstream genes include extracellular matrix proteins [6]. This result indicates that a possible mechanism of extracellular matrix accumulation can be controlled via PDGF in mesangial cells [28]. Base on the above data, PDGF is an interesting target for future anti-fibrotic therapeutic approach. According to present knowledge, a down-modulation of PDGF activity may shift the ECM balance in anti-fibrosis process. Our results also confirmed previous observations that the expression of PDGF significantly increased by high glucose in HMCs [29]. Whereas treatment with FGF21 for 24 h, the mRNA and protein expression levels of PDGF decreased in a dose-dependent manner (Fig. 4). Another important fibrogenic mediator, VEGF, is an angiogenic factor. In a rat model of bleomycin-induced pulmonary fibrosis, the expression of VEGF increased in fibrotic lesions [30]. Chaudhary proved that VEGF receptor could be inhibited by a prototypical small molecule inhibitor to decrease fibrosis. These data suggest that an anti-VEGF approach may offer a suitable anti-fibrosis therapy [31]. Recent studies showed that VEGF induces expression of CTGF through TGF-b-dependent pathway, which is mediated via VEGF receptors. CTGF is a chemoattractant and mitogen for fibroblasts [32]. CTGF effects important cellular function, such as proliferative activity and ECM synthesis [33]. These effects are not only executed by CTGF alone, but also in combination with other growth factors or through direct interaction with ECM [34,35]. Some studies demonstrate that VEGF is able to anchor with ECM depends on the presence of CTGF. This supports the proposal that CTGF acts primarily as matrix-associated proteins that provide a bridge between structural proteins in the ECM and effector
701
molecules such as growth factors recruit to the matrix [36–38]. In the same study, an enhancing effect of CTGF on the binding of FN to fibrin was demonstrated [39]. In conclusion, CTGF contributes to the ECM accumulation in tissue fibrosis by promoting fibre-fibre, fibre-matrix and matrix- matrix interactions through direct molecular interactions with matrix components [33]. Thus, preventive and treatment strategies targeting the VEGF and CTGF pathway are reasonable antifibrotic options in renal fibrosis. Base on the above data, we revealed a role for FGF21 in regulating the expression of VEGF and CTGF in high glucose-induced mesangial cell fibrogenesis. Results showed that the expression of VEGF and CTGF were significantly increased by high glucose in HMCs. Under high glucose conditions, treatment with FGF21 in HMCs decreased VEGF and CTGF both at mRNA and protein levels in a dosedependent manner. All of the above indicate that FGF21 decreases growth factors expression in high glucose conditions, and further decrease the expression and deposition of ECM. However, the underlying mechanism how FGF21 affects the expression of growth factors is not clear. Therefore, we searched for the potential genes to regulate growth factors. Among the potential genes, we focused on STAT because of its known role as a regulator of many critical functions in the pathophysiology of renal fibrosis [40]. The STAT pathway is a key pathway that participates in cytokine signal transduction. Numerous cytokines, including growth factors, regulate the proliferation and differentiation of cells through the STAT pathway [41]. Several preclinical studies show that the inhibition of STAT signaling results in the attenuation of fibrosis in rodents, suggesting that drug-targeting of the STAT pathway may provide a useful therapeutic intervention in human fibrotic diseases including renal fibrosis [42]. In experimental models, inhibition of the STAT signaling pathway, particularly STAT5, reduces renal fibrosis and prevent deterioration of renal function [43]. STAT5 is a member of the STAT protein family which is latent cytoplasmic transcription factors that mediate normal cellular responses