Fibronectin synthesis by human tubular epithelial cells in culture: Effects of PDGF and TGF-β on synthesis and splicing

Kidney International, Vol. 54 (1998), pp. 407– 415

Fibronectin synthesis by human tubular epithelial cells in culture: Effects of PDGF and TGF-b on synthesis and splicing ANTJE B¨ URGER, CHRISTOF WAGNER, CHRISTIANE VIEDT, BETTINA REIS, FRIEDERIKE HUG, and GERTRUD MARIA H¨ANSCH Institut fu ¨r Immunologie, Medizinische Klinik der Universita ¨t Heidelberg, Heidelberg; Carl-Ludwig-Institut fu ¨r Physiologie der Universita ¨t Leipzig, Leipzig; and Chirurgische Universita ¨tsklinik Freiburg, Freiburg, Germany

Fibronectin synthesis by human tubular epithelial cells in culture: Effects of PDGF and TGF-b on synthesis and splicing. Background. Enhanced synthesis of extracellular matrix proteins including fibronectin (FN) is associated with the development of sclerosis. In this context we studied FN synthesis by tubular epithelial cells in response to transforming growth factor-b (TGF-b) and platelet-derived growth factor (PDGF). Methods. FN protein synthesis by human tubular epithelial cells in culture (TEC) was measured by biosynthetic labeling and ELISA. Splicing of FN was assessed by RT-PCR and by Northern blotting. Results. Cultivated TEC synthesized and released FN, the majority of which was deposited as an unsoluble protein and a minor portion (10 to 15%) was released into the supernatant. TGF-b and, to a lesser degree, PDGF, up-regulated FN synthesis. All three FN splice variants (EDA, EDB, and IIICS) were produced. PDGF did not influence the splicing. TGF-b preferentially up-regulated the EDA splice variant, but had no effect on the splicing of the other domains. Conclusions. PDGF and TGF-b both up-regulate FN synthesis of TEC. TGF-b, but not PDGF, also changed the quality of the de novo synthesized FN, and thus has a different role in the development of sclerosis.

Accumulation of extracellular matrix proteins has been described in many inflammatory processes, including glomerulonephritis and interstitial nephritis [1– 4]. In addition to hypercellularity, most probably due to the influx of inflammatory cells and increased proliferation of local cells, deposits of matrix proteins contribute to the development of sclerosis and eventually to the loss of kidney function. Inflammatory cytokines, particularly transforming growth factor-b (TGF-b) [5, 6], generated during acute inflammation may initiate an excessive production of extracellular Key words: sclerosis, epithelial cells, extracellular matrix, glomerulonephritis, interstitial nephritis. Received for publication October 21, 1997 and in revised form February 13, 1998 Accepted for publication February 23, 1998

© 1998 by the International Society of Nephrology

matrix proteins concomitantly with a reduction of the proteolytic and collagenolytic enzymes [7–9]. Among the extracellular matrix proteins found in sclerotic areas is fibronectin, a non-collagenous protein that participates in wound healing and is also associated with the development of fibrosis [10, 11]. In various forms of chronic renal disease and in experimentally-induced tubular injury deposits of fibronectin are found in the interstitium, as well as along the tubular basement membrane [9, 12–15]. Interstitial fibroblasts and tubular epithelial cells are the most likely producers of fibronectin, an assumption supported by studies with primary tubular epithelial cells in culture [16, 17]. Fibronectin is a rather versatile protein. Though encoded by a single gene, due to alternative splicing and posttranslational modifications it may assume different forms and most probably also different functions [18, 19]. Three distinct splice sites have been identified, and are termed EDA, EDB and IIICS in humans, or EIIIA, EIIIB and V in rats. EDA and EDB are encoded by a single exon within the type III homology domain. They may be deleted from the mature protein independently of each other. Also, the IIICS region may be excluded, either partially or completely, giving rise to five variants. By combining different splice variants, at least 20 fibronectin isoforms may be generated. There is evidence that during development [18 –22], wound healing [23] or after malignant transformation of cells [24] different splice products are synthesized. Cytokines such as transforming growth factor-b (TGF-b) appear to affect splicing [25, 17]. Previously, we described that TGF-b up-regulated fibronectin synthesis of human tubular epithelial cells in culture and preferentially induced synthesis of the splice variant EDA [17]. These data are in good agreement with reports by others, who described a close correlation between TGF-b expression and EDA-FN deposition in experimentally-induced nephritides in rats [13, 26]. We now examined the effect of TGF-b on the other FN splice variants as well as the effect of the platelet-derived

