AP-1 pathway to promote pancreatic stellate cell activation

Journal Pre-proof Fibromodulin is up-regulated by oxidative stress through MAPK/AP-1 pathway to promote PSCs activation Wei An, Jian-wei Zhu, Fei Jiang, Jiu-long Zhao, Mu-yun Liu, Gui-xiang Li, Xin-gang Shi, Hui Jiang, Chang Sun, Zhao-shen Li PII:

S1424-3903(19)30732-X

DOI:

https://doi.org/10.1016/j.pan.2019.09.011

Reference:

PAN 1096

To appear in:

Pancreatology

Received Date: 9 July 2019 Revised Date:

15 September 2019

Accepted Date: 25 September 2019

Please cite this article as: An W, Zhu J-w, Jiang F, Zhao J-l, Liu M-y, Li G-x, Shi X-g, Jiang H, Sun C, Li Z-s, Fibromodulin is up-regulated by oxidative stress through MAPK/AP-1 pathway to promote PSCs activation, Pancreatology (2019), doi: https://doi.org/10.1016/j.pan.2019.09.011. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier B.V. on behalf of IAP and EPC.

Fibromodulin is up-regulated by oxidative stress through MAPK/AP-1 pathway to promote PSCs activation Wei An1#, Jian-wei Zhu1#, Fei Jiang1, Jiu-long Zhao1, Mu-yun Liu1, Gui-xiang Li1, Xin-gang Shi1, Hui Jiang2, Chang Sun1*, Zhao-shen Li1* 1

Department of Gastroenterology, Changhai Hospital of Second Military Medical University, 168

Changhai Road, Shanghai 200433, China 2

Department of Pathology, Changhai Hospital of Second Military Medical University, 168 Changhai

Road, Shanghai 200433, China Co-first authors#: Wei An and Jian-wei Zhu contributed equally to this work. Co-Corresponding authors*: Chang Sun, Tel: +86-2131161345, e-mail: [email protected]. Zhao-shen Li, Tel: +86-2181873241, e-mail: zhaoshen [email protected]. Authors’ Disclosures of Potential Conflicts of Interest: The authors indicated no potential conflicts of interest. Grant Support: This study was supported by the National Nature Science Foundations of China (Grant 81400669 to Wei An, Grant 81470885 to Chang Sun). Scientific Research Project of Shanghai Municipal Commission of Health and Family Planning (20144Y0255). Author Involvement: Conception and design of the study: Wei An; Jian-wei Zhu; Chang Sun; Zhao-shen Li. Generation, collection, assembly, analysis and/or interpretation of data: Wei An, Jian-wei Zhu, Fei Jiang, Jiu-long Zhao, Mu-yun Liu, Gui-xiang Li, Xin-gang Shi, Hui Jiang, Chang Sun, Zhao-shen Li Drafting or revision of the manuscript: Wei An; Jian-wei Zhu; Chang Sun; Zhao-shen Li. Approval of the final version of the manuscript: Wei An, Jian-wei Zhu, Fei Jiang, Jiu-long Zhao, Mu-yun Liu, Gui-xiang Li, Xin-gang Shi, Hui Jiang, Chang Sun, Zhao-shen Li Word count: 4414

Abstract: Background and Objectives: The pathogenesis of chronic pancreatitis(CP) is unknown, and the expression of fibromodulin( FMOD) in CP tissues and the effect on the function of pancreatic stellate cells (PSCs) has been seldom studied. Our aim was to investigate the role of FMOD contributes to the pathogenesis of fibrosis by regulating the fibrogenic phenotype of PSCs and the underlying molecular mechanism related to FMOD expression in PSCs. Methods: We investigated the expression of FMOD in pancreatic tissue and correlation between FMOD expression and fibrosis in patients with CP and the CP rat models. And then, we verified the effects of FMOD was involved in the oxidative stress (OS) by in vitro experiments. Results: Drastically higher expression of FMOD was observed in fibrosis tissue of CP patients and rat models compared with controls. Transfection of PSCs with an adenovirus that expressed FMOD increased expression of collagen I (col-I) and α–smooth muscle actin (a-SMA). Up-regulation of FMOD expression promoted proliferation, and migration of PSCs, contributing to their profibrogenic activity. FMOD was sensitive to reactive oxygen species, and its expression increased by incubated with MND. Knockdown FMOD in PSCs abated the α-SMA expression caused by MND. Mechanistically, OS donor increased FMOD production through JNK and ERK signaling pathway. Activator protein-1 bound to the FMOD promoter and transcriptionally regulated FMOD expression in PSCs. Conclusion: FMOD levels are up-regulated in fibrosis tissue of CP and is a critical downstream mediator of OS. It could induce PSCs activation and maintain the fibrosis phenotype of PSCs. Key words: Fibromodulin, oxidative stress, MAPK\Activator protein-1, pancreatic stellate cells, Chronic pancreatitis

Introduction: Chronic pancreatitis (CP) is a progressive inflammatory disease with pancreatic parenchyma destruction, inflammatory cell infiltration and extensive fibrosis, accompanied by pancreatic exocrine and endocrine dysfunction[1]. The current treatments for CP are unsatisfactory, which are just to relieve symptoms or therapy complications[2, 3]. Therefore, understanding the pathogenesis of CP may identify therapeutic targets to prevent its onset, slow its progression, or help its resolution. Recent findings implicate that the activation of pancreatic stellate cells (PSCs) has played a key role in the initiation and progression of CP[4]. Several studies have shown that it is the activated PSCs that deposit collagen fibers and contribute to the progression of pancreatic fibrosis[5]. In addition, activated PSCs also can secrete chemokines and cytokines to further activate more PSCs through autocrine or paracrine manner, and it result in sustaining of inflammatory reactions and fibrosis[6, 7]. Oxidative stress (OS) is one of the most important factors to induce pancreatic fibrosis by activating PSCs [8-15], OS donors can activate PSCs, promote them to expression of α–smooth muscle actin (α-SMA) and collagen I (col-I), and enhance the migration and proliferation ability by activating the MAPK signaling pathway[16]. However, downstream mediators for the OS effects on the activation of PSCs and the increase in extracellular matrix (ECM) levels require further study. Fibromodulin (FMOD) is a small leucine-rich proteoglycan that regulates ECM organization and tissue repair[17]. Recently, studies showed that fibromodulin had a profound effect on fibrosis diseases[18-20]. FMOD was overexpressed in the liver and pulmonary samples with fibrosis[18,

19]

.