to cytokines, growth factors and other polypeptide ligands [44–46]. The STAT5 phosphorylation leads to the activity of STAT5 pathway, which causes its translocation to the nucleus to bind DNA regulatory sequences and induce expression of multiple genes, including growth factors [47]. VEGF is shown to induce kidney fibroblast proliferation and extracellular matrix synthesis [48] Effect of VEGF on fibroblast is found to be partially mediated by STAT5. Some studies demonstrate that STAT activation promotes VEGF expression and stimulates cells proliferation [49,50]. Previous study showed that knockdown of STAT3 or STAT5 significantly decreased VEGF expression at mRNA and protein levels [51]. STAT5 has been described for regulation growth factors such as VEGF. Thus, similar mechanisms of protein-protein interaction in renal fibrosis may also propose for PDGF and CTGF. For example, it is shown that CTGF in renal fibrosis may regulate the expression of matrix-integrin complex by STAT5 signal pathway [31,52]. A widely accepted paradigm in concepts of development of renal fibrosis is that TGFb up-regulation is a main factor responsible for fibrotic changes. TGF-b is found to induce expression of PDGF in various cell types including mesangial cells, PDGF may act as a role of downstream of TGF-b leading to fibrosis. The two potential STAT-binding sites in the promoter region of TGF-b and demonstrated that STAT activates the promoter activity in vitro [52]. Therefore, TGF-b transcription seems to be directly regulated by STAT. Another study uses a combination of immunoprecipitation (IP) and immunoblotting to explore the possibility of a physical interaction between STAT5 and TGF-b. Result show that the 94 N-terminal amino acids of STAT5 are critical for the interaction with TGF-b [53]. Alternatively and provoking, it may also hint to regulate PDGF expression by STAT5. These data provide strong evidences that activation of STAT signaling has been shown to play an important
702
S. Li et al. / Biomedicine & Pharmacotherapy 93 (2017) 695–704
Fig. 6. FGF21 effects the migratory ability of HMC. HMCs were grown to 100% confluency in 6-well culture plates. Wounds were made in confluent layers of growth-arrested cells using a fine pipette tip (A). Migration was monitored for 24 h for calculation of cellular displacement (mm) with or without FGF21 (B). The displacement is the distance between the positions of cells at the beginning and at the end of the experiment. Images were analyzed with Image J. The data were performed using one-way analysis of variance (ANOVA), followed by Student two-tail t-test. Data represent the mean SD (n = 6–10).*p < 0.05, **p < 0.01 and ***p < 0.001 **p < 0.01 and ***p < 0.001.
role in driving growth factors expression and the development of tissue fibrosis. In this study, our findings suggest that high glucose activate STAT5 pathway and promote the progression of renal fibrosis through increasing growth factors. Consequently, STAT5-
mediated expression of growth factors is inhibited, which would alleviate the development of renal fibrosis. Indeed, Treatment with FGF21 reduced STAT5 tyrosine phosphorylation and prevented the high glucose-induced production of growth factors in mesangial
S. Li et al. / Biomedicine & Pharmacotherapy 93 (2017) 695–704
cells. Therefore, STAT5 activity is necessary for the progression of renal fibrosis. Inhibition of STAT5 signaling with FGF21 may hold therapeutic potential for fibrotic kidney diseases. However, the regulation of growth factors in mesangial cell is quite complicated, and we cannot rule out the possibility that other signaling pathways to modulate PDGF, VEGF and CTGF expression. In summary, we show that the overactivity of STAT5 signal pathway in HMCs under high glucose conditions, which may explain the high expression of PDGF, VEGF and CTGF, the cell fibrogenesis and the expression of ECM components. Treatment with FGF21 inhibits