407

408

Bu ¨rger et al: Fibronectin and sclerosis

growth factor, PDGF, another cytokine associated with chronic inflammation and sclerosis in the kidney [27, 28]. We found that: (1) tubular epithelial cells produce all FN splice variants; (2) TGF-b as well as PDGF up-regulated the FN synthesis; and (3) TGF-b, but not PDGF, affected the splicing of the EDA domain. METHODS Cultivation of human tubular epithelial cells Tubular epithelial cells (TEC) were prepared and characterized as previously described [17], essentially following the protocol of Trifillis, Regec and Trump [29]. In brief, tissue was obtained from patients undergoing nephrectomy due to renal carcinoma. Only histologically normal tumorfree tissue was used for the preparation. The fibrous capsule was removed and tissue from the outer cortex was cut into pieces of approximately 1 mm3. The tissue was treated with 230 U/ml collagenase (Sigma Mu ¨nchen, Germany) for 30 minutes at 37°C. TEC were isolated by sequential sieving procedures as discribed by Trifillis et al [29]. TEC were washed three times with DMEM (Gibco, Eggenstein, Germany) and then suspended in DMEM containing 10% fetal calf serum, 1% antibiotics, 0.1% insulin (5 mg/ml), 1% BME (all obtained from Gibco) in a concentration of 4 3 105 cells/ml. The cells were placed in a 24-well culture dish (NUNC GmbH, Wiesbaden-Biebrich Germany). After two days, the cells were rinsed with DMEM. Confluent cells were subcultivated and after removal with trypsin-EDTA 103 (Gibco) diluted 1:10 in phosphate-buffered salt solution (PBS) pH 7.4. The cells were passed every four days. All experiments were performed using cells of passages 3 to 4. TEC were identified by: (1) characteristic polygonal or cobblestone-shaped morphology; (2) expression of the surface antigens aminopeptidase M and angiotensinase A; and (3) expression of cytokeratin detected by indirect immunofluorescence. RNA extraction and hybridization TEC (106) were washed in 0.9% NaCl solution and RNA was extracted by acid guanidium isothiocyanate-phenolchloroform according to the method of Chomczynski and Sacchi [30]. The total amount of RNA was quantitated based on its absorption at 260 nm. Eight to ten mg of total RNA was electrophoresed in an 1% agarose gel with 2.2 M formaldehyde, transferred to nylon membranes (Gene Screen, Du Pont, Dreieich, Germany) by capillary blotting in 10 3 SSC (NaCl 1,5 M, sodium citrate 0,15 M, pH 7.0) and cross linked by UV illumination (UV Stratalinker; Stratagene, Heidelberg, Germany) at 254 nm for two minutes. After blotting, the filters were rinsed and prehybridized in Church buffer (sodium phosphate 0.25 M, pH 7.2, 5 mM EDTA and 7% SDS) [31] for two to four hours at 65°C. cDNA probes for fibronectin [32], the EDA alternatively spliced exon [17] and GAPDH (ATCC, Rockville, MD,

USA) were labeled using a random priming kit (Boehringer, Mannheim, Germany) strictly following the instructions given by the manufacturer. The labeled probe was added to the filters and hybridized overnight. After hybridization the membranes were washed in 2 3 SSC (0.15 M sodium chloride and 0.015 M sodium citrate adjusted to pH 7.0) with 1% SDS for 30 minutes at 65°C, followed by 0.2 3 SSC with 1% SDS at 65°C for 10 minutes twice. The filters were exposed to Kodak X-Omat at 270°C for different times, dependent on the signal intensity. After stripping they were rehybridized with GAPDH cDNA as housekeeping gene. Relative mRNA levels were determined by densitometric scanning (Computer 1D image analyzer; Pharmacia, Freiburg, Germany). Data were corrected for the respective GAPDH value. The relative increase in abundance of FN-mRNA was calculated as N-fold increase over the respective medium control, that is, TEC cultivated under similar culture conditions and for the same time but without addition of cytokines. Analysis of alternative splicing of fibronectin pre-mRNA by polymerase chain reaction Alternative splicing of fibronectin RNA was detected by reverse transcribed-polymerase chain reaction (RT-PCR) or radioactive PCR essentially as described in [33] with minor modifications. To detect EDA, primers corresponding to the EDA alternatively spliced exons (267 bp) were used as described [17]. Alternative splicing of the EDB region of fibronectin mRNA was detected by RT-PCR using primers flanking the EDB region (EDB1: 59CCCCTACAAACGGCCAGCAGGG 39 and EDB2 59GCCAGTTGGGGAATCAAGACCTG 39). Primers were synthesized according to the cDNA sequence, which generated two PCR products, one with 458 bp corresponding to the FN-EDB2 and one at 731 bp corresponding to FN-EDB1. To quantify the ratio between FN containing the EDB region, and FN without the EDB region, a radioactive RT-PCR was performed. Synthesis was carried out in a 20 ml reaction volume containing 2 mg of total RNA, 3.3 mM of a random primer, and 40 U M-MuLV reverse transcriptase (Boehringer). One microliter of the first strand cDNA synthesis mixture was added to the amplification reaction mix containing 20 mM dNTP, 2 mCi of [a32-P]-dCTP, 1 unit Taq DNA polymerase and 50 pmol of each primer in a final volume of 50 ml. Amplification was performed in a DNA thermocycler ¨ berlingen, Germany) as follows: initial (Perkin Elmer, U denaturation at 95°C for five minutes, 25 cycles of amplification (1 min at 95°C, 1 min at 70°C, 1 min at 73°C), and final extension at 73°C for five minutes. DNA fragments were analyzed by electrophoresis on 5% polyacrylamide gels. The gels were then dried under vacuum and exposed on Kodak X-Omat film. PCR products were quantitated by scintillation counting of excised bands. For each sample at