Up-regulation expression of FMOD promoted proliferation, migration, and invasion of hepatic stellate cells (HSC), and the expression of col-I and α–SMA were both increased[19]. Furthermore, the degree of liver fibrosis induced by CCl4 and bile duct ligation was significantly reduced in FMOD-deficient mice[19], and the level of Col-I also was decreased[18]. On the other hand, FMOD was sensitive to reactive oxygen species, OS donor could promote the expression of FMOD both in fibroblast cells and hepatic stellate cells[19, 21]. However, to date, there is no study to show the expression of FMOD in CP tissues, and little is known about its potential role in the activation of PSCs and the profibrogenic potential. In addition, whether FMOD is one of the downstream mediators for the OS effects on the activation of PSCs is unknown. Therefore, the aim of this study was to evaluate the expression of FMOD in fibrosis tissue of CP patients and animal models, and explore how FMOD regulates the PSCs the profibrogenic phenotype, a crucial event for pancreatic fibrosis. Additionally, by the analysis of

biological information software (TRANSFAC), FMOD promoter region contained activator protein-1 (AP-1) binding sites, which was the downstream transcription factor of the MAPK signaling pathway. Thus, we hypothesized that OS induced the expression of FMOD through MAPK/AP-1 signaling pathway, and up-regulation of FMOD expression could contribute to PSCs activation and col-I deposition, thus participating in the pathogenesis of pancreatic fibrosis.

Materials and Methods This experiment was approved by the Institutional Animal Use and Care Committee of The Second Military Medical University, Shanghai, China. Animals and CP Induction Twenty 6-week-old male Wistar rats weighing 180 to 200 g were obtained from the Animal Center of Second Military Medical University. Rats were provided with food and water ad libitum and kept in cages in a temperature- and humidity- controlled room with a 12-hour dark-light cycle for 1 week before the experiment. Dibutylin dichloride (DBTC) (Sigma-Aldrich, Chemie GmbH, Steinheim) was dissolved in 100% ethanol (Changshu Yangyuan Chemical Co China, Changshu, China) and mixed with glycerol (Amresco, Ohio), with the ethanol: glycerol volume ratio of 2:3 and the final DBTC concentration of 8 mg/ml. Then, DBTC at a dose of 8 mg/kg body weight was infused slowly into the tail vein of the rats, as Sparmann et al described(22). As controls, 10 rats were infused with the same volume of ethanol and glycerol mixture. All rats were monitored daily, and the bodyweight was measured weekly. The rats were killed by exsanguination under pentobarbital anesthesia (50 mg/kg, intraperitoneally) 4 weeks. The pancreas was removed for further analysis. Preparation of Pancreatic Specimens for Analyses The head of the pancreatic tissue taken from each rat was fixed in 10% formalin and embedded in paraffin, and then several 4-µm sections were cut for histological examinations, Sirius red staining and immunohistochemistry. The rest part of the pancreas was used for the extraction of protein for Western Blot analysis and the measurement of intrapancreatic content of malondialdehyde (MDA). Human Samples Human pancreatic tissue samples were obtained from 20 patients with CP who underwent pancreatic resection because of CP-related complications at the Changhai Hospital of Second Military Medical University (Shanghai, China). Histologically, CP was graded as moderate to severe in all the patients. Normal human pancreatic tissue samples were obtained through cancer paired adjacent normal pancreas tissue from 20 patients with pancreatic cancer (8 female patients, 12 male patients; median age 40 years [range 28 to 70]), who underwent pancreatic resection because of pancreatic cancer at the Changhai Hospital of Second Military Medical University (Shanghai, China). Histologically, these pancreases were normal.

In all cases, freshly removed tissue samples were fixed in paraformaldehyde solution in the operating room, maintained for 12 to 24 hours, and then paraffin-embedded for histologic analysis. Sirius Red Staining Fibrosis in the pancreas was measured by Sirius red stain kit (Abcam, Cambridge, UK), according to the manufacturer’s protocol. Quantification of the Sirius red stain was evaluated by Image J software. Immunohistochemistry (IHC) Immunohistochemistry Immunohistochemical staining of formalin-fixed paraffin-embedded (FFPE) tumor tissue was performed using antibody to FMOD (Abcam, Cambridge, UK; dilution 1:200), antibody to a-SMA (Abcam, Cambridge, UK; dilution 1:200). Briefly, after incubation with 2.5 % blocking serum, FFPE 4 µm thick sections were incubated with anti-FMOD, anti-a-SMA antibody at 4 ˚C overnight. Diaminobenzidine (DAKO Corp.) was used as chromogen, and Meyer’s hematoxylin was used for counterstaining. All procedures of immunohistochemical staining were performed by G-X. L. Immunostaining Grading and Score Staining was assessed by 3 separate observers (W. A., H. J., and G-X. L.). Expressions of FMOD and a-SMA were evaluated by a scoring method based on the extent of staining (percentage of positive tumor cells ranked on scale from 0 to 4) and the intensity of staining (ranked on scale from 0 to 3). The final results of extent score (E) × intensity score (I) for each ×200 magnification visual field were used as EI score (varying from 0 to 12), which was divided into 4 grades, representing negative (score 0–2), weak (score 3–5), moderate (score 6–8), and strong (score 9–12), respectively. Cell Culture Human Pancreatic Stellate Cell（HPaSteC）and 293T cell were purchased from Sciencell Researh Laboratories (Los Angeles, USA) and the Committee of Type Culture Collection of Chinese Academy of Sciences. Both of them were cultured according to the manufacturer’s protocol. Chemical stimulation Menadione (MND), which is a pro-oxidant, was obtained from Sangon Biotech (Shanghai, china). SB201290 (P38 MAPK inhibitor), U0126 (ERK inhibitor) and SP600125 (JNK inhibitor) were obtained from Cell Signaling Technology (MA, USA). we incubated PSCs in serum-free medium for 24 h before the addition of experimental reagents. MND was dissolved in dimethyl sulfoxide (DMSO), and was used at 50µM. In experiments involving, SB201290 (at 20µM), U0126(at 10µM) or