the overactivity of the STAT5 signal pathway and thus decreased PDGF, VEGF and CTGF expression. Furthermore, the decreased expression of PDGF, VEGF and CTGF inhibit excessive deposition of ECM in high glucose-induced mesangial cells. Taken together, these results suggest that FGF21 ameliorates high glucose-induced fibrogenesis in mesangial cells. We propose that FGF21 may be a promising therapeutic approach to prevent the renal fibrosis. Acknowledgments This work was supported by Bio-pharmaceutical Lab, Life Science College, Northeast Agricultural University. We are grateful to Prof. J. D. Jiao (Harbin Medical University) for HMC cell lines gift to us. References [1] P.Y. Chuang, M.C. Menon, J.C. He, Molecular targets for treatment of kidney fibrosis, J. Mol. Med. (Berl). 91 (5) (2013) 549–559. [2] R.C. Harris, E.G. Neilson, Toward a unified theory of renal progression, Annu. Rev. Med. 57 (2016) 365–380. [3] J.M. Zheng, J.M. Zhu, L.S. Li, et al., Rhein reverses the diabetic phenotype of mesangial cells over-expressing the glucose transporter (Glut 1) by inhibiting the hexosamine pathway, Br. J. Pharmacol. 153 (2008) 1456–1464. [4] S.H. Ayo, R.A. Radnik, J.A. Garoni, et al., Increased extracellular matrix synthesis and mRNA in mesangial cells grown in high-glucose medium, Am. J. Physiol. 260 (2) (1991) 185–191. [5] H. Kitsunai, Y. Makino, H. Sakagami, et al., High glucose induces plateletderived growth factor-C via carbohydrate response element-binding protein in glomerular mesangial cells, Physiol. Rep. 4 (6) (2016) e12730. [6] N.I. Chaudhary, G.J. Roth, F. Hilberg, et al., Inhibition of PDGF: VEGF and FGF signaling attenuates fibrosis, Eur. Respir. J. 29 (2007) 976–985. [7] R.K. Coker, G.J. Laurent, S. Shahzeidi, et al., Transforming growth factors-beta 1, beta 2, and beta 3 stimulate fibroblast procollagen production in vitro but are differentially expressed during bleomycin-induced lung fibrosis, Am. J. Pathol. 150 (1997) 981–991. [8] R.J. McAnulty, J.S. Campa, A.D. Cambrey, et al., The effect of transforming growth factor beta on rates of procollagen synthesis and degradation in vitro, Biochim. Biophys. Acta 1091 (1991) 231––235. [9] X. Li, A. Ponten, K. Aase, et al., PDGF-C is a new protease-activated ligand for the PDGF alpha-receptor, Nat. Cell Biol. 2 (5) (2000) 302–309. [10] A. Ponten, X. Li, P. Thoren, et al., Transgenic overexpression of platelet-derived growth factor-C in the mouse heart induces cardiac fibrosis, hypertrophy, and dilated cardiomyopathy, Am. J. Pathol. 163 (2003) 673–682. [11] S.H. Han, Y.H. Kim, I. Mook-Jung, RAGE: the beneficial and deleterious effects by diverse mechanisms of actions, Mol. Cells 31 (2011) 91–97. [12] H.J. Cho, S.M. Son, S.M. Jin, et al., RAGE regulates BACE1 and Ab generation via NFAT1 activation in Alzheimer's disease animal model, FASEB J. 23 (2009) 2639–2649. [13] F. Riuzzi, G. Sorci, R. Sagheddu, et al., HMGB1-RAGE regulates muscle satellite cell homeostasis via p38-MAPK- and myogenin-dependent repression of Pax7 transcription, J. Cell Sci. 125 (2012) 1440–1454. [14] V.S. Tapia, H.R. Mauricio, J. Larrain, JAK-STAT pathway activation in response to spinal cord injury in regenerative and non-regenerative stages of Xenopus laevis, Regeneration 4 (2017) 21–35. [15] T. Kisseleva, S. Bhattacharya, J. Braunstein, et al., Signaling through the JAK/ STAT pathway, recent advances and future challenges, Gene 285 (1–2) (2002) 1––24. [16] S. Wang, Q.C. Yang, S.Q. Yu, et al., Fibroblast growth factor 1 levels are elevated in newly diagnosed type 2 diabetes compared to normal glucose tolerance controls, Jpn. Endocr. Soc. 63 (4) (2016) 359–365. [17] S. Vernia, C.K. Julie, T. Barrett, et al., Fibroblast growth factor 21 mediates glycemic regulation by hepatic JNK, Cell Rep. 14 (2016) 2273–2280. [18] B.M. Owen, D.J. Mangelsdorf, S.A. Kliewer, Tiusse-specific actions of the metabolic hormones FGF15/19 and FGF21, Trends Endocrinol. Metab. 26 (2015) 22–29.