Bu ¨rger et al: Fibronectin and sclerosis

409

Control experiments with standard protein diluted in urea, however, showed no major differences when compared to tests done with the usual buffer system, suggesting that the data were reliable. Biosynthetic labeling

Fig. 1. Identification of fibronectin by biosynthetic labeling with [35S]methionine and SDS-PAGE and Western blotting: TEC were cultivated in the presence of [35S]-methionine for 24 hours. The cell supernatant (lane 3) and the cell lysates (lane 2) were absorbed to gelatin sepharose and after elution subjected to SDS-PAGE followed by autoradiography. The deposited extracellular matrix (lane 1) was solubilized with urea and then separated by SDS-PAGE. In parallel, a Western blot was performed with a polyclonal antibody to human FN (left lane).

least three independent RT-PCR reactions were carried out. To analyze the IIICS region a PCR with primer pairs flanking the region was performed (PCS1: 59 TTTAAAGCCTGATTCAGACATTCG 39; PCS2: 59 GGGAACCGAATATACAATTTATGTC 39) cDNA synthesis and the amplification were done as described above except that only 5 pmol of each primer were used at an annealing temperature of 40°C. To distinguish between the V95 and the V89 variant a PCR with one primer flanking the respective region and one internal primer was performed (PCS4 59 TAGTCTACATCTTCCCTGGG 39; PCS3 59 TTCCCCAACTGGTAACCCTT 39) [33]. FN protein synthesis was either measured by ELISA or by biosynthetic labeling. For the ELISA a commercially available kit (TaKaRa; Dianova, Hamburg, Germany) was used. Cell free supernatants, cell lysates and urea-solubilized extracellular matrix (the latter diluted 1:10 in PBS) were stored at 220°C before use and applied in a volume of 20 ml. One concern was that the solubilization of the deposited fibronectin by urea may cause a denaturation of fibronectin, thereby changing its reactivity with the antibodies; on the other hand, the remaining urea might also affect the antibodies in the ELISA, thereby modifying the results.

Protein synthesis was quantitated by biosynthetic labeling with [35S]-methionine. Cells of passages 3 to 4 were washed with DMEM without additives and incubated with 0.5 ml medium at 37°C, using UltroserTM (2%) as the FCS substitute. After adding the respective stimuli, medium containing 100 mCi/ml [35S]-methionine (1000 Ci/mmol; Du Pont, Dreieich, Germany) was added. After either 24, 48 or 72 hours, the cell supernatants were removed, the remaining cells were washed and lysed with cold cell-lysis buffer (PBS, 0.01 M EDTA, 0.001 M PMSF, 0,01% NaN3, 1 mg/ml CHAPS). Cell supernatants and cell lysates were centrifuged at 10000 3g at 4°C for 15 minutes to remove cell debris. Then, the FN was isolated by adsorption to gelatinsepharose 4B (Pharmacia, Uppsala, Sweden) as described in [44]. In brief, 100 ml of the gelatin-sepharose suspension were added to each sample. Following incubation at 4°C with constant mixing overnight, the gelatin-sepharose beads were recovered by centrifugation. After washing three times with 0.15 NaCl containing 0.5% Triton X-100 and 25 mM Tris-HCl, pH 7.4, fibronectin was released by resuspending the beads in SDS-sample buffer and heating to 100°C for two minutes. Relased FN was identifed by Western blotting (see below). Fibronectin extraction from extracellular matrix After removal of the cell lysates, the matrix attached to the bottom of the wells was solubilized in 8 M urea, 50 mM Tris-HCl, pH 7.5. For Western blotting an SDS-sample buffer was added and the samples were boiled for two minutes. Protein content was estimated by the Lowry method. Western blotting Samples isolated from the cell supernatant or the celllysate, or the solubilized extracellular matrix were electrophoresed on 9% polyacrylamide gels and electroblotted onto nitrocellulose (0.45 mm; Schleicher & Schuell, Dassel, Germany) by dry-transfer. The nitrocellulose filter was incubated with 2% casein in TBS for two hours or overnight. To detect fibronectin, peroxidase conjugated sheep anti-human fibronectin and anti-sheep IgG (Binding-Site, Heidelberg, Germany) were used. After developing the substrate reaction, the filters were dried and exposed to Kodak X-Omat at 270°C for two to three days. The stained regions from the filters were cut out and the radioactivity was counted. [35S]-methionine incorporation into fibronectin was expressed as counts per minute, and used as an indicator of de novo fibronectin synthesis.