SP600125(at 25µM), these reagents were added at 30 min before the addition of MND. Construction of recombinant lentivirus and cell infection. FMOD overexpression and interferon expression lentiviral vectors were constructed in the pLX304-Blast-V5 and pHAVP3.1-sh-tGFP vectors, c-FMOD overexpression primer used were Fw:5'-GAGCTCTGCTATTGTATGCAGTGGACCTCCCTCC-3'; Rv:5'-CCGGTTAGCGCTAGCTCAGATCTCGATGAGGCTGG-3'.

FMOD

interferon

expression

primer used was 5'-AGGATGGACC ATGTGACAG-3'. The correct insertions of the cassettes were confirmed using direct sequencing. The recombinant plasmids (FMOD-O/E and sh-FMOD) were respectively transfected into 293T cells with Lipofectamine 2000 (Invitrogen, Carlsbad, USA), empty vectors were used as controls. After filtering the collected medium through 0.45 µm-filters, the virus was concentrated by centrifugation at 4,000 x g (Eppendorf, Hamburg, Germany) for 15 min followed by 2 min at 1,000 x g. The concentrated virus was stored at ‑80˚C and the titers of the lentiviral vectors were determined via dilution using fluorescence microscopy (IX71; Olympus, Tokyo, Japan). PSCs were plated at a density of 1x105 cells/well in six-well plates and incubated for 24 h at 37˚C and 5% CO2. A recombinant lentivirus in serum-free growth medium was added at a multiplicity of infection of 50 (sh-FMOD) or 20 (FMOD-O/E), and after incubation for a further 24 h, the serum-containing growth medium was added to the cells. The reporter gene expression was assessed by fluorescence microscopy 48 h after changing medium, or used for further experiments. RNA Extraction and Quantitative Real-time PCR Total RNA was extracted from the PSCs using Trizol reagent (Invitrogen) according to the manufacturer’s protocol. cDNA was synthesized by random primers and PrimeScript RT reagent Kit (Fermentas Madison, USA). Real-time quantitative PCR (RT-qPCR) was performed using SYBR-green Master Mix (Fermentas, Madison, USA) and run in a Light Cycler 480II instrument (Roche, Mannheim, Germany). Relative expression of genes was calculated using the 2-△△Ct method. The primers used were: h-FMOD Fw 5’- GTTCCCTCCCGCATGAAGTAT -3’ h-FMOD Rv 5’- TGGCATTGTCAAAGACGCCT -3’ α-SMA Fw 5’- CATGTACGTCGCCATTCAAGC -3’ α-SMA Rv 5’- TTGATGTCTCGCACAATTTCTCT -3’ Col-I Fw 5’- GTGACCTCAAGATGTGCCAC -3’

Col-I Rv 5’ - CTTGTCCTTGGGGTTCTTGC -3’ GAPDH Fw 5’- TGCACCACCAACTGCTTA -3’ GAPDH Rv 5’- GGCATGGACTGTGGTCATGAC -3’ Protein Extraction and Western Blotting Total protein was isolated from the cells at the exponential growth phase and the pancreatic tissues, the protein concentration was measured using a BCA Protein Assay Kit (Beyotime Biotecnology, Shanghai, China). Proteins were separated by a sodium dodecyl sulphate polyacrylamide gel (SDS-PAGE) and then transferred to a protein‐blotted polyvinylidene membranes (PVDF; Millipore, Billerica, MA, USA). The membranes were blocked with 5% skimmed milk for 2 hours and then incubated with their corresponding primary antibodies in a blocking buffer (5% skimmed milk) at 4˚C overnight. Membranes were then incubated with secondary antibody for 2 hours at room temperature. Proteins were then detected using Immobilon Western chemiluminescent HRP substrate (Pierce Biotechnology, Rockford, IL, USA) according to the manufacturer's instructions. GAPDH or Tubulin served as the control to verify that there was equal protein loading. Results were analyzed with Image J software. The primary antibodies information were: anti-FMOD (Abcam, Cambridge, UK; dilution 1:500), anti-α-SMA (Abcam, Cambridge, UK; dilution 1:500), anti-Col-I (Abcam, Cambridge, UK; dilution 1:500), anti-p38 (Cell Signaling Technology, MA, USA; dilution 1:1000), anti-p-p38 (Cell Signaling Technology, MA, USA; dilution 1:1000) , anti-JNK (Cell Signaling Technology, MA, USA; dilution 1:5000) , anti-pJNK (Cell Signaling Technology, MA, USA; dilution 1:5000) , anti-ERK(Cell Signaling Technology, MA, USA; dilution 1:5000), anti-p-ERK(Cell Signaling Technology, MA, USA; dilution 1:5000), anti-GAPDH (Abcam, Cambridge, UK; dilution 1:10000), anti- Tubulin (Abcam, Cambridge, UK; dilution 1:10000). Immunofluorescence To detect α-SMA expression and its cell localization in cell lines. Cells were seeded on glass slides coated by poly‐l‐lysine (Sigma‐Aldrich, MO, USA), 4% paraformaldehyde fixed 30 minutes blocked with 5% FBS for 30 minutes, then incubated with anti-α-SMA (Abcam, Cambridge, UK; dilution 1:200) primary antibodies at 37°C 2 hours. After three times washed with 0.1M PBS, cells were incubated with fluorescent secondary antibody at 37°C 1 hours. DAPI was used to stain nucleus for 5 minutes. Fluorescence microscope was then applied to capture images.