703
[19] Y.H. Yu, J.J. He, S.M. Li, et al., Fibroblast growth factor 21 (FGF21) inhibits macrophage-mediated inflammation by activating Nrf2 and suppressing the NF-kB signaling pathway, Int. Immunopharmacol. 38 (2016) 144–152. [20] W.T. Cong, J. Ling, H.S. Tian, et al., Proteomic study on the protective mechanism of fibroblast growth factor 21 to ischemia–reperfusion injury, Can. J. Physiol. Pharmacol. 91 (2013) 973–984. [21] Y. Yu, F. Bai, W. Wang, et al., Fibroblast growth factor 21 protects mouse brain against D-galactose induced aging via suppression of oxidative stress response and advanced glycation end products formation, Pharmacol. Biochem. Be. 133 (2015) 122–131. [22] P.F. Xu, Y.J. Zhang, Y.Y. Liu, et al., Fibroblast growth factor 21 attenuates hepatic fibrogenesis through TGF-b/smad2/3 and NF-kB signaling pathways, Toxicol. Appl. Pharmacol. 290 (2016) 43–53. [23] T. Inagaki, V.Y. Lin, R. Goetz, et al., Inhibition of growth hormone signaling by the fasting-induced hormone FGF21, Cell Metab. 8 (2008) 77–83. [24] J.M. Zahm, H. Kaplan, A.L. Herad, et al., Cell migration and proliferation during the in vitro wound repair of the respiratory epithelium, Cell Motil. Cytoskeleton 37 (1997) 33–43. [25] H. Kitsunal, Y. Makino, H. Sakagami, et al., High glucose induces plateletderived growth factor-C via carbohydrate response element-binding protein in glomerular mesangial cells, Physiol. Rep. 2016 4 (2016) e12730. [26] F. Floege, C.E. Eitner, Alpers a new look at platelet-derived growth factor in renal disease, J. Am. Soc. Nephrol. 19 (2008) 12–23. [27] J. Floege, F. Eitner, C.E. Alpers, A new look at platelet-derived growth factor in renal disease, J. Am. Soc. Nephrol. 19 (2008) 12–23. [28] T. Ostendorf, F. Eitner, J. Floege, The PDGF family in renal fibrosis, Pediatr. Nephrol. 27 (2012) 1041–1050. [29] J. Floege, E. Eng, B.A. Young, et al., Infusion of platelet-derived growth factor or basic fibroblast growth factor induces selective glomerular mesangial cell proliferation and matrix accumulation in rats, J. Clin. Invest. 92 (1993) 2952– 2962. [30] J.T. Allen, M.A. Spiteri, Growth factors in idiopathic pulmonary fibrosis: relative roles, Respir. Res. 3 (2002) 13. [31] N. Hamada, K. Kuwano, M. Yamada, et al., Anti-vascular endothelial growth factor gene therapy attenuates lung injury and fibrosis in mice, J. Immunol. 175 (2005) 1224–1231. [32] Y. Iro, J. Aten, R.J. Bende, et al., Expression of connective tissue growth factor in human renal fibrosis, Kidney Int. 53 (4) (1998) 853–861. [33] O.A. Gressner, A.M. Gressner, Connective tissue growth factor: a fibrogenic master switch in fibrotic liver diseases, Liver Int. 28 (8) (2008) 1065–1079. [34] R.P. Gao, D.K. Ball, B. Perbal, et al., Connective tissue growth factor induces cfos gene activation and cell proliferation through p44/42 MAP kinase in primary rat hepatic stellate cells, J. Hepatol. 40 (2004) 431–438. [35] F.F. Safadi, S.N. Popoff, R. Aswald, et al., Connective tissue growth factor (CTGF) acts as a downstream mediator of TGF-beta 1 to induce mesenchymal cell condensation, Cell Physiol. 