410

Bu ¨rger et al: Fibronectin and sclerosis

Fig. 2. TGF-b and PDGF in the supernatant of cultivated TEC. (A) TEC were cultivated for various times with (grey bar) or without (hollow bar) PDGF (1 ng/ml). Then PDGF (lower panel) or TGF-b (upper panel) was measured in the cell supernatant by ELISA. The values represent the mean of triplicates and are expressed as pg FN per ml supernatant. (B) TEC were cultivated for various times with TGF-b 2 ng (dark grey bar), TGF-b 0.2 ng (grey bar) or without TGFb (hollow bar). Again, PDGF (lower panel) or TGF-b (upper panel) were measured as described above. Note that the two experiments were done with different TEC, which might explain the differences in the spontaneous cytokine release.

Determination of PDGF and TGF-b PDGF and TGF-b were measured in cell-free supernatants with a commercially available ELISA-Kit (Quantikine; R&D Systems Europe, Abingdon, UK) and expressed in pg per ml supernatant of approximately 1 3 105 TEC. Statistical analysis Comparisons between means were made by using a two-population t-test.

RESULTS Tubular epithelial cells in culture synthesize large amounts of fibronectin (FN), which is partly released into the supernatant and partly is deposited onto the culture plates. Fibronectin was not found on the cell surface as measured by cytofluorometry (data not shown). To analyze the distribution of de novo synthesized FN, TEC were cultured in the presence of [35S]-methionine. After 24 hours, the supernatant was harvested and the cells were removed and lyzed. FN was isolated by absorption to

Bu ¨rger et al: Fibronectin and sclerosis

411

Table 1. Effect of TGF-b and of PDGF on FN mRNA measured as relative increase in abundance compared to unstimulated TEC TEC stimulated with FN mRNA EDA mRNA

TGF-b 1 ng/ml, 48 hr a

3.6 6 0.9 7.1 6 1.1a

PDGF 1 ng/ml, 2 hr 2.0 6 0.33a 1.0 6 0.24

Abbreviations are: TGF-b, transforming growth factor-Beta; PDGF, platelet-derived growth factor; FN, fibronectin; TEC, tubular epithelial cells.

gelatin-sepharose and subjected to SDS-PAGE. The deposited matrix was solubilized in 8 M urea. By SDS-PAGE combined with autoradiography and Western blotting, three major FN forms could be identified with apparent molecular weights of 200, 240 and 265 kD. The supernatant contained mainly the 265 kD FN, the lysate a major band at 200 kD, and there was a faint band at 265 kD (Fig. 1). The radioactivity associated with the FN bands was counted. From the experiment shown in Figure 1 and other similar experiments it was calculated that approximately 80% of the de novo synthesized FN appeared in the matrix; 10 to 15% were found in the cell supernatant, 5 to 10% in the cell lysate. By ELISA, the data could be confirmed: in one experiment with 1.5 3 105 TEC per well 50 ng FN was found in the supernatant, 27 ng in the cell lysate and 300 ng in the extracellular matrix (data are mean of triplicate experiments). Independent experiments gave essentially a similar distribution of FN; however, the absolute amounts of FN were rather variable. In another set of experiments the effects of TGF-b and PDGF on FN synthesis were tested. Both cytokines may also be produced by TEC. Under our culture conditions, PDGF was found in the cell supernatant, accumulating to up 400 pg per ml cell supernatant within 72 hours (a representative experiment is shown in Fig. 2). The addition of PDGF or TGF-b did not cause a considerable increase in PDGF synthesis (Fig. 2). Also, TGF-b was found in the cell supernatant, again accumulating with time in culture. Exogenously added PDGF did not increase TGF-b release; however, TGF-b itself caused an up to twofold increase of TGF-b, but only after 72 hours (Fig. 2). Consequently, autocrine or paracrine stimulation is not expected to obscure the effects of exogenously added PDGF or TGF-b. The rather delayed effect of TGF-b was also seen when FN synthesis was studied. Only after 24 to 48 hours exposure to TGF-b was the abundance of FN-specific mRNA increased (Table 1), whereas PDGF had already caused about a twofold increase at between two and four hours (Fig. 3). The different kinetics of the TGF-b- and PDGF-mediated effects were also seen when studying FN protein synthesis by biosynthetic labeling. TGF-b and to a lesser extent PDGF enhanced FN protein synthesis. After cultivation with TGF-b for 72 hours about threefold (3.4 6 0.95; mean of 3 independent experiments) more FN was