Cell Proliferative viability Assay Cell proliferation assays were performed using cell counting kit-8 (CCK-8, Dojindo, Kumamoto, Japan). After infection FMOD-O/E, Cells were seeded in 96-well plates at a density of 1×104 cells/well and cultured at 37°C for 24 hours. At further 12, 24, 48, and 72h, cells were incubated with CCK‐8 reagent (10µl) for 2 hours at 37°C, respectively. The absorbance was read at 450 nm using a microplate ELISA reader (SpectroMax 190; Molecular Devices, Sunnyvale, CA, USA). Cell Migration Assay Cell migration assay was conducted using an 8.0-µm Millicell-24 cell culture insert plate (353079, Millipore, Bedford, MA, USA). After infection FMOD-O/E 72h, Cells at a concentration of 1.0x105 cells/well were added to the upper compartment of the transwell insert and 500 µl medium, with 5% FBS as a chemoattractant, was added to the lower chamber and the plates were incubated at 37˚C for 48 h. Cells on the lower surface of the polycarbonate membrane were stained with hematoxylin (Biouniquer Technology Co.), and counted under a microscope (magnification, x100; Nikon, Tokyo, Japan). Cells were counted in five randomly selected fields and the assays were performed in triplicate. Luciferase reporter assay FMOD promoter (Fw 5’- CTTACGCGTGCTAGCAGCAGCCCCTCCT ACATGCT -3’, Rv 5’ATCGCAGATCTCGAGGGTCATGGCCCAGAT GTG GA -3’) was cloned into the pGL3-basic vectors

to

generate

luciferase

reporter

plasmid

(c-pGL3),

ACTGTCGGGATCAACATGACTGCAAAGATGGAAAC-3’,

and

AP-1 Rv

(Jun,

Fw

5’5’-

AACCACTTTGTACAATCAAAATGTTTGCAACTGCT -3’) was clone into the pLX304-Blast-V5 vectors to synthesize transcription factor expression plasmid (pLX304-AP1-V5), empty vectors were used as controls. All vectors were conducted by Asia-Vector Biotechnology (Shanghai, China). PSCs were seeded into 96‐well plates at a density of 1×104 cells/well, Once reaching a confluence of 80%, the cells were co-transfected with FMOD-promoter-pGL3, pLX304-AP1-V5 and the Renilla luciferase reporter vector (internal reference vector). The luciferase activities in the cells were detected using the dual luciferase assay system (Promega, Madison, USA) 48 hours after transfection, according to the manufacturer's protocol. Firefly luciferase activities were normalized to Renilla luciferase values, and expressed as relative luciferase units. Chromatin immunoprecipitation assay The chromatin immunoprecipitation (CHIP) assay was performed according to the instructions

provided with the CHIP assay kit (Sigma- Aldrich, MO, USA). Briefly, the chromatin was saved to act as the input control and remainder diluted in CHIP dilution buffer. The diluted chromatin was incubated with 10 µL anti-V5 antibody (Abcam, Cambridge, UK) or normal immunoglobulin G (IgG). Immunoprecipitated DNA or DNA from input were analyzed using PCR and RT‐qPCR, performed on a Light Cycler 480II instrument (Roche, Mannheim, Germany). The products were then separated by 2% agarose

gel

electrophoresis.

The

following

primers

were

used:

FMOD-promoter

F:

5′-ATCCTCCTGCCTCGGCCT-3′, and R: 5′- TTGTTTGAGAAGGAGT CTCAGC -3′. Statistical analysis Data were presented either as means ± standard deviation (SD) from one representative independent experiment of three with similar results. Categorical variables were evaluated using the chi-square or the Fisher’s exact tests, and continuous variables were analyzed using the Student’s t-test. In all of the tests, P values less than 0.05 were considered statistically significant. Statistical analyses were conducted using SPSS 19.0 software (IBM, Armonk, NY, USA).