210 (2007) 398–410. [36] J.K. Burgess, Q. Ge, M.H. Poniris, et al., Connective tissue growth factor and vascular endothelial growth factor from airway smooth muscle interact with the extracellular matrix, Am. J. Physiol. Lung Cell Mol. Physiol. 290 (1) (2006) 153–161. [37] P. Bornstein, E.H. Sage, Matricellular proteins: extracellular modulators of cell function, Curr. Opin. Cell Biol. 14 (2002) 608–616. [38] L.F. Lau, S.C. Lam, The CCN family of angiogenic regulators: the integrin connection, Exp. Cell Res. 248 (1999) 44–57. [39] K. Yoshida, H. Munakata, Connective tissue growth factor binds to fibronectin through the type I repeat modules and enhances the affinity of fibronectin to fibrin, Biochim. Biophys. Acta. General Subjects. 1770 (2007) 672–680. [40] F. Matsui, K.K. Meldrum, The role of the Janus kinase family/signal transducer and activator of transcription signaling pathway in fibrotic renal disease, J. Surg. Res. 178 (1) (2012) 339–345. [41] P.Y. Chuang, J.C. He, JAK/STAT signaling in renal diseases, Kidney Int. 78 (2010) 231–234. [42] M. Kuratsune, T. Masaki, T. Hirai, et al., Signal transducer and activator of transcription 3 involvement in the development of renal interstitial fibrosis after unilateral ureteral obstruction, Nephrology (Carlton) 12 (2007) 565– 571. [43] L. Blaas, J.W. Kornfeld, D. Schramek, et al., Disruption of the growth hormone— signal transducer and activator of transcription 5-insulinlike growth factor 1 axis severely aggravates liver fibrosis in a mouse model of cholestasis, Hepatology 51 (2010) 1319–1326. [44] L. Ma, S.G. Zhuang, The role of STAT 3 in tissue fibrosis, Curr. Chem. Biol. 5 (2011) 44–51. [45] J.E. Darnell, STATs and gene regulation, Science 277 (1997) 1630–1635. [46] J. Turkson, STAT proteins as novel targets for cancer drug discovery, Expert Opin. Ther. Targets 8 (2004) 409–422. [47] C. Mertens, J.E. Darnell, Snap shot JAK-STAT signaling, Cell 131 (3) (2007) 612. [48] K. Frazier, S. Williams, D. Kothapalli, et al., Stimulation of fibroblast cell growth, matrix production, and granulation tissue formation by connective tissue growth factor, J. Invest Dermatol. 107 (1996) 404–411. [49] X.Y. Zhang, J. Tang1, X.F. Zhi, et al., miR-874 functions as a tumor suppressor by inhibiting angiogenesis through STAT3/VEGF-a pathway in gastric cancer, Oncotarget 6 (3) (2015) 1605–1617. [50] L.M. Judd, K. Bredin, A. Kalantzis, et al., STAT3 activation regulates growth, inflammation, and vascularization in a mouse model of gastric tumorigenesis, Gastroenterology 131 (2006) 1073–1085.
704
S. Li et al. / Biomedicine & Pharmacotherapy 93 (2017) 695–704
[51] T. You, Y.H. Bi, J. li, et al., IL-17 induces reactive astrocytes and up-regulation of vascular endothelial growth factor (VEGF) through JAK/STAT signaling, Sci. Rep. 7 (2017) 41779. [52] M.Y. Pang1, L. Ma, R.J. Gong, et al., A novel STAT3 inhibitor S3I-201, attenuates renal interstitial fibroblast activation and interstitial fibrosis in obstructive nephropathy, Kidney Int. 78 (2010) 257–268.
[53] A. Hosui, A. Kimura, D. Yamaji, et al., Loss of STAT5 causes liver fibrosis and cancer development through increased TGF-b and STAT3 activation, J. Exp. Med. 206 (4) (2009) 819–831.