Fig. 3. Expression of FN mRNA in TEC after stimulation with PDGF. TEC were incubated for various times with (1) or without (2) PDGF (1 ng/ml). Then total RNA was isolated and Northern blots were performed with FN specific cDNA probe (upper panel), a cDNA specific for EDA (middle panel) and for comparison with GAPDH (lower panel).

found in the deposited matrix than in the matrix of untreated TEC; in the cell supernatant only a slight though statistically significant increase (6 40%) of FN was found. The effect of PDGF was less pronounced. At a maximum about 80% more FN was found in the matrix after 24 hours, while in the supernatant a minor increase of FN was seen only in some experiments. The findings could be confirmed by measuring FN by ELISA (Fig. 4). Next, the effects of TGF-b and of PDGF on the FN splicing was tested. Approximately 30% of the de novo synthesized FN contains EDA as determined by RT-PCR (Fig. 5). After stimulation with TGF-b, the portion of EDA-containing mRNA increased to about 45% of total FN, suggesting that TGF-b preferentially up-regulated EDA-containing FN. Stimulation of TEC with PDGF, though resulting in an increase of total FN mRNA, did not up-regulate the EDA splice variant (Figs. 3 and 5). Next, the presence of the EDB splice variant was tested. Since it is known from work by others that EDB is present only in small amounts, a PCR with radiolabeled dCTP and primers flanking the EDB region was performed. After separating the PCR products two bands were found, one corresponding to 458 bp and and one to 731 bp (Fig. 6). By cloning and sequencing the 458 bp PCR product was identified as FN lacking EDB, the 731 bp as the EDBcontaining form. From 10 independent experiments it was calculated that the latter amounted to approximately 5% of the total FN. To see whether stimulation of TEC with either PDGF or TGF-b affected the synthesis of EDB-FN, TEC were cultivated with PDGF for two hours or with TGF-b for 24 hours. Under neither condition did the intensity of the EDB-FN band increase relative to the EDB2-FN band. Next the IIICS region was analyzed by PCR using radiolabeled dCTP and primers flanking the respective domains. The majority of FN contained the splice variants

412

Bu ¨rger et al: Fibronectin and sclerosis

Fig. 4. Fibronectin synthesis by TEC after stimulation with TGF-b or with PDGF. TEC were cultivated in the absence (hollow bar) or presence of either TGF-b (0.2 ng/ml; grey bar) or PDGF (2 ng/ml; hatched bar) for various times. Then FN was measured in the cell supernatant (right panel) or in the solubilized deposited matrix proteins (left panel) by ELISA. The data are the mean of five replicates.

Fig. 5. Determination of the EDA splice variant in TEC. TEC were cultivated in medium with TGF-b (24 hr) or PDGF (2 hr), and then RNA was isolated and RT-PCR was performed with primers flanking the EDA coding region. The PCR products are separated on agarose gels and visualized by ethidium bromide staining (M size marker, - unstimulated TEC).

V89/V95, but also the full length IIICS region (V120) and FN lacking the CS1 and the CS5 regions (V64) were synthesized (Fig. 7). To distinguish between V95 and V89, a PCR was done using a 59primer within the CS1 region (PCS3) and a 39primer flanking the IIICS region (PCS1).

Fig. 6. Determination of the EDB splice variant in TEC. TEC were cultivated in medium, with TGF-b (24 hr) or PDGF (2 hr); then RNA was isolated and RT-PCR was performed with [32P]dCTP and primers flanking the EDB coding region. The PCR products are separated on polyacrylamide gels and visualized by autoradiography (- unstimulated TEC).

After separation on a 5% polyacrylamide gel, V120 and V89 could be identified (Fig. 7B). Amplification with another primer pair, the 59 primer binding outside IIICS (PCS2), the 39primer binding within the CS5 region (PCS4) again yielded two bands, one corresponding to V120 the other to V95 (Fig. 7). Taken together, the data indicate that TEC synthesize all IIICS splice variants.

Bu ¨rger et al: Fibronectin and sclerosis

413

Fig. 7. Analysis of the IIICS splice variants in TEC. The IIICS region contains three potential splice sites (schematically shown in A) giving rise to five different mRNA (shown as shaded bars). With use of primers flanking the IIICS region (PCS2 and PCS1) the five PCR products were obtained (B shows the autoradiography of 2 independent RT-PCR reactions). The relative percentage of the different PCR was calculated. V95 and V89 were separated using the two other primer pairs (PCS3/PCS1or PCS2/PCS4) (B right panel; ethidium bromide gels are shown). On lane M the DNA size markers were separated (from top: 2176, 1756, 1230, 1033, 653, 517, 453, 394, 298, 234, 154 bp). With use of the flanking primers (PCS2/PCS1) the band pattern of TEC, stimulated with PDGF (C), or TGF-b (D) for various times was analyzed (ethidium bromide agarose gels are shown).