Result： ： 1. Expression of FMOD increased in drug-induced CP in rats. To evaluate the expression of FMOD during the development of CP, we used DBTC injection to establish pancreatic fibrosis in vivo model. By the end of the experiment, the survival rates were 70% (7/10) in DBTC group and 100% (10/10) in control group. There was no difference in the body weight at baseline between the two groups. However, significant bodyweight reduction was observed in animals with DBTC induction compared with the controls at the second, third and fourth week (all P < 0.01; Sup.1). DBTC could leading to significant oxidant stress, the pancreatic tissue content of MDA was significantly increased in rats with DBTC induction compared with the controls (Sup. 2), and DBTC also induced significant histological changes in terms of the areas of abnormal architecture, glandular atrophy, inflammation and fibrosis (Fig. 1A). The expression of α-SMA was significantly increased in DBTC group compared with control group (Fig. 1B，D). As IHC analysis results showed that FMOD was mainly expressed in the cytoplasm of pancreatic duct cells, acinar cell and fibrotic tissues, and the expression of FMOD was significantly upregulated in DBTC group compared with the control group (Fig. 1C). FMOD protein expression in the DBTC model was also validated by Western blot analysis (Fig. 1D). 2. Correlation between FMOD expression and Sirius-red staining We used Sirius-red staining to evaluate pancreatic fibrosis. Sirius red staining showed a strong lobular and sub-lobular collagen deposition in DBTC rats, but it was attenuated in control rats, the areas of staining were respectively 0.46±0.07 and 0.08±0.03 (P<0.01; Fig. 2A). Expression of FMOD was positively correlated with the areas of Sirius-red staining (Spearman’s r =0.838, P<0.01; Fig. 2B). Thus, there was an association between FMOD protein up-regulation and pancreatic fibrosis in DBTC rats. 3. FMOD Activates and induces profibrogenic effects in PSCs Because FMOD protein was found induced in CP tissue and correlated with pancreatic fibrosis, we hypothesized that endogenous FMOD could enhance activation of PSCs and their profibrogenic potential. To show this, PSCs were infected with Lenti-GFP or Lenti-FMOD-O/E, Lentivirus infection

did not alter PSCs viability or phenotype (Fig. 3A). With the enhancement expression of FMOD, intracellular col-I and α-SMA, a marker of PSCs activation, were increased by FMOD-O/E compared with GFP infection in both mRNA and protein levels (Fig. 3B). Next, we investigated whether FMOD could play a role in regulating the profibrogenic phenotype of PSCs, which entails their proliferative and migrate potential. CCK-8 results showed that PSCs proliferation was identified to be significantly accelerated by FMOD-O/E infection compared with the GFP control (P<0.01; Fig. 3C). Migration ability also enhanced by 5-fold in FMOD-O/E group compared with the GFP group (Fig. 3D). Overall these results showed that overexpression intracellular FMOD could induce PSCs activation and regulate the profibrogenic behavior and phenotype of PSCs. 4. Oxidative Stress promotes PSCs activation through up-regulate FMOD expression Because OS donor is a crucial factor for induce PSCs activation[16, 23, 24], and it can upregulate FMOD expression in HSCs; thus, we intended to validated OS donor could promote PSCs activation through up-regulate FMOD expression. Firstly, PSCs were incubated with menadione (MND), and the expression of FMOD, α-SMA and col-Ⅰ was analyzed. PCR and WB results showed significant up-regulation of FMOD, α-SMA and col-Ⅰ expression in PSCs induced by MND (Fig. 4A). To determine the effect of FMOD on OS donor promoted PSCs activation, three FMOD-shRNAs were synthesized, and the best FMOD-shRNA (shFMOD) was selected for further study based on PCR and WB analysis results (Sup.3). Then, we investigated the expression of α-SMA and col-Ⅰ in PSCs induced by MND after infected with shFMOD. Knockdown of expression of FMOD could significantly abate the α-SMA and col-Ⅰ expression induced by MND both in mRNA and protein level (Fig.4B). Consistent results were obtained from immunofluorescence (Fig.4C). 5. Oxidative Stress induce FMOD up-regulation by MAPK signaling pathway To dissect whether MND could up-regulate FMOD expression through MAPK signaling pathways, the activation of MAPK signaling pathways of PSCs incubated with MND were analyzed by using WB. As shown in the (Fig. 5A), MND could up-regulate the expression of p-P38 MAPK, p-ERK and p-JNK in PSCs, indicating that MND could up-regulate FMOD expression of PSCs through MAPK signaling pathways. Then, the specific inhibitors of P38 MAPK(SB201290), ERK(U0126) and JNK(SP600125) were used respectively to block MND-induced FMOD expression in PSCs. WB analysis showed that U0126 and SP600125 attenuated the expression of FMOD induced by MND respectively, but no different was found between MND and MND + SB201290 group (Fig.5B), suggesting that ERK and

JNK signaling pathways may play an important role in MND-induced FMOD expression of PSCs. 6. Activator protein-1(AP-1) binds to the FMOD promotor In order to evaluate the role of AP-1, a transcription factor of JNK and ERK signaling pathways downstream, in FMOD expression of PSCs, FMOD-promoter-pGL3 and AP-1-O/E (pLX304-AP1-V5) were co-transfected in PSCs, empty vector (pLX304-blast-V5) as control. After 48 hours, the protein was extracted for luciferase assay. The results showed that the fluorescence intensity of AP-1-O/E group was significantly increased compared with control group (P<0.001; Fig. 6A). WB results also showed that the expression of FMOD protein was markedly upregulated in AP-1-O/E group compared with control group (P<0.001; Fig. 6B). Additionally, to confirm the transcriptional regulation of FMOD by AP-1, CHIP assay with qPCR was performed. As shown in Figure 6C, anti-V5-AP-1-O/E group binding significant more FMOD promoter than V5-control group (P<0.001). The CHIP results suggested that AP-1 could combine with FMOD promoter and transcriptionally regulated FMOD expression in PSCs. 7. Expression of FMOD increased in CP patients To identify the expression pattern of FMOD in CP pancreas specimens, we investigated FMOD expression in CP and normal tissue specimens using IHC. As shown in Figure 7A，FMOD protein expression in CP specimens was much higher than that in normal pancreas specimens. Normal pancreas specimens exhibited weak FMOD immunoreactivity, often colocalized in a few acinar cells. In contrast to the normal pancreas, CP specimens exhibited intense immunoreactivity for FMOD. Intense staining signals were primarily colocalized in the cytoplasm of pancreatic duct cells, acinar cell and fibrotic tissues. Next, we investigated the effect of altered expression of FMOD on the pancreatic fibrosis. We used Sirius-red staining to evaluate pancreatic fibrosis. Samples with higher level of FMOD expression also exhibited higher degrees of pancreatic fibrosis (Spearman’s r =0.68, P<0.0001; Fig. 7B)

Discussion: To our knowledge, this was the first report which discussed the relationship between expression of FMOD and CP pancreatic fibrosis, and investigated the potential role of FMOD on the profibrogenic phenotype of PSCs. In the previous researches, FMOD has been described in bleomycin-induced pulmonary fibrosis in rats[18], and Up-regulation expression of FMOD promoted proliferation, migration, and invasion of HSC, it could be considered as a new target to prevent the development and progression of liver fibrosis[19]. In our study, we found that the expression of FMOD was significantly increased both in CP patients and DBTC-induced CP rats’ pancreatic tissues. We also demonstrated that OS through MAPK/AP-1 to induce FMOD up-regulate, and the latter could drive PSCs activation and promote their profibrogenic potential. From the results above, we conclude that FMOD is a target of OS/MAPK/AP-1 regulatory pathway in PSCs, constituting a new signaling axis and promoting CP development and progression. FMOD was one of the small leucine-rich proteoglycans, mainly expressed in connective tissues, and it played important role in the process of collagen fibrillogenesis by modifying ECM environment[25, 26]. But recently researches showed that the expression of FMOD was elevated in a variety of fibrotic tissue, including liver, lung and kidney[19]. In this study, we got the similar results, that FMOD expression was up-regulated in pancreatic tissues in CP patients and DBTC-induced CP rats compared with controls. Further correlational analysis demonstrated that the expression of FMOD was positively associated with the areas of Sirius Red Staining. So, we speculated that FMOD was associated with pancreatic fibrosis. Activation of PSCs is a key step in the development of CP[27]. To evaluate the effects of FMOD on the PCSs profibrogenic phenotype, FMOD was induced by infecting PSCs with FMOD-O/E. The results showed that up-regulated FMOD expression induced in increasing the expression of a-SMA and col-Ⅰ, and caused an increase in PSCs proliferation and migration potential. Hence, the experimental data validated a potential role for FMOD in driving PSCs activation and participating in pancreatic fibrosis of CP. In addition, FMOD was an OS sensitive proteoglycan and reactive oxygen species (ROS) could

promote the expression of FMOD both in fibroblast cells and HSC[19, 21]，and FMOD gene transcription was also induced by UV irradiation[28]. As we know, Alcohol and cigarette smoking which are the key etiological factors implicated in CP are known to induce OS[29]. And ROS is an important factor which related to the occurrence and development of pancreatic fibrosis for CP[24, 30]. To date, there is limited information on the specific ROS-sensitive mediators secreted by PSCs, as well as the potential mechanisms by that these molecules modulate the fibrogenic response in PSCs. In DBTC-induced CP rats, besides pancreatic fibrosis was observed, OS was also triggered, and our test showed that the level of MDA (one of the most prevalent products during OS) and expression of FMOD in the CP group were increased compared with the control group. In vitro study, FMOD and α-SMA were both overexpressed in PSCs which incubated by MND. Thus, we supposed that FMOD might be a potential mediator of OS induced CP. In the following experiments, we verified that activation of PSCs induced by MND was inhibited by down-regulating FMOD expression. These results suggested that OS induced activation of PSCs dependent on FMOD expression. Furthermore, the molecular mechanism underlying the expression of FMOD induced by OS was also investigated in this study. The activation of MAP kinases is one of the most classical signaling pathways for cells responds to ROS stimulation. And Jaster.et.al study have proven that MAPK play a key role in the regulation of PSC activation and growth[31]. In this study, we also found OS can activate MAPK signaling pathway in human PSCs. In order to investigated OS whether induced FMOD through activate MAP kinases, the inhibitor of three classical of MAP kinases was used. We found that the expression of FMOD induced by OS was abated by suppressing ERK and JNK. These results identified that ERK and JNK involved in the expression of FMOD induced by OS. AP-1, a downstream transcription factor of the MAPK signaling pathway, is also one of the important factors for regulating PSCs activation[16]. Fitzner B. et.al[32] study showed the expression of AP-1 and the binding activity of DNA increased in the early stage of PSCs culture, and earlier than the expression of a-SMA expression in the activated PSCs. However, the potential target gene of AP-1 regulating PSCs activation is still rarely reported. Our current study for the first-time found that AP-1 could activate PSCs through promoting FMOD transcription by binding its promoter. First, overexpression of AP-1 upregulated the expression of FMOD at protein level. Second, AP-1 increased the activity of FMOD promoter. Third, AP-1 bound directly to the FMOD promoter. All these results

strongly supported that FMOD expression in PSCs was transcriptionally regulated by AP-1. Lastly, our study also had some limits. First, we found FMOD also expressed in pancreatic acinar and ductal epithelium cells, further study could evaluate weather FMOD convey paracrine-mediated signaling to activate PSCs, and the potential FMOD receptor or intracellular signaling in PSCs should be determined. Second, FMOD, as an important mediator of OS promoting pancreatic fibrosis, could be a potential target to prevent the development and progression of CP. And the potential therapeutic effects of FMOD should also be explored in animal models or FMOD−/− animal models. In conclusion, FMOD was overexpressed in pancreatic tissues in CP patients and DBTC-induced CP rats, and FMOD induced PSCs activation and promoted PSCs proliferation and migration. Additionally, the expression of FMOD in CP was transcriptionally activated by OS/MAPK/AP-1pathway. On the basis of above evidences, we identified that FMOD was an important mediator of OS promoting pancreatic fibrosis, hence, FMOD could be considered as a new target to prevent the development and progression of CP.

References 1.