To test the effect of TGF-b, the splice pattern was determined after stimulation for either 12 or 24 hours when the abundance of FN mRNA was high. No differences of the band pattern were apparent (Fig. 7D). Also, after stimulation with PDGF all PCR products were still present; in independent experiments the V120 and the V95/V89 appeared less intense when TEC were maximally stimulated (after 2 and 4 hr) as opposed to unstimulated cells. (one example is shown in Fig. 7C) DISCUSSION Human tubular epithelial cells in culture synthesize fibronectin, predominantly as a rather stable, water-insoluble deposit on the culture plate. After solubilization by urea and separation by SDS-PAGE three major protein bands with different apparent molecular sizes, 200, 240 and 265 kD, were found. The nature of these different fibronectins was not analyzed further. Most probably, the 240 kD and the 265 kD bands represent fibronectin post-transla-

tionally or even extracellularly modified, because there is only one form found intracellularly. A minor portion (10 to 15%) of the de novo synthesized fibronectin is released into the supernatant, also as a protein of larger size. Tubular epithelial cells produce all the three splice variants of FN, though FN containing EDB represents only a minor portion of total FN (6 5%). EDA is found in approximately 30% of the FN and also all variants of the IIICS region, including CS1, which encodes for the cellattachment region for VLA-4. In many cells including TEC splicing of FN is affected by cytokines [17]. In our experiments splicing at the EDB site appeared to be unaffected by either TGF-b or PDGF, as judged from the band patterns obtained by RT-PCR. All splice variants were still produced and no major differences were visible. Though not a quantitative method, important changes can be recognized by calculating the ratio between the different PCR products of the same sample [33]. TGF-b also did not affect splicing at the IIICS region.

414

Bu ¨rger et al: Fibronectin and sclerosis

When analyzing IIICS after stimulation with PDGF at the times of maximal stimulation (2 hr and 4 hr) the band pattern and the semiquantitative analysis point to a slight reduction of V120. Whether this reflects a different splicing (such as, loss of CS1 or CS5) is not known, because the ratio of V89 to 120 or of V95 to V120 could not be determined with sufficient accuracy by the method employed. Analyzing EDA splicing by the same method revealed that following TGF-b stimulation the portion of EDA cDNA increased from 30% of total FN to 45%, confirming the earlier data obtained by Northern blotting that TGF-b preferentially up-regulated the EDA-containing FN [17]. PDGF did not affect the splicing at the EDA site as tested by Northern blotting and RT-PCR as well. Like many other cells TEC synthesize PDGF and TGF-b, which are released and accumulate in the supernatant over time. In contrast to other cells, such as mesangial cells [34, 35], the release of cytokines was not enhanced by either TGF-b or PDGF in the current study. As suggested for PDGF, additional signals appear to be required for efficient TGF-b release [36]. These findings rule out the possibility that effects seen after stimulation with PDGF or with TGF-b might partly be due to secondarily induced cytokines. The conclusion that PDGF and TGF-b act independently of each other is supported by the differences seen between the TGF-b- and PDGF-mediated effects. TGF-b but not PDGF affect the splicing at the EDA site, while in PDGF-treated TEC the increase in abundance of FN mRNA occurred earlier and was more transient than in cells stimulated with TGF-b. TGF-b appeared also to be the more potent stimulator, particularly with regard to the induction of fibronectin protein synthesis. The different effects of TGF-b and PDGF on fibronectin synthesis correlate well with in vivo observations by others, and though both PDGF and TGF-b are thought to participate in the development of sclerosis, there are important differences. A constant presence of TGF-b, for example, induces fibronectin deposits and development of sclerosis, whereas PDGF induces hypercellularity, most probably by stimulating cell proliferation [27, 37]. Moreover, in experimentally-induced nephropathies, expression of PDGF differs from TGF-b with regard to the kinetics and the distribution in the tissue [38 – 41]. Moreover, the enhanced formation of the EDA-containing FN-splice variant in response to TGF-b has an in vivo correlate: in human disease as well as in experimentally-induced nephropathy TGF-b synthesis is associated with deposition of EDAcontaining fibronectin and the pathological accumulation of extracellular matrix [13, 26]. Whether the expression of EDA changes the properties of fibronectin in a way to favor matrix accumulation is not yet known, however, it appears to be an attractive hypothesis for further studies.