Jagannath S, Garg PK. Novel and Experimental Therapies in Chronic Pancreatitis. Digestive

diseases and sciences. 2017;62:1751-61. 2.

Lew D, Afghani E, Pandol S. Chronic Pancreatitis: Current Status and Challenges for Prevention

and Treatment. Digestive diseases and sciences. 2017;62:1702-12. 3.

Kleeff J, Whitcomb DC, Shimosegawa T, Esposito I, Lerch MM, Gress T, et al. Chronic

pancreatitis. Nature reviews Disease primers. 2017;3:17060. 4.

Erkan M, Adler G, Apte MV, Bachem MG, Buchholz M, Detlefsen S, et al. StellaTUM: current

consensus and discussion on pancreatic stellate cell research. Gut. 2012;61:172-8. 5.

Xue R, Yang J, Wu J, Meng Q, Hao J. Coenzyme Q10 inhibits the activation of pancreatic stellate

cells through PI3K/AKT/mTOR signaling pathway. Oncotarget. 2017;8:92300-11. 6.

Masamune A, Watanabe T, Kikuta K, Shimosegawa T. Roles of pancreatic stellate cells in

pancreatic inflammation and fibrosis. Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association. 2009;7:S48-54. 7.

Komar HM, Serpa G, Kerscher C, Schwoegl E, Mace TA, Jin M, et al. Inhibition of Jak/STAT

signaling reduces the activation of pancreatic stellate cells in vitro and limits caerulein-induced chronic pancreatitis in vivo. Scientific reports. 2017;7:1787. 8.

Basso D, Panozzo MP, Fabris C, del Favero G, Meggiato T, Fogar P, et al. Oxygen derived free

radicals in patients with chronic pancreatic and other digestive diseases. Journal of clinical pathology. 1990;43:403-5. 9.

Schoenberg MH, Buchler M, Pietrzyk C, Uhl W, Birk D, Eisele S, et al. Lipid peroxidation and

glutathione metabolism in chronic pancreatitis. Pancreas. 1995;10:36-43. 10. Mathew P, Wyllie R, Van Lente F, Steffen RM, Kay MH. Antioxidants in hereditary pancreatitis. The American journal of gastroenterology. 1996;91:1558-62. 11. Hausmann DH, Porstmann T, Weber I, Hausmann S, Dummler W, Liebe S, et al. Cu/Zn-SOD in human pancreatic tissue and pancreatic juice. International journal of pancreatology : official journal of the International Association of Pancreatology. 1997;22:207-13. 12. Ganesh Pai C, Sreejayan, Rao MN. Evidence for oxidant stress in chronic pancreatitis. Indian journal of gastroenterology : official journal of the Indian Society of Gastroenterology. 1999;18:156-7. 13. Szuster-Ciesielska A, Daniluk J, Kandefer-Szerszen M. Oxidative stress in blood of patients with alcohol-related pancreatitis. Pancreas. 2001;22:261-6. 14. Szuster-Ciesielska A, Daniluk J, Kandefer-Szerszen M. Alcohol-related cirrhosis with pancreatitis. The role of oxidative stress in the progression of the disease. Archivum immunologiae et therapiae experimentalis. 2001;49:139-46. 15. Kodydkova J, Vavrova L, Stankova B, Macasek J, Krechler T, Zak A. Antioxidant status and oxidative stress markers in pancreatic cancer and chronic pancreatitis. Pancreas. 2013;42:614-21. 16. Masamune A, Kikuta K, Satoh M, Satoh A, Shimosegawa T. Alcohol activates activator protein-1

and mitogen-activated protein kinases in rat pancreatic stellate cells. The Journal of pharmacology and experimental therapeutics. 2002;302:36-42. 17. Oldberg A, Antonsson P, Lindblom K, Heinegard D. A collagen-binding 59-kd protein (fibromodulin) is structurally related to the small interstitial proteoglycans PG-S1 and PG-S2 (decorin). The EMBO journal. 1989;8:2601-4. 18. Venkatesan N, Ebihara T, Roughley PJ, Ludwig MS. Alterations in large and small proteoglycans in bleomycin-induced pulmonary fibrosis in rats. American journal of respiratory and critical care medicine. 2000;161:2066-73. 19. Mormone E, Lu Y, Ge X, Fiel MI, Nieto N. Fibromodulin, an oxidative stress-sensitive proteoglycan, regulates the fibrogenic response to liver injury in mice. Gastroenterology. 2012;142:612-21.e5. 20. Rydell-Tormanen K, Andreasson K, Hesselstrand R, Westergren-Thorsson G. Absence of fibromodulin affects matrix composition, collagen deposition and cell turnover in healthy and fibrotic lung parenchyma. Scientific reports. 2014;4:6383. 21. Iovine B, Nino M, Irace C, Bevilacqua MA, Monfrecola G. Ultraviolet B and A irradiation induces fibromodulin expression in human fibroblasts in vitro. Biochimie. 2009;91:364-72. 22. Sparmann G, Merkord J, Jaschke A, Nizze H, Jonas L, Lohr M, et al. Pancreatic fibrosis in experimental pancreatitis induced by dibutyltin dichloride. Gastroenterology. 1997;112:1664-72. 23. Kikuta K, Masamune A, Satoh M, Suzuki N, Satoh K, Shimosegawa T. Hydrogen peroxide activates activator protein-1 and mitogen-activated protein kinases in pancreatic stellate cells. Molecular and cellular biochemistry. 2006;291:11-20. 24. Tandon RK, Garg PK. Oxidative stress in chronic pancreatitis: pathophysiological relevance and management. Antioxidants & redox signaling. 2011;15:2757-66. 25. Al-Qattan MM, Al-Qattan AM. Fibromodulin: Structure, Physiological Functions, and an Emphasis on its Potential Clinical Applications in Various Diseases. Journal of the College of Physicians and Surgeons--Pakistan : JCPSP. 2018;28:783-90. 26. Jan AT, Lee EJ, Choi I. Fibromodulin: A regulatory molecule maintaining cellular architecture for normal cellular function. The international journal of biochemistry & cell biology. 2016;80:66-70. 27. Masamune A, Shimosegawa T. Signal transduction in pancreatic stellate cells. Journal of gastroenterology. 2009;44:249-60. 28. Bevilacqua MA, Iovine B, Zambrano N, D'Ambrosio C, Scaloni A, Russo T, et al. Fibromodulin gene transcription is induced by ultraviolet irradiation, and its regulation is impaired in senescent human fibroblasts. The Journal of biological chemistry. 2005;280:31809-17. 29. Bhardwaj P, Yadav RK. Chronic pancreatitis: role of oxidative stress and antioxidants. Free radical research. 2013;47:941-9. 30. Bopanna S, Nayak B, Prakash S, Shalimar, Mahapatra SJ, Garg PK. Increased oxidative stress and deficient antioxidant levels may be involved in the pathogenesis of idiopathic recurrent acute pancreatitis. Pancreatology : official journal of the International Association of Pancreatology (IAP) [et al]. 2017;17:529-33. 31. Jaster R, Sparmann G, Emmrich J, Liebe S. Extracellular signal regulated kinases are key mediators of mitogenic signals in rat pancreatic stellate cells. Gut. 2002;51:579-84. 32. Fitzner B, Sparmann G, Emmrich J, Liebe S, Jaster R. Involvement of AP-1 proteins in pancreatic stellate cell activation in vitro. International journal of colorectal disease. 2004;19:414-20.