Reprint requests to Dr. Gertrud Maria Ha ¨nsch, Institut fu ¨r Immunologie, Ruprecht-Karls-Universita ¨t Heidelberg, Im Neuenheimer Feld 305, 69120 Heidelberg, Germany.

ACKNOWLEDGMENTS This work was supported by Grant Ha1129-1.

APPENDIX Abbreviations used in this article are: FN, fibronectin; PBS, phosphate buffered saline; PDGF, platelet-derived growth factor; RT-PCR, reverse transcribed-polymerase chain reaction; TEC, tubular epithelial cells; TGF-b, transforming growth factor beta.

REFERENCES 1. KLAHR S, SCHREINER G, ICHIKAWA I: The progression of renal disease. N Engl J Med 318:1657–1666, 1988 2. KUNCIO GS, NEILSON EG, HAVERTY T: Mechanisms of tubulointerstitial fibrosis. Kidney Int 39:550 –556, 1991 3. BOHLE A, GLOMB D, GRUND KE, MACKENSEN S: Correlation between relative interstitial volume of the renal cortex and serum creatinine concentration in minimal changes with nephrotic syndrome and in focal sclerotising glomerulonephritis. Virchows Arch 376:221–232, 1977 4. NATH KA: Tubulointerstitial changes as a major determinant in the progression of renal damage. Am J Kidney Dis 20:1–17, 1992 5. IGNOZ RA, MASSAGUE J: Transforming growth factor b stimulates the expression of fibronektin and collagen and their incorporation into the extracellular matrix. J Biol Chem 261:4337– 4345, 1986 6. BORDER WA, RUOSLAHTI E: Transforming growth factor b in disease: The dark side of tissue repair. J Clin Invest 90:1–7, 1992 7. ONG ACM, FINE LG: Loss of glomerular function and tubulointerstitial fibrosis: Cause and effect? Kidney Int 45:345–351, 1994 8. WOLF G, NEILSON EG: Molecular mechanisms of tubulointerstitial hypertrophy and hyperplasia. Kidney Int 39:401– 420, 1991 9. TANG WW, FENG L, XIA Y, WILSON CB: Extracellular matrix accumulation in immune-mediated tubulointerstitial injury. Kidney Int 45:1077–1084, 1994 10. CLARK RA, LANIGAN JM, DELLAPELLE P, MANSEAU E, DVORAK HF, CALVIN RB: Fibronectin and fibrin provide a provisional matrix for epidermal cell migration during wound reepitheliazation. J Invest Dermatol 79:264 –269, 1982 11. EDDY AA, GIACHELLI CM: Renal expression of genes that promote interstitial inflammation and fibrosis in rats with protein-overload proteinuria. Kidney Int 47:1546 –1557, 1995 12. SADY SP, GOYAL M, THOMAS PE, WHARRAM BL, WIGGINS RC: Fibronectin mRNA in the developing glomerular crescent in rabbit antiglomerular basement membrane disease. J Am Soc Nephrol 5:2087–2090, 1995 13. YAMAMOTO T, NOBLE NA, MILLER DE, BORDER WA: Sustained expression of TGF-b1 underlies development of progressive kidney fibrosis. Kidney Int 45:916 –927, 1994 14. SHARMA AK, MAUER SM, KIM Y, MICHAEL AF: Interstitial fibrosis in obstructive nephropathy. Kidney Int 44:774 –788, 1993 15. ABRASS CK, ADCOX MJ, RAUGI GJ: Aging-associated changes in renal extracellular matrix. Am J Pathol 146:742–752, 1995 16. BURTON CJ, COMBE C, WALLS J, HARRIS KPG: Fibronectin production by human tubular cells: The effect of apical protein. Kidney Int 50:760 –767, 1996 17. VIEDT CH, B¨ URGER A, H¨ ANSCH GM: Fibronectin synthesis in tubular epithelial cells: Up-regulation of the EDA splice variant by transforming growth factor b. Kidney Int 48:1810 –1817, 1995 18. OYAMA F, MURATA Y, SUGANUMA N, KIMURA T, TITA NI K, SEKIGUCHI K: Patterns of alternative splicing of fibronectin premRNA in human and fetal tissues. Biochemistry 28:1428 –1434, 1989 19. KORNBLIHTT AR, UMEZAWA K, VIBE-PETERSEN K, BARALLE FE: Primary structure of human fibronectin: Differential splicing may generate at least 10 polypeptides from a single gene. EMBO J 4:1755–1759, 1985

Bu ¨rger et al: Fibronectin and sclerosis 20. TAMKUN JM, SCHWARZBAUER JE, HYNES RO: A single rat fibronectin gene generates three different mRNAs by alternative splicing of a complex exon. PNAS 81:5140 –5144, 1984 21. SCHWARZBAUER JE, PATEL RS, FONDA D, HYNES RO: Multiple sites of alternative splicing of the rat fibronectin gene transcript. EMBO J 6:2573–2580, 1987 22. PAGANI F, ZAGATO L, VERGANI C, CASARI C, SIDO I, A, BARELLE FE: Tissue-specific splicing pattern of fibronectin messenger mRNA precursor during development and aging in rat. J Cell Biol 113:1223–1229, 1991 23. FRENCH-CONSTANT C, VAN DEN WATER L, DVRAK HF, HYNES RO: Reappearance of an embryonic pattern of fibronectin splicing during wound healing in the adult rat. J Cell Biol 109:903–914, 1989 24. CARNEMOLLA B, BALZA E, SIRI A, ZARDI L, NICOTRA MR, BIGOTTI A, NATALI PG: A tumor-associated fibronectin isoform generated by alternative splicing of messenger RNA precursors. J Cell Biol 108: 1139 –1148, 1989 25. BALZA E, BORSI L, ALLEMANNI G, ZARDI L: Transforming growth factor regulates the level of different fibronectin isoforms in human cultured fibroblasts. FEBS Lett 1:42– 44, 1988 26. YAMAMOTO T, NOBLE NA, COHEN AH, NAST CC, HISHIDA A, GOLD LI, BORDER W: Expression of transforming growth factor-beta isoform in human glomerular disease. Kidney Int 49:461– 469, 1996 27. ISAKA Y, FUJIWARA Y, UEDA N, KANEDA Y, KAMADA T, IMAI E: Glomerulosclerosis induced by in vivo transfection of transforming growth factor-beta or platelet-derived growth factor gene into the rat kidney. J Clin Invest 92:2597–2601, 1993 28. GESUALDO L, PINZANI M, FLORIANO J, HASSAN MO, NAGY MU, SCHENA FP, EMANCIPATOR SN, ABBOUD HE: Platelet-derived growth factor expression in mesangial proliferative glomerulonephritis. Lab Invest 65:160 –167, 1991 29. TRIFILLIS A, REGEC AL, TRUMP BF: Isolation, culture, and characterization of human renal tubular cells. J Urol 133:324 –329, 1985 30. CHOMCZYNSKI P, SACCHI N: Single-step method of RNA isolation by acid guanidinium-thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156 –159, 1987

415

31. THOMAS PS: Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc Natl Acad Sci USA 77:5201–5205, 1980 32. KORNBLIHTT AR, VIBE-PEDERSEN K, BARALLE PE: Isolation and characterization of cDNA clones for human and bovine fibronectins. Proc Natl Acad Sci USA 80:3218 –3222, 1983 33. MAGNUSON VL, YOUNG M, SCHATTENBERG D, MANCINI M, CHEN D, STEFFENSEN B, KLEBE RJ: The alternative splicing of fibronectin pre-mRNA is altered during aging and response to growth factors. J Biol Chem 266:14654 –14662, 1991 34. SILVER BJ, JAFF FE, ABBOUD HE: Platelet-derived growth factor synthesis in mesangial cells by multiple peptide mitogens. Proc Natl Acad Sci USA 86:1056 –1060, 1989 35. H¨ ANSCH GM, WAGNER C, B¨ URGER A, DONG W, STAEHLER G, STOECK M: Matrix protein synthesis by glomerular mesangial cells in culture: Effects of transforming growth factor b (TGFb) and platelet-derived growth factor (PDGF) on fibronectin and collagen type IV mRNA. J Cell Physiol 163:451– 457, 1995 36. PHILLIPS AO, STEADMAN R, TOPLEY N, WILLIAMS JD: Elevated D-glucose concentrations modulate TGF-b 1 synthesis by human cultured renal proximal tubular cells. The permissive role of plateletderived growth factor. Am J Pathol 147:362–374, 1995 37. KETTELER M, BORDER WA, NOBLE NA: Cytokines and L-arginine in renal injury and repair. Am J Physiol 267:197–207, 1994 38. MUCHANETA-KUBARA EC, SAYED-AHMED N, EL-NAHAS AM: Subtotal nephrectomy: A mosaic of growth factors. Nephrol Dial Transplant 10:320 –327, 1995 39. YOUNG BA, JOHNSON RJ, ALPERS CE, ENG E, GORDON K, FLOEGE J, COUSER WG, SEIDEL K: Cellular events in the evolution of experimental diabetic nephropathy. Kidney Int 47:935–944 1995 40. SHANKLAND SJ, LY H, THAI K, SCHOLEY JW: Increased glomerular capillary pressure alters glomerular cytokine expression. Circ Res 75:844 – 853 1994 41. HERRERA GA, SHULTZ JJ, SOONG SJ, SANDERS PW: Growth factors in monoclonal light-chain related diseases. Human Pathol 25:883– 892 1994