Figure 1: Expression of FMOD in DBTC-induced CP tissue in rats. A, representative HE images shown histological changes in terms of the areas of abnormal architecture, glandular atrophy, inflammation and fibrosis of DBTC-induced CP tissue (a, abnormal architecture and glandular atrophy; b, Dilated pancreatic duct; c, inflammatory cell infiltration; d, vehicle control). B, IHC analysis of α-SMA expression in vehicle control and DBTC-induced CP tissue (a, CP tissue; b, vehicle control pancreatic tissue). C, IHC analysis of FMOD expression (a, vehicle control; b-d FMOD expression increased in pancreatic duct cells(b), acinar cell (c) and fibrotic tissues (d) of CP tissue). D, Western blot analysis of FMOD expression in VC and CP pancreatic tissue. CP: chronic pancreatitis; VC: vehicle control. Figure 2: Correlation between FMOD expression and Sirius-red staining. A, Sirius-red staining evaluate pancreatic fibrosis of VC and CP tissue. Representative images of VC and CP sections with Sirius-red staining are shown. B, assessment of the positive correlation between area with Sirius-red staining and FMOD expression in CP specimens using Pearson correlation coefficient analysis. Figure 3: FMOD activates and induces profibrogenic effects in PSCs. A, Lentivirus infection did not alter PSCs viability or phenotype. B, PCR and Western blot analysis of the effect of FMOD overexpression plasmids to PSCs activation. C, assessment of PSCs cell growth in vitro by cell counting kit-8 (CCK-8) at the indicated time points. D, Assessment of PSCs cell migrates by migration assay. Figure 4: Oxidative Stress promotes PSCs activation through up-regulate FMOD expression. A, PCR and Western blot analysis of the effect of MND to PSCs activation and FMOD expression after treatment with MND (50uM) for 24 hours. B, PCR and Western blot analysis the effect of FMOD-shRNA to MND-induced PSCs activation. C, immunofluorescence analysis the effect of FMOD-shRNA to MND-induced PSCs activation. Figure 5: Oxidative Stress induce FMOD up-regulation by MAPK pathway. A, Western blot analysis of the MAPK protein express after treatment with MND (50uM) for 30 minutes. B, Western blot analysis of the MAPK protein express after treatment with MND and inhibitor (10uM) for 30 minutes, respectively. Figure 6: AP-1 increase the FMOD promotor activity. A, Western blot analysis of FMOD expression after transfection with AP-1 overexpression plasmids. B, FMOD promoter reporters were transfected into PSCs cells in triplicate with AP-1 expression plasmids or control vectors for 24 hours. The FMOD promoter activity was then examined using a dual luciferase assay kit. The promoter activities of the treated groups relative to those of the control groups are shown. C, Results of ChIP-real-time PCR and ChIP-PCR assay conducted using chromatins isolated from PSCs. The PSCs cells were transfected with V5-AP-1 for 24 hours. A specific anti-V5 antibody was used, and normal IgG was used as a control. One percent of the total cell lysates was subjected to PCR before immunoprecipitation (input control). **P < 0.01, *** P < 0.001. Figure 7: Expression of FMOD in CP pancreas specimens. A, IHC analysis of FMOD expression (a,

normal pancreas specimens; b-d FMOD expression increased in acinar cell and pancreatic duct cells(b), pancreatic duct cells (c) and fibrotic tissues (d) of CP tissue). B, assessment of the positive correlation between area with Sirius-red staining and FMOD expression in CP specimens. Samples with higher level of FMOD expression also exhibited higher degrees of pancreatic fibrosis.

Sup.1: Weight growth curves between CP and VC group. CP: chronic pancreatitis; VC: vehicle control. Sup. 2: Analysis of MDA activity between vehicle control and CP pancreatic tissue. *p<0.05 Sup.3: verification of the efficiency of FMOD-shRNA in 293T and PSCs. A, PCR analysis of the effect of FMOD shRNA in 293T cells; B, Western blot analysis of the effect of FMOD shRNA3 in PSCS.